Pesticide composition compounded by pesticide and detoxification gene dsRNA and application of pesticide composition in prevention and control of nematodes

Abstract

The invention discloses a pesticide composition compounded by pesticide and detoxification gene dsRNA and application of the pesticide composition in prevention and control of nematodes. The method comprises the following steps: soaking pine wood nematodes by adopting a fluopyram agent with LC20 concentration, collecting samples at different time points respectively, carrying out transcriptome analysis, and screening out obviously up-regulated pine wood nematode detoxification genes BxGST, BxATP and BxVCat by comparing gene expression differences at different time points. Designing and synthesizing double-stranded RNA aiming at the detoxification genes, and compounding the double-stranded RNA with fluopyram to obtain the pesticide compound composition for preventing and treating pine wood nematodes. Nematicidal test results prove that the pesticide compound composition has a remarkable synergistic control effect on pine wood nematodes, is expected to become an efficient pine wood nematode control agent, and provides a new strategy and theoretical basis for control of pine wood nematode diseases.

Description

Technical Field

[0001] This invention relates to a combination of pesticides and dsRNA, and more particularly to a combination of fluopyram and dsRNA designed with detoxification genes as targets, and its application in the control of pine wilt disease, belonging to the field of pine wilt disease control. Background Art

[0002] Pine wilt disease, also known as pine rot, is a devastating disease of pine forests caused by the pine wood nematode. The pine wood nematode, *Bursaphelenchus xylophilus* (Steiner & Buhrer), belongs to the phylum Nematoda, order Aphelenchida, family Aphelenchoididae, and genus *Bursaphelenchus*. Infected pine trees gradually experience a decrease in resin secretion; the needles initially fade and yellow, then wither and turn reddish-brown, eventually leading to the death of the entire tree. Pine trees infected with the pine wood nematode develop the disease rapidly, leading to complete death of the pine tree within 30-90 days. The mortality rate is extremely high, and large-scale forest stand death can occur within 3-5 years.

[0003] The expression of detoxification genes plays a crucial role in regulating the tolerance of pine wood nematodes to pesticide treatments. By comparing the differences in gene expression at different time points in pine wood nematodes, significantly upregulated detoxification genes were screened out. These upregulated detoxification genes may be closely related to the resistance of pine wood nematodes to fluopyram. Based on the screened upregulated detoxification genes, double-stranded RNAs targeting key detoxification genes were further designed and synthesized, which can provide a new control approach for effectively killing pine wood nematodes. Summary of the Invention

[0004] One objective of this invention is to provide a compound composition of fluopyram and dsRNA designed with the detoxification gene of pine wood nematode as the target;

[0005] A second objective of this invention is to apply the aforementioned combination of fluopyram and dsRNA to the control of pine wood nematodes.

[0006] To achieve the above objectives, the main technical solutions adopted by the present invention include:

[0007] This invention discloses a compound composition of fluopyram and dsRNA, wherein the fluopyram is preferably fluopyram with a concentration of 98.26%.

[0008] The expression of detoxification genes plays a crucial role in regulating the tolerance of pine wood nematodes to pesticide treatments; to further investigate the pesticide resistance mechanisms of pine wood nematodes, this invention employs LC... 20Pine wood nematodes were treated with a concentration of fluopyram, and samples were collected at 0, 12, 24, and 48 hours for transcriptome analysis. By comparing gene expression differences at different time points, significantly upregulated detoxification genes BxGST, BxATP, and BxVCat were identified. These upregulated detoxification genes may be closely related to the resistance of pine wood nematodes to fluopyram. Based on the screening results, double-stranded RNAs, dsBxGST, dsBxATP, and dsBxVCat, were designed for the detoxification genes BxGST, BxATP, and BxVCat, respectively.

[0009] The dsBxGST ​​consists of a sense strand and an antisense strand that is its anticomplement, and the nucleotide sequence of the sense strand is shown in SEQ ID No. 1.

