Application of phosphorylation inhibition tool in preparation of medicine for preventing and / or treating triple negative breast cancer

Abstract

The invention relates to application of a phosphorylation inhibition tool in preparation of a medicine for preventing and / or treating triple negative breast cancer. The invention systematically reveals the tumorigenic function of ALDOA S39 site phosphorylation in triple negative breast cancer for the first time, provides a new strategy of ALDOA S39 site phosphorylation as a potential molecular target, and has important clinical application value.

Description

Technical Field

[0001] This invention relates to the field of biomedicine, and more specifically to the use of phosphorylation inhibition tools in the preparation of medicaments for the prevention and / or treatment of triple-negative breast cancer. Background Technology

[0002] Triple-negative breast cancer (TNBC) is an aggressive subtype of breast cancer that lacks expression of estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor-2 (HER2), accounting for 15%-20% of all breast cancers.

[0003] Due to the lack of a clear therapeutic target, TNBC patients are unresponsive to endocrine therapy and HER2-targeted therapy. Treatment primarily includes surgical resection, chemotherapy, and radiotherapy, with adjuvant chemotherapy determined post-operatively based on pathological staging. Commonly used first-line chemotherapy drugs include anthracyclines (such as doxorubicin), taxanes (such as paclitaxel and docetaxel), and platinum-based drugs (such as carboplatin). In recent years, immunotherapy and targeted therapy have been increasingly used in TNBC, showing some efficacy in some patients. Immune checkpoint inhibitors (such as PD-1 / PD-L1 inhibitors) and targeted drugs targeting specific molecular pathways (such as PARP inhibitors) have made some progress in prolonging progression-free survival and improving overall survival.

[0004] However, although these emerging therapies can effectively control the disease to some extent, due to the significant heterogeneity of TNBC and the large differences in molecular characteristics among different patients, uniform treatment plans are difficult to meet diverse needs. Furthermore, new therapies (such as immunotherapy and targeted drugs) are not yet widely available or are expensive in many regions, which exacerbates the inequality of the disease burden and leads to persistently high relapse and mortality rates.

[0005] Therefore, further exploring the molecular mechanisms of TNBC and developing more precise and personalized treatment strategies remain urgent clinical challenges in the field. Summary of the Invention

[0006] The technical problem to be solved by this invention is to provide a more precise and effective treatment strategy for triple-negative breast cancer.

[0007] In recent years, an increasing number of studies have focused on the crucial role of glucose metabolism in tumorigenesis and development, as well as its impact on treatment sensitivity and resistance. Triple-negative breast cancer (TNBC) cells exhibit altered glucose metabolism pathways, which not only enhance their proliferative capacity but also enable them to adapt to stressful conditions such as hypoxia and nutrient restriction. The expression and activity of several key glycolytic enzymes are significantly upregulated in TNBC, among which ALDOA is one of the core enzymes of the glycolytic pathway. ALDOA catalyzes the cleavage of fructose-1,6-bisphosphate (FBP) into glyceraldehyde-3-phosphate (G3P) and dihydroxyacetone phosphate (DHAP), providing energy and biosynthetic precursors for tumor cells. Its expression level is abnormally elevated in various malignant tumors, including lung cancer, liver cancer, and colorectal cancer, promoting cell proliferation and metastasis. However, its specific role and regulatory mechanisms in TNBC remain unclear.

[0008] Post-translational modifications of proteins are a core mechanism for regulating protein function, among which phosphorylation plays a central role in tumor signaling networks due to its reversibility and rapid response. However, research on ALDOA phosphorylation is almost nonexistent, especially since the biological significance of these modifications in tumors remains unclear.

[0009] In recent years, mass spectrometry-based phosphorylation proteomics has identified multiple potential phosphorylation sites for ALDOA, but functional validation of the vast majority of these sites remains lacking. Whether ALDOA participates in tumor progression through specific phosphorylation modifications in TNBC, and how to target these modifications to develop therapeutic strategies, remains an unknown area. The limitations of existing targeted therapies for TNBC further highlight the urgency of exploring new targets. Finding common targets that can cover a broad TNBC population and developing interventions with both therapeutic and diagnostic value are key to overcoming current treatment bottlenecks.

[0010] In other words, although existing research has initially revealed the cancer-promoting function of ALDOA, there are still significant gaps in its specific regulatory mechanism and targeting strategies in TNBC.

