Fusion antigen of porcine reproductive and respiratory syndrome virus, kit as well as preparation method and application of fusion antigen

By using luciferase immunoprecipitation and a kit for the GLuc-nsp7 fusion protein, the problem of rapid and accurate detection of porcine reproductive and respiratory syndrome virus-specific antibodies in existing technologies has been solved, achieving early diagnosis with high sensitivity and accuracy.

CN120842441APending Publication Date: 2025-10-28YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511044599.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Existing technologies are insufficient for the rapid and accurate detection of porcine reproductive and respiratory syndrome virus (PRRSV) specific antibodies, especially for early diagnosis and quantitative analysis.

Method used

The infection of porcine reproductive and respiratory syndrome virus (PRRSV) was detected by fluorescence intensity using the luciferase immunoprecipitation method with GLuc-nsp7 fusion protein as the fusion antigen. The corresponding kit was prepared, including components such as sample diluent, blocking solution, ELISA plate, washing solution, and luciferase substrate.

Benefits of technology

It enables rapid, simple, highly sensitive, and high signal-to-noise ratio detection of PRRSV-specific antibodies, and can report results within 3 hours. It is not limited by technology, is easy to operate, highly specific, and highly accurate, making it suitable for early diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120842441A_ABST
    Figure CN120842441A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of virus detection, in particular to a porcine reproductive and respiratory syndrome virus fusion antigen, a kit and a preparation method and application thereof, and provides the porcine reproductive and respiratory syndrome virus fusion antigen which is GLuuc-nsp7 fusion protein, the nucleotide sequence of the fusion antigen is shown as SEQ ID No. 1, and the nucleotide sequence of the fusion antigen is shown as SEQ ID No. The amino acid sequence of the antigen is shown as SEQ ID No.2. Based on the antigen, a luciferase co-immunoprecipitation method can be adopted, the antigen can be used for infection detection of the porcine reproductive and respiratory syndrome virus according to fluorescence intensity, and the method is rapid, simple, convenient, high in sensitivity and signal-to-noise ratio and stable and reliable in measured value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of virus detection technology, specifically to a fusion antigen of porcine reproductive and respiratory syndrome virus, a reagent kit, its preparation method, and its application. Background Art

[0002] Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) is a single-stranded positive-sense RNA virus belonging to the genus Arteritisvirus in the family Arteritisviridae. The main clinical symptoms of PRRS are abortion, stillbirth, premature birth, weak piglets, mummified fetuses in breeding sows, and respiratory diseases in growing pigs of all ages (especially piglets). It easily leads to secondary infections related to swine respiratory diseases. Boars exhibit symptoms such as anorexia, lethargy, and decreased semen quantity and quality. PRRSV is transmitted through various routes, including contact with infected pigs, placental transmission, semen transmission, and milk transmission. Once infected, pigs can continuously shed the virus for 2-14 weeks, spreading it to other pigs through direct contact or contaminated feed, utensils, and aerosols, thus causing the infection area to continuously expand.

[0003] Vaccination is a crucial measure for controlling PRRSV. Currently, there are many types of vaccines available, primarily inactivated and live attenuated vaccines. However, due to the high variability of PRRSV and the existence of multiple genotypes, various strains can infect pig herds, posing a significant challenge to PRRSV immunization and control. Therefore, an effective PRRSV diagnostic method is urgently needed.

[0004] Currently, various methods have been established to detect PRRSV-specific antibodies as serological markers of PRRSV infection, such as enzyme-linked immunosorbent assay (ELISA), indirect immunofluorescence assay (IFA), immunoperoxidase monolayer assay (IPMA), and serum neutralization test (SN). Although commercial tests such as ELISA are highly sensitive for detecting PRRSV-specific antibodies in serum samples, ELISA is not suitable for quantitative analysis of antibody levels because the OD value of ELISA typically varies within a narrow range (0.1-2). IFA and IMA require trained personnel and time-consuming multi-step procedures, and the interpretation of IFA results varies from person to person, so although it can be used for early diagnosis, it cannot be widely applied. Although SN has good detection specificity, it can only be detected 4-6 weeks after infection, which is also not suitable for early detection. Therefore, there is an urgent need to develop an improved method for accurately detecting and quantifying PRRSV-specific antibodies. Summary of the Invention

[0005] The purpose of this invention is to provide a fusion antigen of porcine reproductive and respiratory syndrome virus (PRRSV), a kit, a preparation method thereof, and its application. This invention uses luciferase immunoprecipitation, which can be used to detect PRSV infection based on fluorescence intensity. This method is rapid, simple, highly sensitive, has a high signal-to-noise ratio, and provides stable and reliable measurements.