[0010] The dsBxATP consists of a sense strand and an antisense strand that is inversely complementary to it, and the nucleotide sequence of the sense strand is shown in SEQ ID No. 2;

[0011] The dsBxVCat consists of a sense strand and an antisense strand that is its anticomplement, and the nucleotide sequence of the sense strand is shown in SEQ ID No. 3;

[0012] This invention has found that the nematicidal effects of different dsRNAs vary significantly. Among them, dsBxGST, designed to target the detoxification gene BxGST, has the most significant nematicidal effect, which is significantly better than the nematicidal effects of other dsRNAs.

[0013] The experimental results showed that fluopyram alone had a significant toxic effect on pine wood nematodes, and its LC50 was [missing information]. 50 The median lethal concentration (LD50) was 0.292 mg / L. When the three dsRNA agents (dsBxGST, dsBxATP, and dsBxVCat) were used alone to treat pine wood nematodes, the corrected mortality rates were 5.27%, 3.31%, and 2.29%, respectively, indicating relatively weak efficacy. However, when fluopyram was used in combination with dsRNA, its insecticidal effect was significantly enhanced. The combination of fluopyram and dsBxGST ​​performed best, with a corrected mortality rate as high as 84.89%, significantly superior to the use of fluopyram alone or the other two combination agents (fluopyram·dsBxATP and fluopyram·dsBxVCat).

[0014] The pesticide composition obtained by combining fluopyram and dsRNA in this invention shows a significant synergistic effect in the control of pine wilt disease. The combined use of these pesticides is more effective in killing nematodes than either pesticide alone. This mixture has the potential to become a new trunk injection agent for the prevention of pine wilt disease.

[0015] The final concentration of fluopyram in the compound composition is the concentration at which it is effective in killing nematodes, for example, it can be LC. 50 The concentration of the dsRNA can be 0.5-5 mg / mL, preferably 1 mg / mL.

[0016] The compound composition of the present invention can be prepared into any suitable pesticide formulation using conventional pesticide formulation methods, such as: trunk injection, powder, spray, etc.

[0017] This invention uses LC 20 Pine wilt nematodes were treated with concentrated fluopyram at various concentrations. Samples were collected at 0, 12, 24, and 48 hours for transcriptome analysis. By comparing gene expression differences at different time points, significantly upregulated detoxification genes BxGST, BxATP, and BxVCat were identified. Double-stranded RNAs (dsBxGST, dsBxATP, and dsBxVCat) were designed and synthesized targeting these detoxification genes and then combined with fluopyram to obtain an effective pesticide compound for controlling pine wilt nematodes. Experimental results demonstrated that this pesticide compound had a significant synergistic control effect against pine wilt nematodes. This pesticide compound is expected to become a novel and highly effective pesticide for controlling pine wilt nematodes, providing a new strategy and theoretical basis for the prevention and control of pine wilt disease. Detailed Implementation

[0018] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0019] Example 1: Screening of a combination of fluopyram and dsRNA and its toxicity and efficacy against pine wood nematode.

[0020] 1. Experimental Materials and Methods

[0021] Test insect source: Pine wilt nematode strain number and source: QH-1, collected from diseased Korean pine in Qingyuan, Shenyang, and preserved in the laboratory of the Institute of Forest Ecology, Environment and Nature Conservation, Chinese Academy of Forestry.

[0022] Test drug: Fluopyram, purchased from MedChemExpress, concentration 98.26%.

[0023] The expression of detoxification genes plays a crucial role in the regulation of pesticide tolerance in pine wood nematodes. To further investigate the pesticide resistance mechanism of pine wood nematodes, this experiment used LC-MS. 20 Pine wood nematodes were treated with concentrated fluopyram, and samples were collected at 0, 12, 24, and 48 hours for transcriptome analysis. By comparing gene expression differences at different time points, significantly upregulated detoxification genes were identified. These upregulated detoxification genes are likely closely related to the resistance of pine wood nematodes to fluopyram. Based on the screening results, double-stranded RNAs (dsBxGST, dsBxATP, dsBxVCat) targeting key detoxification genes were designed and synthesized.