[0011] Through extensive research, the inventors verified the effect of ALDOA S39 phosphorylation on TNBC tumor progression, and for the first time defined ALDOA S39 phosphorylation modification as a key driving event of TNBC. They also constructed a complete translational medicine system around this target, from mechanism research to drug development, thus completing this invention.

[0012] The technical solution adopted in this invention is as follows.

[0013] This invention provides the use of a phosphorylation inhibition tool in the preparation of medicaments for the prevention and / or treatment of triple-negative breast cancer, wherein the phosphorylation inhibition tool is a phosphorylation inhibition tool at the S39 site of the ALDOA protein.

[0014] In some implementations, the phosphorylation inhibition tool is a gene editing tool.

[0015] In some implementations, gene editing tools are used to express the S39A mutant of the ALDOA protein in target cells.

[0016] In some implementations, the gene editing tools are selected from the CRISPR / Cas system, Cre-lox-mediated gene recombination, zinc finger endonuclease-directed modification, and transcription activator-like effector nuclease-directed modification.

[0017] In some implementations, the gene-editing tool is the CRISPR / Cas system. In some implementations, the target cells are human triple-negative breast cancer cells.

[0018] In some implementations, the phosphorylation inhibition tool is a specific antibody against phosphorylation at the S39 site of the ALDOA protein.

[0019] In some implementations, the specific antibody is selected from murine antibodies, human antibodies, and humanized antibodies.

[0020] In some implementations, the specific antibody is a multispecific antibody.

[0021] The beneficial effects of the present invention are as follows: On the one hand, this invention, by constructing an S39A mutant to simulate the non-phosphorylated state of the ALDOA protein, clarifies the crucial role of inhibiting phosphorylation at the S39 site of the ALDOA protein in preventing and / or treating the malignant progression of TNBC. The target of this invention is novel and specific. On the other hand, this invention provides a gene-editing tool that targets and regulates phosphorylation modification at the S39 site of the ALDOA protein and applies it to the treatment of TNBC. After gene editing intervention, ALDOA loses its glycolytic regulatory function, thereby significantly inhibiting the proliferation, migration, and invasion of TNBC cells, while simultaneously enhancing apoptosis and inhibiting tumor metabolic reprogramming, achieving the goal of tumor suppression. The gene-editing tool of this invention also showed significant anti-tumor effects in a mouse model. Compared with traditional small molecule drugs, the gene-editing tool of this invention precisely intervenes in phosphorylation modification at the gene level, possessing advantages such as a clear mechanism, strong targeting, and high safety, making it suitable for basic research and potential clinical translation of TNBC targeted therapy, and showing promising application prospects.

[0022] This invention not only deepens the understanding of metabolic heterogeneity in TNBC, but also provides a novel solution to overcome the current challenges of targeted therapy, demonstrating significant scientific value and promising prospects for clinical translation. Attached Figure Description

[0023] Figure 1 The figures shown are schematic diagrams and results for Example 1. In particular, A is a schematic diagram of plasmid construction in Example 1; B and C are Transwell assay results; D is the MTS cell viability assay result; and E and F are scratch repair assay results.

[0024] Figure 2 The figures shown are schematic diagrams and results of Example 2. In the figures, A is a flowchart of Example 2; B and C are Transwell experimental results; D is the MTS cell viability assay result; and E and F are scratch repair assay results.

[0025] Figure 3 The diagrams and results for Example 3 are shown below. A shows the operational process of Example 3; B shows actual photographs of the tumors in each group of mice at the end of 40 days; and C shows the changes in tumor volume in each group of mice. Detailed Implementation

[0026] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood in the technical field to which this application pertains. The following definitions are supplementary to those definitions in the art and relate to this application, but are not extrapolated to any relevant or unrelated situation, such as any conventionally used patent or application. While any methods and materials similar to or equivalent to those described herein may be used in practical testing of this application, the materials and methods described herein are preferred. Therefore, the terminology used herein is intended to describe specific embodiments only and is not intended to limit the invention.

[0027] The terms “including,” “comprising,” or “having”, when used before a step or element, indicate the addition of a further step or element, which is optional and not excluded.

[0028] This invention provides the use of a phosphorylation inhibition tool in the preparation of medicaments for the prevention and / or treatment of triple-negative breast cancer, wherein the phosphorylation inhibition tool is a phosphorylation inhibition tool at the S39 site of the ALDOA protein.