[0006] The objective of this invention is achieved through the following technical solution:

[0007] The present invention provides a fusion antigen of porcine reproductive and respiratory syndrome virus, wherein the fusion antigen is a GLuc-nsp7 fusion protein, the nucleotide sequence of which is shown in SEQ ID No.1 and the amino acid sequence of which is shown in SEQ ID No.2.

[0008] The present invention also provides a method for constructing the aforementioned fusion antigen, comprising the following steps:

[0009] (1) Using plasmid pCMV-GS2022 as a template, the nsp7 fragment was amplified. Then, the amplified nsp7 antigen gene fragment was digested with EcoRV and XhoI double enzymes with pCAGGS-GLuc vector plasmid carrying GLuc gene. The digestion products were ligated with T4 ligase to obtain recombinant plasmid pCAGGS-GLuc-nsp7.

[0010] (2) After transfecting cells with the recombinant plasmid pCAGGS-GLuc-nsp7, the cells were cultured, the cell supernatant was collected, and the supernatant was collected again after centrifugation to obtain the fusion protein GLuc-nsp7.

[0011] Furthermore, in step (1), the primers used to amplify the nsp7 fragment are shown in SEQ ID No. 3-4.

[0012] The present invention also provides the use of the fusion antigen in the preparation of products for detecting porcine reproductive and respiratory syndrome virus.

[0013] Furthermore, the products include testing reagents and kits.

[0014] The present invention also provides a kit for detecting porcine reproductive and respiratory syndrome virus, the kit comprising the fusion antigen as described in claim 1, sample diluent, blocking solution, protein A-coated ELISA plate, washing solution, luciferase substrate, positive control, and negative control.

[0015] Furthermore, the sample diluent is phosphate buffer with pH 7.4; the washing solution is PBS solution containing 1% Triton X-100; and the luciferase substrate is 20 μM coelenterate h.

[0016] Furthermore, the method for preparing the protein A-coated ELISA plate is as follows: protein A is dissolved in PBS to a concentration of 2 μg / mL, and the protein A solution is added to the ELISA plate at 100 μL per well. The ELISA plate is then coated with a membrane, incubated at 4°C for 16 h, the protein A solution is discarded, and 200 μL / well is washed 5 times with PBS. The plate is then dried and stored at 4°C.

[0017] Furthermore, the blocking solution is 10% skim milk, and the amount of the fusion antigen added is 10%. 7 One fluorescent unit.

[0018] The present invention also provides a detection method for the aforementioned kit, comprising the following steps:

[0019] (1) Remove the kit from the refrigerated environment and allow it to equilibrate to room temperature for 15 minutes before use;

[0020] (2) After the protein A-coated microplate is equilibrated at room temperature, add 150 μL of blocking buffer to each well, incubate at 25°C for 1 h, then discard the buffer. Add 200 μL of washing buffer to each well, let stand for 5 min, then discard the buffer. Repeat this washing process 5 times, and finally dry the reaction plate.

[0021] (3) Dilute the serum sample to be tested, the positive control, and the negative control sample 50 times with sample diluent before use;

[0022] (4) Dilute the GLuc-nsp7 fusion antigen to 10 using sample diluent. 7 One fluorescent unit;

[0023] (5) Take the diluted sample to be tested and the control serum and mix them with 10 ml of water. 7 A total of 100 μL of Gluc-nsp7 fusion antigen with 1 fluorescent unit was added to a protein A-coated ELISA plate.

[0024] (6) Cover the reaction plate with a sealing film and incubate it in a 37°C incubator for 1 hour;

[0025] (7) Shake off the reaction liquid in the well, fill each reaction well with washing liquid, let stand for 5 minutes, and then discard the washing liquid; wash in this way 5 times, and finally dry the reaction plate.