[0024] The nucleotide sequences of the positive strand of dsBxGST, dsBxATP, and dsBxVCat are shown below:

[0025] Nucleotide sequence of the positive strand of dsBxGST:

[0026] ATGTCGGAACCTATTCTTTACTCTTATTGGAGAAGTTCTTGTTCATGGAGAGTCCGGATTGCACTAGAATTGAAGAAAGTGCAATACCAGCAGGTCCACATCCATCTACTGAACCAGGAACAGTCCGAAGAGAAGTATCTCCAAATTAACCCGGCTGGAATGATTCCTACCTTCGTACACGATGGGAATGTAATCACAGAGTCGTTGGCCATCCTCGAATACCTCGACGAAGTTTTTGAGGGACCCAAACTTATTTATGGAAATGCGGCCAAGAAAGCTTTGATTCGAAGTCTGGCGCTAATTATTATAAGCAATATACAGCCTTTGCAAAACCCTCGGGTCACTGCTGTACACAGTAATGACAAGGCGAAGAGAGAAGAATTCGCGAGACATTTCATTGATAGAGGCTTCGAAACCCTCGAGAAACGTCTTAAGGCAACTGCGGGAAAGTACAGTGTCGGCGATGAGCTGAGTCTGGTAGATGTGTGCATCCCATCTCAAGTATATTCGGCTATCAGATTTAACGTGGACATGAGAAAGTTTCCAATCATCCAGAGAATTAACGAGGAATTGGGAAAACTTCCTGCATTCATTAAAGCGGACGAGAAACATCAACCTGACACTCCGGCAGAGTTCAGAGCCGAAATTGAAAAGTAA(ESQ ID No.1).

[0027] Nucleotide sequence of the sense strand of dsBxATP:

[0028]

[0029] Nucleotide sequence of the sense strand of dsBxVCat:

[0030] AATTCATCAATGGCCTCAGAACTGTTGGCGAAAAGACGAAGCAGACTTTGAAGAAGGCTGCTGTCTTCGGGAAACAATTGTCATCTGAATCAAAGCCCAACTTCAACAACTTCTTTGGATATATCATCAAGTTCAACAAGGAGTACAACGATGAGTTGAAGGAGCGTTTCGAGAAGTTTTCTAATTCCCTGAAGAAAATTGAGGCCGATCAGAAAGATAATCCAGAAGCAGAATTCGGACCAACGCAATTCTCGGATTTATCGCCGGAAGAATTCATCAAGGCCTATACTGGAGTCCAAGGAGAAGATCATGTCAAACAGCTTCATGGAGTAGAAGAAGGGAGCGATGGAGAAGAACTCATCATCCGTTCCAAAAGATCCATCCCAGCCAATTTTAGCTGGGTTGCCAAGAACAAAGTGACTGGTATCAGAGACCAAGGCCGATGTGGATGTTGTTACGCGTTTGCCGCTGTGGGTGCCGTCGAAAGTCAATATGCCATTAAGACCGGGAAGTTGGTCGATTTGAGTGAGCAACAGGTAATCTCTTGTACTTATGGAAATACCACTCTTCACGGAAGTGGAGGCGGCGGCTGCAATGGAGGAAGCGCTCCAAGCATTCTACAGTACATTGAGGACAATGGAGTCTGCGCGGAAGCCGATTTTAAATATGTTTCGGGAACCAATTTATCGATCCCCGCATGTGTTAGCGAACCGGCCGTTACAAAGATCACAAAATTCAAGAGAATTCCAGAAAACAGCGAGATTGCCTTGGAGATCTACCTCCACTTTGTTGGGCCTGTCGTTACTTATGTTGATGCCACCCCACTCCAACACTACAAAAGTGGCATTCTCAACGCGAAGGAGCCTTCTGGCGGCTGGACCATCAACCACG (ESQ ID No.3).