[0029] As used in this article, ALDOA protein is a key enzyme in the glycolysis pathway (EC 4.1.2.13), responsible for catalyzing the breakdown of fructose-1,6-bisphosphate into triose sugars. ALDOA protein provides rapid energy to cells and is often abnormally highly expressed in tumor cells. It rapidly powers cancer cells by promoting the Warburg effect (preferential glycolysis even under aerobic conditions), supporting their proliferation and survival. The sequence of ALDOA protein can be obtained, for example, from UniProt P04075.

[0030] As used herein, phosphorylation inhibition tools refer to tools or methods used to block or reduce protein phosphorylation. For example, phosphorylation inhibition tools can be antibodies targeting specific protein targets, gene editing tools, small molecule inhibitors, or pharmaceutical compositions.

[0031] This invention utilizes a phosphorylation inhibition tool to target and inhibit phosphorylation at the ALDOA S39 site. Specifically, it involves constructing cell lines or animal models expressing a non-phosphorylated mutant (S39A) using a gene-editing CRISPR / Cas9 system, thereby regulating ALDOA function. As demonstrated in the examples below, the phosphorylation inhibition tool of this invention can significantly inhibit the proliferation, migration, and invasion of TNBC cells, induce apoptosis, and significantly slow tumor progression in xenograft tumor models.

[0032] In some implementations, the phosphorylation inhibition tool is a gene editing tool.

[0033] In some implementations, gene editing tools are used to express the S39A mutant of the ALDOA protein in target cells.

[0034] In some implementations, gene editing tools include the CRISPR / Cas system, Cre-lox-mediated gene recombination, zinc finger endonuclease-directed modification, and transcription activator-like effector nuclease-directed modification.

[0035] In some specific implementation schemes, the gene editing tool is the CRISPR / Cas system. For example, the gene editing tool is the CRISPR / Cas9 system, the CRISPR / Cas12 system, the CRISPR / Cas13 system, etc.

[0036] In some implementations, the target cells are human triple-negative breast cancer cells.

[0037] In some implementations, the phosphorylation inhibition tool is a plasmid or cell expressing ALDOA (S39A).

[0038] In the specific implementation plan, the cells expressing ALDOA (S39A) are human triple-negative breast cancer cells.

[0039] In some implementations, the phosphorylation inhibition tool is a specific antibody against phosphorylation at the S39 site of the ALDOA protein.

[0040] In some implementations, the specific antibody is selected from murine antibodies, human antibodies, or humanized antibodies.

[0041] The following describes preferred embodiments of the present invention, but the present invention is not limited to these preferred embodiments. It should be noted that any modifications and improvements made by those skilled in the art based on this inventive concept are within the scope of protection of the present invention. All reagents used, unless otherwise specified, are commercially available conventional products.

[0042] Example 1: Construction of a stable cell line expressing ALDOA (WT / S39E / S39A) with exogenous plasmid in the MDA-MB-231 cell line and detection of cell proliferation, migration and invasion abilities. Mutants mimicking different ALDOA(S39) phosphorylation states were expressed in the MDA-MB-231 triple-negative breast cancer cell line, and the cell behavior of the cell model was assessed to evaluate its proliferation, migration, and invasion abilities. The specific steps are as follows: (1) Cell Culture: After removing the frozen MDA-MB-231 and HEK293T cells from liquid nitrogen, quickly place them in a 37°C water bath and gently shake to thaw them rapidly. After thawing, transfer the cell suspension to centrifuge tubes containing culture medium, centrifuge at 800 rpm for 4 min, discard the supernatant, resuspend the cells in complete DMEM medium, transfer them to culture dishes, shake well, and incubate at 37°C in a 5% CO2 cell culture incubator. When the cells reach 80% confluence, perform passage treatment by digesting with 0.25% trypsin for 2 min, transfer the cell suspension to centrifuge tubes, centrifuge at 800 rpm for 4 min, discard the supernatant, resuspend the cells in complete DMEM medium, transfer them to culture dishes, and passage at a 1:3 ratio. After two passages, the cells are ready for use.