[0026] (8) Add 100 μL of luciferase substrate to each well, place it in a LumiStation-1800 luminescence detector to detect the fluorescence value, and record it;

[0027] (9) When the test value of the serum sample to be tested / the average value of the negative test is ≥5.343, it is judged as positive.

[0028] Beneficial effects:

[0029] (1) The GLuc-nsp7 fusion antigen selected in this invention is expressed in cell supernatant in secretory form. It is highly efficient, simple to prepare, low in cost, and does not require cumbersome steps such as protein purification.

[0030] (2) This invention has high specificity and does not cross-react with African swine fever virus (ASFV), porcine gettavirus (GETV), Zineka virus (SVA), porcine transmissible gastroenteritis virus (TGEV), porcine pseudorabies virus (PRV), porcine deltacoronavirus (PDCoV), and porcine circovirus type 2 (PCV2).

[0031] (3) The positive and negative serum samples of porcine reproductive and respiratory syndrome virus detected by the kit have a 100% concordance rate with the immunofluorescence detection results, and the accuracy is high.

[0032] (4) The present invention is quick and simple to operate, and the results can be reported in 3 hours. It is not limited by technology and can be operated by operators according to the instructions.

[0033] (5) The present invention has high stability, with intra-batch and inter-batch variation coefficients both less than 15%. Attached Figure Description

[0034] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0035] Figure 1 This is a schematic diagram of the construction of the pCAGGS-GLuc-nsp7 plasmid in this invention;

[0036] Figure 2 This diagram shows the expression and verification analysis of the recombinant GLuc-nsp7 protein in this invention, where A represents the expression verification and B represents the expression level verification.

[0037] Figure 3 The diagram shows the analysis of the optimal reaction time and optimal washing solution in this invention, where A represents a reaction time of 30 min and B represents a reaction time of 60 min.

[0038] Figure 4 This is an analytical graph showing the determination of the optimal antigen concentration and the optimal serum dilution factor in this invention, where AC represents the detection results of different positive sera and DF represents the detection results of different negative sera.

[0039] Figure 5This is an analysis diagram showing the determination of positive and negative threshold values ​​for the luciferase immunoprecipitation detection method for porcine reproductive and respiratory syndrome virus in this invention. In the diagram, A is the ROC curve and B is the S / N value distribution.

[0040] Figure 6 This is a specific experimental analysis diagram of the luciferase immunoprecipitation detection method for porcine reproductive and respiratory syndrome virus in this invention;

[0041] Figure 7 The graph shows the sensitivity analysis of the luciferase immunoprecipitation method for detecting porcine reproductive and respiratory syndrome virus in this invention. In this invention, A represents the sensitivity of the kit and B represents the sensitivity of existing detection kits.

[0042] Figure 8 The figure shows the clinical sample detection results of the luciferase immunoprecipitation detection method for porcine reproductive and respiratory syndrome virus in this invention. In the figure, A represents the detection results of the kit in this invention, and B represents the detection results of the existing detection kit. Detailed Implementation

[0043] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0044] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each smaller range between any intermediate value within a stated value or stated range and any other stated value or intermediate value within the stated range is also encompassed by the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0045] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0046] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0047] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0048] Unless otherwise specified, all chemical reagents, biochemical reagents and materials used in this invention are commercially available.

[0049] The present invention will now be described in detail with reference to the accompanying drawings, so that the advantages and features of the invention can be more easily understood by those skilled in the art, thereby providing a clearer and more definite definition of the scope of protection of the present invention. However, this does not limit the present invention to the scope of the described embodiments. The reagents and raw materials used in the following embodiments are all commercially available, and the test methods without specific conditions are generally performed under conventional conditions or according to the conditions recommended by the respective manufacturers. Furthermore, unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0050] Example 1: Preparation of the GLuc-nsp7 fusion protein of porcine reproductive and respiratory syndrome virus (PRRSV)

[0051] 1.1 Construction of the recombinant plasmid pCAGGS-GLuc-nsp7 eukaryotic expression vector