[0031] Nematode culture and acquisition: Pine wood nematode strains stored at 4℃ in a refrigerator were inoculated onto potato dextrose agar medium covered with Botrytis cinerea hyphae, and then placed in a constant temperature incubator at 25℃ for 5-7 days. After the nematodes had consumed the hyphae, the pine wood nematodes were collected using the Bellman funnel method. The collected pine wood nematode liquid was centrifuged at 6000 r / min for 3 minutes, washed repeatedly 3 times, and then prepared into the required nematode suspension.

[0032] Determination of the toxicity of fluopyram single agent against pine wood nematode: The immersion method was used to investigate the in vitro toxicity of fluopyram against pine wood nematode. The test drug was prepared into a stock solution with dimethyl sulfoxide (DMSO), and then diluted with sterile water to concentrations of 0.5, 1.0, 1.5, 2.0, and 2.5 mg / L. The experiment was repeated 5 times, with sterile water as control 1 and DMSO as control 2. The drug solution and nematode solution were mixed at a predetermined volume ratio and added to 1.5 mL centrifuge tubes (each tube containing approximately 1500 mixed-age pine wood nematodes). All centrifuge tubes were placed in a constant temperature incubator at 25°C and incubated for 24 hours. After 24 hours, the number of surviving and dead nematodes was observed and counted under a microscope, and the mortality rate, corrected mortality rate, and lethal concentration were calculated.

[0033] Because pine wood nematodes exhibit a state of feigned death, when determining their vitality, if the nematode's body moves in an "S" shape, spiral shape, or curled shape, it is considered a live nematode; if the nematode's body remains stiff and still in a "J" shape or "C" shape, and its body surface is dull, and it remains stiff and still after repeated stimulation with an insect needle, it can be considered a dead nematode.

[0034] Mortality rate = (Number of dead nematodes / Total number of pine wilt nematodes) × 100%

[0035] Corrected mortality rate = (mortality rate - control 2 mortality rate) / (100 - control 2 mortality rate) × 100%

[0036] Determination of dsRNA toxicity against pine wood nematode: A laboratory-prepared 1 mg / mL dsRNA solution and nematode fluid were mixed at a predetermined volume ratio and added to 1.5 mL centrifuge tubes (each tube containing approximately 1500 mixed-age pine wood nematodes). The tubes were incubated at 25°C for 24 hours. Afterward, the number of surviving and dead nematodes was observed and counted under a microscope, and the mortality rate and corrected mortality rate were calculated. The experiment was repeated 5 times, with sterile water as a control.

[0037] Mortality rate = (Number of dead nematodes / Total number of pine wilt nematodes) × 100%

[0038] Corrected mortality rate = (mortality rate - control mortality rate) / (100 - control mortality rate) × 100%

[0039] Determination of the toxicity of the compound agent to pine wilt nematode: LC-12 of fluopyram was used. 50Three dsRNAs at a concentration of 1 mg / mL and a median lethal concentration (LD50) were mixed separately, and the above toxicity experiments were repeated. By comparing the experimental results of single agents and mixtures, the killing effect of fluopyram and dsRNA on pine wood nematodes when used in combination was explored in depth, and the best-performing compound was selected.

[0040] 2. Experimental Results

[0041] 2.1 The toxic effects of fluopyram single agent on pine wood nematode

[0042] After treating pine wood nematodes with different concentrations of fluopyram alone for 24 hours, the LC50 of the fluopyram was significantly reduced. 50 The lethal concentration was 0.292 mg / L (Table 1).

[0043] Table 1. Toxicity of different concentrations of fluopyram single agent against pine wood nematode.

[0044]

[0045] 2.2 Effects of gene screening on the virulence of pine wilt nematode

[0046] By analyzing transcriptome data (see Table 2), we screened three genes that were significantly upregulated after fluopyram treatment. Subsequently, we designed and synthesized dsRNAs associated with these genes and treated pine wood nematodes at a concentration of 1 mg / mL for 24 hours. The corrected mortality rates after treatment were 5.27%, 3.31%, and 2.29%, respectively (Table 3).