[0043] (2) Construction of expression plasmid: Primers were designed so that the 5' and 3' ends of the target fragment PCR product contained sequences completely identical to the two ends of the pre-inserted linearized vector, respectively, serving as homologous arms. Simultaneously, the target gene amplification primer sequence was added to the primer sequences. The circular vector plasmid was linearized by inverse PCR amplification, and the PCR product was recovered using agarose gel electrophoresis, following the kit instructions. The PCR primers for the pHAGE vector are as follows: F1: 5'-TCGAATTCTTTGGAAGTTTTGTTTC-3' (SEQ ID NO. 1); R1: 5'-GGTGGCAAGCTTAAGTTTAAACG-3' (SEQ ID NO. 2).

[0044] The PCR primers for the ALDOA gene are as follows: F2: 5'-TTAAACTTAAGCTTGCCACCATGCCCTACCAATATCCAGCAC-3' (SEQ ID NO. 3); R2: 5'-CTTCCAAAGAATTCGAATAGGCGTGGTTAGAGACGAAG-3' (SEQ ID NO. 4).

[0045] The PCR primers for site-directed mutagenesis, which mutates serine at position 39 of ALDOA to glutamate (S39E) to simulate phosphorylation, are as follows: F3: 5'-ACTGGGGAGATTGCCAAGCGGCTGCAG-3' (SEQ ID NO. 5); R3: 5'-TTGGCAATCTCCCCAGTGGACTCATCTGCAGC-3' (SEQ ID NO. 6).

[0046] The PCR primers for simulating the dephosphorylation state by mutating serine at position 39 of ALDOA to alanine (S39A) are as follows: F4: 5'-ACTGGGGCCATTGCCAAGCGGCTGCAG-3' (SEQ ID NO. 7); R4: 5'-TTGGCAATGGCCCCAGTGGACTCATCTGCAGC-3' (SEQ ID NO. 8).

[0047] The linearized vector and amplified fragment were ligated proportionally at 37°C for 2 hours. The ligated recombinant plasmid was transformed into DH5α competent cells, incubated on ice for 30 minutes, then heat-shocked at 42°C for 60 seconds, and immediately cooled on ice for 2-3 minutes. 800 μL of antibiotic-free LB liquid medium was added, and the mixture was placed in a shaker at 37°C and 160 rpm for 1 hour. The bacterial culture was centrifuged at 4800 rpm for 5 minutes, 750 μL of supernatant was discarded, and the bacterial cells were resuspended in the remaining medium. The culture was then spread evenly on LB plates containing plasmid-resistant culture medium using a sterile spreader and incubated at 37°C for 12 hours. After 12 hours of incubation, uniform single colonies (0.5-1.0 mm in diameter) were selected for colony PCR amplification. 5 μL of the amplification product was separated by electrophoresis on a 1.5% agarose gel, and the vector construction was determined based on the bands of the amplification product. For positive clones with expected fragment length matching, the plasmid was extracted and sent to Beijing Qingke Biotechnology Co., Ltd. for bidirectional sequencing. The original sequencing peak diagram is globally compared with the reference sequence. When the nucleotide sequence consistency is greater than 99% and the open reading frame remains intact, it is determined to be a correct recombinant plasmid and can be used for downstream experiments.

[0048] like Figure 1 As shown in Figure A, a total of three plasmids were constructed in this experiment: wild-type (WT), simulated phosphorylation (S39E), and simulated dephosphorylation (S39A), with a blank pHAGE plasmid vector used as a control.

[0049] (3) Lentiviral packaging and transfection of MDA-MB-231 cells: HEK293T cells in good growth condition were seeded into 100 mm dishes and transfected when the cell coverage reached 90%. Lentiviral packaging plasmids pMD2G and psPAX2, along with the target vector, were added in a 1:3:4 ratio, totaling 24 μg of DNA, to 2.4 mL of Opti-MEM medium. 50 μL of transfection reagent was added, and the mixture was gently pipetted to mix. After standing at room temperature for 15 min, the mixture was added dropwise to HEK293T culture dishes until the final volume was 7 mL. After culturing for 8 h, the medium was replaced with 7 mL of DMEM complete medium. After 16 h, the medium was replaced with another 7 mL of DMEM complete medium. After 24 h, 3 mL of medium was added to bring the total volume to 10 mL. After 48 h, the supernatant was collected, filtered through a 0.45 µm filter to remove impurities, and the lentivirus solution was stored at -80 °C. MDA-MB-231 cells were seeded into six-well plates to achieve a coverage of approximately 30%. The obtained lentivirus solution was added, and after 16 hours of incubation, the medium was replaced with normal medium. After 48 hours of infection, medium containing 1 μg / mL Puromycin was added, and selection was carried out continuously for 15 days. Cells that had not undergone viral infection treatment were used as controls. When all control cells were screened to death, the entire screening process was completed, and the surviving cells were identified as stable cell lines.