[0052] Based on the complete gene sequence of the nsp7 protein of PRRSV GS2022 strain, using plasmid pCMV-GS2022 (constructed and preserved in our laboratory) as a template, the nsp7 fragment was amplified using primers FAAAGATATCTCACTGACTGGTGCTCTC (SEQ ID No. 3) and R: AAACTCGAGTCATTCCCACTGGGCCCTCA (SEQ ID No. 4). Its nucleotide sequence is shown in SEQ ID No. 1, and the corresponding amino acid sequence is shown in SEQ ID No. 2. The obtained nsp7 antigen gene fragment was then digested with the pCAGGS-GLuc vector plasmid (constructed and preserved in our laboratory) containing the GLuc gene using EcoRV and XhoI double digestion. The digestion products were then ligated using T4 ligase to obtain the recombinant plasmid pCAGGS-GLuc-nsp7. Figure 1 ).

[0053] 1.2 Expression and validation of recombinant GLuc-nsp7 protein

[0054] At 10cm 2 HEK-293T cells were cultured in cell culture dishes. When the cell density reached 60-70%, 8 μg of recombinant plasmid was transfected into the 293T cells at a ratio of 1.5 μL:1 μg using Lipofectamine 2000 liposome nucleic acid transfection reagent (Invitrogen). The cells were then cultured in an incubator at 37°C and 5% CO2. After 72 h of culture, the cell supernatant was collected and centrifuged at 12,000 rpm for 15 min at 4°C to remove cell debris. The collected supernatant was the fusion protein GLuc-nsp7.

[0055] The expression of GLuc-nsp7 was verified by Western blotting and Luciferase experiments:

[0056] The protein membrane was blocked in PBS buffer containing 5% w / v skim milk powder at room temperature for 1 h, then incubated with 1:5000 diluted anti-FLAG antibody for 1 h. After washing five times with PBS containing 0.05% Tween 20 (PBST), the membrane was incubated with 1:5000 diluted goat anti-mouse horseradish peroxidase-labeled secondary antibody at room temperature for 1 h. After washing five times with PBST, the membrane was detected using a chemiluminescence assay kit. The results showed that the supernatant of cells transfected with pCAGGS-GLuc-nsp7 contained secreted GLuc-nsp7 (… Figure 2 A).

[0057] The collected cell supernatant was analyzed for GLuc luciferase activity. 20 μL of cell supernatant was reacted with 100 μL of the GLuc fluorescent substrate, coelenterin h (20 μM). GLuc luciferase activity was detected using a LumiStation-1800 luminescence detector. Results showed that GLuc luciferase activity was clearly detected in the cell supernatant, with the undiluted cell supernatant exhibiting a fluorescence unit of 10-1. 8 units / 100μL ( Figure 2 B).

[0058] Example 2: Parameter optimization experiment of luciferase immunoprecipitation detection method for porcine reproductive and respiratory syndrome virus based on recombinant protein GLuc-nsp7 protein.

[0059] 2.1 Determination of optimal reaction time and washing solution

[0060] Protein A was diluted to a concentration of 2 μg / mL with PBS at pH 7.4. The protein A solution was added to 100 μL wells of an ELISA plate, which was then covered with a membrane and incubated at 4°C for 16 h. The next day, the solution was discarded, and the plate was washed five times with PBS for 5 min each time. The plate was then blocked with 10% skim milk at 37°C for 1 h, after which the blocking solution was discarded, and the plate was washed five times with PBS for 5 min each time. A standard GETV positive or negative porcine serum sample and 10 μL of PBS were added to each sample well. 7 100 μL of GLuc-nsp7 fusion protein (fluorescent units) was incubated at 37 °C for 30 min and 1 h, respectively. Washing buffers included PBST (0.05% Triton X-100), PBST (0.1% Triton X-100), PBST (0.5% Triton X-100), and PBST (1% Triton X-100). Afterward, the reaction liquid in each well was dried, and each well was filled with diluted PBST. The wells were allowed to stand for 5 min, and the wash buffer was discarded. This washing process was repeated 5 times, and the plate was dried completely on the last wash. 100 μL of luciferase substrate was added to each well, and the fluorescence value was detected and recorded using a LumiStation-1800 luminescence detector.