[0047] Table 2. Screening gene information

[0048]

[0049] Table 3 shows the toxicity of dsRNA single-agent treatment against pine wood nematode.

[0050]

[0051] 2.3 The toxic effect of the combination on pine wood nematode

[0052] Fluopyram formulations according to LC 50 When pine wilt nematodes were soaked in a mixture of three 1 mg / mL dsRNAs and cultured at 25°C for 24 h, the corrected mortality rates of the nematodes were 84.89%, 63.45%, and 61.89%, respectively. As shown in the table, the mortality rate of the compound treatment was significantly better than that of fluopyram and dsRNA alone, indicating that the compound treatment has a significant synergistic effect in the control of pine wilt disease. Moreover, the mortality rate of fluopyram·dsBxGST ​​was significantly higher than that of fluopyram·dsBxATP and fluopyram·dsBxVCat, indicating that the combination of fluopyram·dsBxGST ​​had the best effect (Table 4).

[0053] Table 4. Toxicity of Fluopyram·dsRNA Compound against Pine Wood Nematode

[0054]

[0055] The experimental results showed that fluopyram alone had a significant toxic effect on pine wood nematodes, and its LC50 was [missing information]. 50 The median lethal concentration (LD50) was 0.292 mg / L. When the three dsRNA agents (dsBxGST, dsBxATP, and dsBxVCat) were used alone to treat pine wood nematodes, the corrected mortality rates were 5.27%, 3.31%, and 2.29%, respectively, indicating relatively weak efficacy. However, when fluopyram was used in combination with dsRNA, its insecticidal effect was significantly enhanced. The combination of fluopyram and dsBxGST ​​performed best, with a corrected mortality rate as high as 84.89%, significantly superior to the use of fluopyram alone or the other two combination agents (fluopyram·dsBxATP and fluopyram·dsBxVCat).

[0056] In conclusion, the combined use of fluopyram and dsRNA has a significant synergistic effect in the prevention and control of pine wilt disease, especially the combination of fluopyram and dsBxGST.

Claims

1. A pesticide compound composition for killing nematodes, characterized in that, It consists of fluopyram and dsRNA; the dsRNA is designed and synthesized from the detoxification genes BxGST, BxATP and BxVCat of pine wood nematode.

2. The pesticide compound composition according to claim 1, characterized in that, The dsRNA is selected from any one of the dsRNAs described in (1)-(3) below: (1) The dsRNA consists of a sense strand and an antisense strand that is complementary to it, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No.1; (2) The dsRNA consists of a sense strand and an antisense strand that is complementary to it, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No.2; (3) The dsRNA consists of a sense strand and an antisense strand that is complementary to it, and the nucleotide sequence of the sense strand of the dsRNA is shown in SEQ ID No.

3.

3. The pesticide compound composition according to claim 2, characterized in that, The nucleotide sequence of the positive strand of the dsRNA is the nucleotide sequence shown in SEQ ID No.

1.

4. The pesticide compound composition according to claim 1, characterized in that, The fluopyram mentioned is fluopyram with a concentration of 98.26%.

5. The pesticide compound composition according to claim 1, characterized in that, The final concentration of fluopyram in a pesticide compound is the concentration at which it is effectively used to kill nematodes.

6. The pesticide compound composition according to claim 1, characterized in that, The concentration of the dsRNA is 0.5-5 mg / mL.

7. The pesticide compound composition according to claim 6, characterized in that, The concentration of the dsRNA is 1 mg / mL.

8. The use of the pesticide compound composition according to any one of claims 1-7 in the preparation of pesticide formulations for controlling nematodes.

9. The application according to claim 8, characterized in that, The pesticide formulations mentioned are selected from tree trunk injections, powders, or sprays.

10. The application according to claim 8, characterized in that, The nematode mentioned is the pine wood nematode.

Images