[0050] (4) MTS cell viability assay to detect cell proliferation: Cells in good growth condition were digested with trypsin, and the cell suspension was collected. After cell counting, the cell suspension was diluted to 5000 cells per 100 μL based on the counting results. The cells were then seeded into 96-well plates with 4 replicates per group. After gentle mixing, the plates were incubated in a cell culture incubator. Cells were cultured for 12, 24, and 36 hours, and 20 μL of CellTiter 96 was added to each well. ®AQueous One Solution Reagent was incubated at 37°C with 5% CO2 for 4 hours. Absorbance values ​​were read at 490 nm using a microplate reader to calculate the proliferation capacity of each group. Each experiment was independently repeated three times. The relative cell proliferation rate was calculated as follows: using the OD value of the control group transfected with the pHAGE empty vector as a baseline (set as 100% proliferation rate), the relative proliferation percentage of each experimental group was calculated using the following formula: Relative proliferation rate (%) = (Experimental group OD value / Control group OD value) × 100%. Experimental data are expressed as mean ± standard deviation. One-way ANOVA was used to test for statistical significance between groups, with p < 0.05 considered statistically significant. The final results were plotted as a line graph using Graphpad Prism 9 software. Error bars represent the range of variation in the graph, and significant differences are marked.

[0051] MTS cell viability test results are as follows: Figure 1 As shown in Figure D, the cell proliferation capacity was significantly enhanced after exogenous ALDOA refill. The cell proliferation folds of control cells (pure pHAGE vector), ALDOA (WT), ALDOA (S39E), and ALDOA (S39A) 36 hours after refill were approximately 2.35, 3.07, 3.34, and 2.71 times that of the starting cells, respectively.

[0052] (5) Scratch repair assay to detect cell migration ability: Cells in good growth condition were digested with trypsin, and the cell suspension was collected. The cells were then evenly seeded into six-well plates. Once the cells had completely adhered and the coverage reached over 90%, the cells were removed, washed twice with PBS, and streaked vertically in each well using a sterile 20μL pipette tip. Cells at the scratched areas were washed away with PBS, and the medium was replaced with complete medium containing 1% FBS. The plates were then incubated at 37℃. Two points with the best field of view were selected for each well and each streak, and photographs were taken at 0h, 12h, and 24h. The cell migration area was calculated using ImageJ software, and the results are expressed as mean ± standard deviation (sd).

[0053] Scratch repair experiment results are as follows Figure 1 As shown in E and F, the areas of cell migration after scratching 24 h are approximately 38.4%, 67.8%, 71.9%, and 60.2% of the scratch area, respectively, for control cells (pure pHAGE vector), cells replenished with ALDOA (WT), cells with ALDOA (S39E), and cells with ALDOA (S39A).

[0054] (6) Transwell assay for cell invasion: Matrigel stored at -30℃ was removed and thawed overnight at 4℃. Using a sterile pipette tip pre-cooled to 4℃, high-concentration Matrigel was mixed with ice-cold phenol red-free DMEM medium at a volume ratio of 1:7, and thoroughly mixed by pipetting. 25 μL of the diluted Matrigel was evenly spread on the surface of the Transwell chamber and placed in a 37℃ cell culture incubator for 1 hour to complete the gelation process. Cells in the logarithmic growth phase were selected, and after discarding the medium, they were gently washed twice with PBS. Trypsin-EDTA solution was added and digested at 37℃, and the reaction was terminated by adding complete medium. After centrifuging the cell suspension at 800 rpm for 4 min, the density was adjusted to 2 × 10⁶ cells / mL with serum-free medium. 5 Cells / mL, viability greater than 95% verified by trypan blue staining. 100 μL of cell suspension was added to the matrix gel-coated chamber, and 600 μL of chemotactic medium containing 20% ​​fetal bovine serum was injected into the lower chamber. If air bubbles appeared, the chamber tilt was adjusted with sterile forceps to remove the gas. The cell plate was incubated at 37°C in a cell culture incubator containing 5% CO2 for 48 h. The Transwell chamber was removed, and unmigrated cells were gently wiped from the membrane surface with a pre-moistened nonwoven cloth swab. The cells were fixed with 4% paraformaldehyde at room temperature for 15 minutes and stained with 0.1% crystal violet (containing 20% ​​methanol) for 20 minutes. After washing with PBS, the cells were observed under an inverted fluorescence microscope, and five fields of view were randomly photographed. Cell counting analysis was performed using ImageJ software.