[0061] The results show the p / N values ​​calculated under each condition, such as... Figure 3 As shown, under each reaction condition, the optimal conditions were 37℃ for 1 h of reaction and pBST (1% Triton X-100) as the washing solution, with p1N of 635.22, p2N of 446.313, and P3 / N of 15.691, which were superior to other conditions.

[0062] 2.2 Determination of Optimal Antigen Concentration and Optimal Serum Dilution Factor

[0063] Following the steps in 2.1, the protein A ELISA plate was coated and blocked with 10% skim milk at 25°C for 1 hour. The optimal antigen concentration and the best serum dilution factor were determined using the extreme serum dilution method. First, PRRSV positive serum was serially diluted twofold (initial dilution factor 1:25) to 800-fold; then, each dilution of PRRSV porcine positive serum was diluted with 10... 9 10 8 10 7 10 6A mixture of GLuc-nsp7 fusion protein at 1 fluorescent unit was added to an ELISA plate and incubated at 37°C for 1 hour. Subsequently, the reaction liquid in the wells was dried, and each well was filled with diluted PBST (1% Triton X-100) wash buffer. After standing for 5 minutes, the wash buffer was discarded. This washing process was repeated 5 times, and the plate was dried completely on the last wash. 100 μL of luciferase substrate was added to each well, and the fluorescence value was detected and recorded using a LumiStation-1800 luminescence detector.

[0064] The results show the calculated P / N values ​​under each condition, such as... Figure 4 As shown, under each reaction condition: the amount of antigen added is 10... 7 The optimal fluorescence unit was achieved when the serum was diluted 1:50; the mean P1 / N ratio was 625.994, the mean P2 / N ratio was 464.932, and the mean P3 / N ratio was 11.646, which were superior to other conditions.

[0065] Example 3: Determination of positive and negative threshold values ​​for luciferase immunoprecipitation detection of porcine reproductive and respiratory syndrome virus.

[0066] Based on the optimal reaction conditions determined in Example 2, 101 negative serum samples and 154 positive serum samples of porcine reproductive and respiratory syndrome virus (PRRSV) were tested under these optimal conditions. ROC curve analysis of the test results yielded a critical value of 5.343, indicating a specificity and sensitivity of 100%. Figure 5 As shown.

[0067] Example 4: Repeatability test of luciferase immunoprecipitation method for detecting porcine reproductive and respiratory syndrome virus.

[0068] Based on the optimal operating conditions of the established luciferase immunoprecipitation assay method, intra-batch and inter-batch repeatability tests were performed. The results are shown in Table 1-2. The inter-batch and intra-batch coefficients of variation of the luciferase immunoprecipitation assay method for detecting PRRSV established in this experiment are less than 15%, indicating that this method has good repeatability.

[0069] Table 1 Results of Intra-Batch Repeatability Tests

[0070]

[0071] Table 2 Results of inter-batch repeatability testing

[0072]

[0073] Example 5: Concordance rate experiment of luciferase immunoprecipitation method for detecting porcine reproductive and respiratory syndrome virus.

[0074] First, using the gold standard for antibody detection—indirect immunofluorescence assay—we identified 154 GETV positive and 101 GETV negative serum samples from pigs preserved in this study. These samples were then tested using a luciferase immunoprecipitation assay for porcine reproductive and respiratory syndrome virus (PRRSV). The concordance rate between negative and positive samples reached 99%, indicating that the established luciferase immunoprecipitation assay for porcine gehtavirus can be used for clinical detection of PRRSV antibodies and has practical value.

[0075] Example 6: Detection kit for porcine reproductive and respiratory syndrome virus based on recombinant protein GLuc-nsp7.

[0076] The luciferase immunoprecipitation kit used in this embodiment for detecting porcine reproductive and respiratory syndrome virus includes the following components: sample diluent, blocking buffer, GLuc-nsp7 protein solution, protein A-coated ELISA plate, washing buffer, luciferase substrate, positive control, and negative control. The sample diluent is phosphate buffer at pH 7.4; the washing buffer is PBS solution containing 1% Triton X-100; and the luciferase substrate is 20 μM coelenterate h.

[0077] The preparation and storage method of the above protein A-coated ELISA plate is as follows: dissolve protein A in PBS to a concentration of 2 μg / mL, add the above protein A solution to the ELISA plate at 100 μL wells, cover the ELISA plate with a membrane, incubate at 4℃ for 16 h, discard the protein A solution, wash 5 times with PBS at 200 μL / well, and dry and store at 4℃.

[0078] The method for constructing this luciferase immunoprecipitation kit is as follows:

[0079] S1. Preparation of porcine reproductive and respiratory syndrome virus GLuc-nsp7 fusion protein solution;

[0080] S2. Determine that the sealing solution is 10% skim milk;

[0081] S3. Set the sealing temperature to 25℃ and the sealing time to 1 hour;

[0082] S4. Determine the incubation temperature as 37℃ and the incubation time as 1 hour;

[0083] S5. Determine the amount of fusion antigen added is 10. 7 One fluorescent unit;

[0084] S6. Determine the serum dilution ratio to be 1:50.

[0085] The detection method of this luciferase immunoprecipitation kit is as follows:

[0086] S1. Equilibration: Remove the kit from the refrigerated environment and allow it to equilibrate to room temperature for 15 minutes before use;

[0087] S2. Blocking: After the protein A-coated microplate has been equilibrated at room temperature, add 150 μL of blocking buffer to each well and incubate at 25°C for 1 h. Then discard the buffer. Add 200 μL of washing buffer to each well, let stand for 5 min, and then discard the buffer. Repeat this washing process 5 times. Finally, dry the microplate.

[0088] S3. Sample dilution: Dilute the serum sample to be tested, the positive control, and the negative control sample 50 times with the sample diluent before use;

[0089] S4. Dilution of fusion protein solution: Dilute the GLuc-nsp7 fusion antigen to 107 fluorescent units using sample diluent;

[0090] S5. Sample addition: Mix the diluted sample to be tested and the control serum with 107 fluorescent units of GLuc-nsp7 fusion antigen, totaling 200 μL, and add them to the blocked protein A-coated ELISA plate.

[0091] s6. Reaction: Cover the reaction plate with a sealing film and incubate at 37°C for 1 hour;

[0092] S7. Washing the plate: Shake off the reaction liquid in the wells, fill each well with diluted washing solution, let stand for 5 minutes, and then discard the washing solution; wash 5 times in this way, and finally dry the reaction plate.

[0093] S8. Add substrate and detect: Add 100 μL of luciferase substrate to each well, place in a LumiStation-1800 luminescence detector to detect the fluorescence value, and record it;

[0094] S9. Result determination: When the ratio of the test value of the serum sample to the average negative test value is ≥5.343, it is judged as positive.

[0095] Example 7: Specificity test of luciferase immunoprecipitation method for detecting porcine reproductive and respiratory syndrome virus.

[0096] Using the kit constructed in this invention, positive serum samples for African swine fever virus (ASFV), porcine Geytavirus (GETV), Zineka virus (SVA), transmissible gastroenteritis virus (TGEV), porcine pseudorabies virus (PRV), porcine deltacoronavirus (PDCoV), and porcine circovirus type 2 (PDCoV) were detected. The results are as follows: Figure 6 The kits used in this embodiment of the invention showed no false positive results and good specificity.

[0097] Example 8: Sensitivity test of the luciferase immunoprecipitation method for detecting porcine reproductive and respiratory syndrome virus.

[0098] Using the kit constructed in this invention, serum was serially diluted from 1 / 25 to 1 / 51200, and compared with a commercially available IDEXX PRRS 2XR ELISA kit. Results are as follows: Figure 7 The results show that for PRRSV weakly positive serum, the detection limit of the kit in this embodiment of the invention is 1 / 800, and the detection limit of the IDEXX PRRS 2XR ELISA kit is 1 / 100, indicating that the kit in this embodiment of the invention has high detection sensitivity.

[0099] Example 9: Clinical Sample Detection Experiment of Porcine Reproductive and Respiratory Syndrome Virus Using Luciferase Immunoprecipitation.

[0100] The luciferase immunoprecipitation method for detecting porcine geistovirus established in this invention was used to detect the virus in porcine serum at 0, 3, 8, 10, 14, and 22 days post-infection. The results were compared using a commercially available IDEXX PRRS 2XR ELISA kit. Figure 8 The results show that, for PRRSV-positive serum, the kit of this embodiment can detect PRRSV-positive serum as early as day 3 after challenge, while the commercially available IDEXX PRRS 2XR ELISA kit can detect PRRSV-positive serum as early as day 8 after challenge. This indicates that the kit of this embodiment can effectively identify PRRSV serum in the early stage of infection.