[0055] The results of the Transwell experiment are as follows: Figure 1 As shown in Figures B and C, the number of cells that crossed the matrix gel in the control (pure pHAGE vector) was 14.6 ± 3.7, while the number that crossed the matrix gel after ALDOA (WT) replacement was 68.6 ± 12.7. The number that crossed the matrix gel was the highest after ALDOA (S39E) replacement, at 116.2 ± 12.9, while the number that crossed the matrix gel after ALDOA (S39A) replacement was only 32.4 ± 3.6.

[0056] In summary, the experimental results show that cell migration was significantly enhanced after exogenous ALDOA supplementation. Specifically, supplementation with S39E-mimicking phosphorylated ALDOA further enhanced cell migration, while supplementation with S39A-mimicking dephosphorylated ALDOA resulted in a downregulation of cell migration compared to the WT group. This indicates that phosphorylation modification of ALDOA can enhance the malignant behavior of triple-negative breast cancer cells.

[0057] Example 2: Construction of ALDOA-WT / S39E / S39A gene knock-in triple-negative breast cancer cell lines using CRISPR / Cas9-mediated homology-directed repair technology and detection of their cell proliferation, migration, and invasion abilities. Based on the same therapeutic principle as the exogenous plasmid expression of the ALDOA (S39A) mutant in Example 1, this embodiment uses gene editing to intervene in the phosphorylation state of serine 39 (S39) in the ALDOA gene to inhibit TNBC progression. This is achieved by precisely introducing the S39A mutation into the endogenous ALDOA locus using the CRISPR / Cas9 gene editing system. The specific steps are as follows: (1) Construction of CRISPR-Cas9 gene editing plasmid: sgRNA oligos targeting the S39 codon of the human ALDOA gene were designed and synthesized. Based on the BsmBI restriction site of the LentiCRISPRv2 vector, sticky end sequences identical to those at both ends of the linearized vector were introduced at the 5' and 3' ends of the sgRNA oligos. The circular vector plasmid was linearized by digestion with BsmBI restriction endonuclease, and the linearized vector fragments were separated and recovered by agarose gel electrophoresis. The annealed double-stranded sgRNA oligos and the BsmBI-digested linearized vector were ligated with T4 DNA ligase, transformed into Stbl3 competent cells, plated on LB plates containing ampicillin, and positive clones were screened and sequenced for verification. Simultaneously, a single-stranded DNA oligonucleotide (ssODN) containing the S39 site mutation was designed and synthesized as a homology-directed repair (HDR) template, with sequences homologous to the ALDOA gene target site at its 5' and 3' ends.

[0058] The specific sgRNAs targeting the S39 site of the human ALDOA gene are as follows: 5'-TCCCAGGGAGCATTGCCAAG-3' (SEQ ID NO. 9); The three HDR restoration template sequences are shown in SEQ ID NO. 10 (ALDOA-WT), SEQ ID NO. 11 (ALDOA-S39A), and SEQ ID NO. 12 (ALDOA-S39E), respectively: 5'-CACTGGTGCGGGCAGGAGACAGAATGGGTGGAGGGTGCAGGGTTGGGAGTGGCAGGCTGATCCCCTAATTCCCATGTGACACTCCCAGGATCTATCGCTAAACGGCTGGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTTACCGCCAGCTGCTGCTGACAGCTGACGACCGC-3' (SEQ ID NO. 10); 5'-CACTGGTGCGGGCAGGAGACAGAATGGGTGGAGGGTGCAGGGTTGGGAGTGGCAGGCTGATCCCCTAATTCCCATGTGACACTCCCAGGAGAGATCGCTAAACGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTTACCGCCAGCTGCTGCTGACAGCTGACGACCGC-3' (SEQ ID NO. 11); 5'-CACTGGTGCGGGCAGGAGACAGAATGGGTGGAGGGTGCAGGGTTGGGAGTGGCAGGCTGATCCCCTAATTCCCATGTGACACTCCCAGGAGCAATCGCTAAACGGCTGCAGTCCATTGGCACCGAGAACACCGAGGAGAACCGGCGCTTTACCGCCAGCTGCTGCTGACAGCTGACGACCGC-3' (SEQ ID NO. 12).