[0101] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A fusion antigen of porcine reproductive and respiratory syndrome virus, characterized in that, The fusion antigen is a GLuc-nsp7 fusion protein, the nucleotide sequence of which is shown in SEQ ID No. 1 and the amino acid sequence of which is shown in SEQ ID No.

2.

2. The method for constructing a fusion antigen as described in claim 1, characterized in that, The following steps are involved: (1) Using plasmid pCMV-GS2022 as a template, the nsp7 fragment was amplified. Then, the amplified nsp7 antigen gene fragment was digested with EcoRV and XhoI double enzymes with pCAGGS-GLuc vector plasmid carrying GLuc gene. The digestion products were ligated with T4 ligase to obtain recombinant plasmid pCAGGS-GLuc-nsp7. (2) After transfecting cells with the recombinant plasmid pCAGGS-GLuc-nsp7, the cells were cultured, the cell supernatant was collected, and the supernatant was collected again after centrifugation to obtain the fusion protein GLuc-nsp7.

3. The construction method as described in claim 2, characterized in that, In step (1), the primers used to amplify the nsp7 fragment are shown in SEQ ID No. 3-4.

4. The use of the fusion antigen as described in claim 1 in the preparation of products for detecting porcine reproductive and respiratory syndrome virus.

5. The application as described in claim 4, characterized in that, The products include testing reagents and kits.

6. A kit for detecting porcine reproductive and respiratory syndrome virus, characterized in that, The kit includes the fusion antigen as described in claim 1, sample diluent, blocking solution, protein A-coated ELISA plate, washing solution, luciferase substrate, positive control, and negative control.

7. The kit according to claim 6, characterized in that, The sample diluent was a phosphate buffer solution with pH 7.4; the washing solution was a PBS solution containing 1% Triton X-100; and the luciferase substrate was 20 µM coelenterate h.

8. The reagent kit as described in claim 6, characterized in that, The method for preparing the protein A-coated ELISA plate is as follows: dissolve protein A in PBS to a concentration of 2 μg / mL, add 100 μL of the protein A solution to the ELISA plate at 100 μL / well, cover the ELISA plate with a membrane, incubate at 4℃ for 16 h, discard the protein A solution, wash 5 times with 200 μL / well of PBS, and dry and store at 4℃.

9. The reagent kit as described in claim 6, characterized in that, The blocking solution is 10% skim milk, and the amount of fusion antigen added is 10%. 7 One fluorescent unit.

10. The detection method of the reagent kit according to any one of claims 6-9, characterized in that, The following steps are involved: (1) Remove the kit from the refrigerated environment and allow it to equilibrate to room temperature for 15 minutes before use; (2) After the protein A-coated microplate is equilibrated at room temperature, add 150 μL of blocking buffer to each well, incubate at 25°C for 1 h, then discard the buffer. Add 200 μL of washing buffer to each well, let stand for 5 min, then discard the buffer. Repeat this washing process 5 times, and finally dry the reaction plate. (3) Dilute the serum sample to be tested, the positive control and the negative control sample 50 times with the sample diluent before use; (4) Dilute the GLuc-nsp7 fusion antigen to 10 with sample diluent. 7 One fluorescent unit; (5) Take the diluted sample to be tested and the control serum and mix them with 10 ml of water. 7 A total of 100 μL of Gluc-nsp7 fusion antigen with 1 fluorescent unit was mixed and added to a protein A-coated ELISA plate. (6) Cover the reaction plate with a sealing film and incubate at 37°C for 1 hour; (7) Shake off the reaction liquid in the well, fill each reaction well with washing liquid, let stand for 5 minutes, and then discard the washing liquid; wash in this way 5 times, and finally dry the reaction plate. (8) Add 100 μL of luciferase substrate to each well, place it in a LumiStation-1800 luminescence detector to detect the fluorescence value, and record it; (9) When the test value of the serum sample to be tested / the average value of the negative test is ≥5.343, it is judged as positive.