[0059] (2) Viral Packaging and Cell Infection: The validated LentiCRISPRv2-sgALDOA plasmid was co-transfected into HEK293T cells with psPAX2 and pMD2G packaging plasmids at a ratio of 4:3:1. Forty-eight hours post-transfection, the supernatant rich in lentiviral particles was collected, filtered through a 0.45 μm filter, and then used to infect triple-negative breast cancer cells with an appropriate amount of viral stock solution, 500 nM ssODN (WT / S39E / S39A), and 8 μg / mL polybrene (to enhance infection efficiency). Sixteen hours after infection, the medium was replaced with fresh complete medium, and after another 24 hours of culture, puromycin was added at a final concentration of 1 μg / mL for selection, establishing a cell pool stably expressing Cas9-sgRNA. The cell pool was seeded into 96-well plates using a limiting dilution method, and single clones were selected and expanded after two weeks of culture.

[0060] like Figure 2 As shown in Figure A, three plasmid-guided repair (HDR) templates were constructed in this experiment: wild-type (WT), simulated phosphorylation (S39E), and simulated dephosphorylation (S39A). Cells infected with LentiCRISPRv2-sgALDOA lentivirus without the addition of HDR repair templates were used as controls.

[0061] (3) Functional verification: The cell proliferation (MTS), migration (scratch repair) and invasion (Matrigel Transwell) capabilities of the single clone cell line with the S39 site mutation successfully knocked in by sequencing and the empty vector control group cells were tested according to the method described in Example 1, and the differences in malignant phenotypes of the cells in each group were compared.

[0062] MTS cell viability test results are as follows: Figure 2 As shown in Figure D, after 36 hours, the cell proliferation folds of the control cells (sgALDOA), cells replenished with ALDOA (WT), cells replenished with ALDOA (S39E), and cells replenished with ALDOA (S39A) were approximately 2.01, 2.60, 2.71, and 2.24 times that of the initial cells, respectively. The scratch repair experiment results are shown in Figure D. Figure 2 As shown in Figures E and F, the areas of cell migration after 24 hours of scratching (control cells (sgALDOA), ALDOA replacement (WT), ALDOA (S39E), and ALDOA (S39A)) accounted for approximately 18.0%, 46.1%, 52.6%, and 38.8% of the scratched area, respectively. The results of the Transwell assay are as follows: Figure 2 As shown in Figures B and C, the number of cells that crossed the matrix gel in the control group (sgALDOA) ​​was 17.8 ± 1.8, while the number that crossed the matrix gel after replacement with ALDOA (WT) was 62.4 ± 5.5. The number that crossed the matrix gel was the highest after replacement with ALDOA (S39E), at 77.2 ± 3.9, while the number that crossed the matrix gel after replacement with ALDOA (S39A) was 43.6 ± 2.4.

[0063] In summary, the experimental results show that phosphorylation mutation (S39E) at the S39 site in TNBC cells significantly enhanced cell proliferation, migration, and invasion abilities, while dephosphorylation mutation (S39A) at the S39 site downregulated these abilities compared to the WT group. This indicates that phosphorylation modification at the ALDOA S39 site enhances the malignant behavior of triple-negative breast cancer cells, while dephosphorylation mutation at the ALDOA S39 site effectively inhibits the progression of triple-negative breast cancer.

[0064] Example 3: Validating the effect of ALDOA(S39) phosphorylation on TNBC tumor progression using a nude mouse xenograft tumor model. (1) CDX mouse model construction: The experimental animals were 6-week-old female Balb / c nude athymic nude mice, all purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. Before the experiment, the mice were acclimatized for one week in the SPF-grade barrier environment of the experimental animal platform. The rearing conditions were: room temperature 26℃, humidity 60%; 12-hour light / dark cycle; and free access to water and food. Sufficient MDA-MB-231 cells were cultured. Cells in the logarithmic growth phase were digested with trypsin, resuspended in pre-cooled PBS, and the cell suspension density was adjusted to 8 × 10⁻⁶. 7 Cells / mL. 12.5 μL (1 × 10⁻⁶ cells / mL) was injected into the fat pad of the fourth mammary gland in mice. 6 The mice were fed a tumor cell line and their growth, activity, and tumor formation were closely monitored. When the tumor was visible to the naked eye, the mice's weight and tumor volume were measured every two days. All experimental procedures were performed in accordance with the requirements of the animal welfare and ethics review. The animal welfare and ethics review approval number is NCPSB-20240315-44MT.

[0065] (2) Evaluation of the effect of ALDOA(S39) phosphorylation modification on tumor growth in vivo: Six-week-old female Balb / cnude athymic nude mice were randomly divided into groups of 5 each. Three types of stable MDA-MB-231 cells expressing ALDOA(WT), ALDOA(S39E), and ALDOA(S39A) were injected into the fat pad of the fourth mammary gland of the mice, respectively. Each group was seeded with 1×10⁻⁶ cells. 6 Each cell. The procedure for this experiment is as follows: Figure 3 As shown in A.

[0066] Tumor growth was observed, and nude mice were weighed every two days to measure and record the longest and shortest diameters of the tumors. On day 40 after cell inoculation, mice were humanely sacrificed, and the tumors were dissected, photographed, and measured. The volume of tumors in all mice did not exceed 2000 mm². 3 Tumor volume (mm) 3 = Major axis (mm) × Minor axis (mm) 2 ×0.52.

[0067] Actual images of tumors in mice at the end of 40 days are shown below. Figure 3As shown in Figure B. In the analysis of tumor volume changes in each group of mice, to clarify the final therapeutic effect of the intervention, statistical comparisons were only performed on the tumor volume data at the experimental endpoint (i.e., the last measurement). The tumor volume data at this time point are expressed as mean ± standard error, and one-way ANOVA was used to test for overall inter-group differences. A p < 0.05 was considered statistically significant. * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001. The final results were generated using Graphpad Prism 9 software. Error bars in the figure represent the range of variation, and significant differences are marked. The results of the tumor volume change curves in each group of mice are shown below. Figure 3 As shown in Figure C, the tumors in mice inoculated with replenished ALDOA (S39E) cells grew the fastest, with a tumor volume of 1238 ± 195.8 mm at the end of 40 days. 3 Secondly, the tumors in mice inoculated with ALDOA cells showed a tumor volume of 430.5 ± 27.82 mm at the end of 40 days. 3 Mice inoculated with replenished ALDOA (S39A) cells showed the slowest tumor growth, with a tumor volume of only 154.9 ± 56.59 mm at the end of 40 days. 3 The differences among the three groups were significant. This indicates that gene editing tools that mimic the non-phosphorylation state of the ALDOA protein using the S39A mutant can significantly slow tumor progression in xenograft tumor models.

[0068] This document uses specific embodiments to illustrate the principles and implementation schemes of the present invention. The descriptions of the embodiments above are merely for the purpose of helping to understand the method and central idea of ​​the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from its principles, and these improvements and modifications also fall under the protection of the claims of the present invention.

Claims

1. The use of a phosphorylation inhibitor in the preparation of medicaments for the prevention and / or treatment of triple-negative breast cancer, characterized in that, The phosphorylation inhibition tool is a phosphorylation inhibition tool for the S39 site of the ALDOA protein.

2. The use as described in claim 1, characterized in that, The phosphorylation inhibition tool is a gene editing tool.

3. The use as described in claim 2, characterized in that, The gene editing tool is used to express the S39A mutant of the ALDOA protein in target cells.

4. The use as described in claim 2, characterized in that, The gene editing tools are selected from CRISPR / Cas system, Cre-lox-mediated gene recombination, zinc finger endonuclease directed modification, and transcription activator effector nuclease directed modification.

5. The use as described in claim 4, characterized in that, The gene editing tool is the CRISPR / Cas system.

6. The use as described in claim 3, characterized in that, The target cells are human triple-negative breast cancer cells.

7. The use as described in claim 1, characterized in that, The phosphorylation inhibition tool is a specific antibody against phosphorylation at the S39 site of the ALDOA protein.

8. The use as described in claim 7, characterized in that, The specific antibody is selected from murine antibodies, human antibodies, and humanized antibodies.

9. The use as described in claim 7, characterized in that, The specific antibody is a multispecific antibody.

Images