Diaphorina algida reference gene as well as screening method and application of diaphorina algida reference gene

Abstract

The invention discloses a diaphorina algida reference gene as well as a screening method and application thereof, and belongs to the technical field of biology. The diaphorina algida internal reference gene comprises an internal reference gene EIF5A, an internal reference gene RPL7A, an internal reference gene RPL13, an internal reference gene H3, an internal reference gene GAPDH, an internal reference gene RPS6 and an internal reference gene RPL32. The reference gene provided by the invention can be used for correcting the gene expression quantity correction of the diaphorina algida under different conditions, and lays a foundation for the research on the functional gene of the diaphorina algida.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to the reference gene of the Ali lice-eating wasp and its screening method and application. Background Technology

[0002] *Diaphorencyrtus aligarhensi*, belonging to the order Hymenoptera and family Encyrtidae, is the dominant endoparasitic wasp of the citrus psyllid *Diaphorina citri Kuwayama*, a vector of citrus Huanglongbing (HLB). It can reproduce parthenogenetically or sexually. *Diaphorencyrtus aligarhensi* feeds on the hemolymph of citrus psyllid nymphs, thus killing them, making it an important natural enemy of the citrus psyllid. It has been used worldwide as an effective biological control method for citrus psyllid control.

[0003] Quantitative real-time PCR (RT-qPCR) is highly sensitive, specific, and cost-effective. It is used not only to determine gene expression patterns but also to validate the accuracy of high-throughput transcriptome sequencing (RNA-Seq) data. However, factors such as RNA purity, complementary DNA content, PCR reaction efficiency, and primer design can all affect the accuracy of RT-qPCR analysis. Therefore, internal reference genes have been introduced to standardize RT-qPCR results. Stably expressed internal reference genes can correct and standardize RT-qPCR data, correcting various variations caused by the experimental process. By correcting and standardizing, internal differences in the experiment can be controlled, ensuring the accuracy and reliability of the data. In recent years, numerous studies have shown that genes with absolutely stable expression levels do not exist. The constant expression level of any internal reference gene has certain limitations, especially considering the significant differences in stability among different species or under different treatment conditions. Common universal reference genes are expressed differently in different species, at different developmental stages of the same species, and under different growth environments. Introducing inappropriate reference genes for correction during analysis can have a significant impact on the results. Therefore, screening for suitable reference genes for specific species and specific experimental conditions is beneficial to improving the accuracy of RT-qPCR detection results.

[0004] However, to date, no studies have been conducted on the internal reference genes of the Ali lice-eating wasp, which limits the subsequent research on the functional genes of the Ali lice-eating wasp. Summary of the Invention

[0005] The purpose of this invention is to provide a reference gene for *Amanita muscaria*, its screening method, and its application, in order to solve the problems existing in the prior art. This invention screens out stable reference genes for *Amanita muscaria* under different conditions. The screened reference genes can be used to correct the expression levels of *Amanita muscaria* genes under different conditions, laying the foundation for the study of functional genes in *Amanita muscaria*.

[0006] To achieve the above objectives, the present invention provides the following solution:

[0007] This invention provides an internal reference gene for the Ali lice-eating wasp, including internal reference gene EIF5A, internal reference gene RPL7A, internal reference gene RPL13, internal reference gene H3, internal reference gene GAPDH, internal reference gene RPS6 and internal reference gene RPL32.

[0008] The nucleotide sequence of the internal reference gene EIF5A is shown in SEQ ID NO.17; the nucleotide sequence of the internal reference gene RPL7A is shown in SEQ ID NO.18; the nucleotide sequence of the internal reference gene RPL13 is shown in SEQ ID NO.19; the nucleotide sequence of the internal reference gene RPS6 is shown in SEQ ID NO.20; the nucleotide sequence of the internal reference gene RPL32 is shown in SEQ ID NO.21; the nucleotide sequence of the internal reference gene H3 is shown in SEQ ID NO.22; and the nucleotide sequence of the internal reference gene GAPDH is shown in SEQ ID NO.23.

[0009] The present invention also provides detection primers for the internal reference genes of the aforementioned Ali lice-eating wasp, wherein the detection primer sequences for the internal reference gene EIF5A are shown in SEQ ID NO. 13-14; the detection primer sequences for the internal reference gene RPL7A are shown in SEQ ID NO. 1-2; the detection primer sequences for the internal reference gene RPL13 are shown in SEQ ID NO. 3-4; the detection primer sequences for the internal reference gene RPS6 are shown in SEQ ID NO. 5-6; the detection primer sequences for the internal reference gene RPL32 are shown in SEQ ID NO. 7-8; the detection primer sequences for the internal reference gene H3 are shown in SEQ ID NO. 9-10; and the detection primer sequences for the internal reference gene GAPDH are shown in SEQ ID NO. 11-12.

[0010] This invention also provides a method for screening the reference gene of the Ali lice-eating wasp, comprising the following steps:

[0011] Candidate reference genes were selected, and the DNA of samples of Ali lice-eating fleas under different conditions was used as templates. The candidate reference genes were detected by real-time fluorescence quantitative PCR. The real-time fluorescence quantitative PCR data were analyzed, and the reference gene with the highest stability was selected as the reference gene of Ali lice-eating fleas.

[0012] The different conditions include different developmental stages, different tissues, different diets, different periods of starvation, different temperatures, and different populations.

[0013] This invention also provides an application of the aforementioned *Aliphatic lice-eating wasp* internal reference gene or the aforementioned detection primer in the correction of *Aliphatic lice-eating wasp* gene expression levels under different conditions.

[0014] Optionally, the different conditions include different developmental stages, different tissues, different diets, different starvation times, different temperatures, and different populations.

[0015] Optionally, when correcting gene expression levels in *Aegilops alias* at different developmental stages, the internal reference genes are EIF5A and RPL32; when correcting gene expression levels in *Aegilops alias* under different dietary conditions, the internal reference genes are RPS6 and GAPDH; when correcting gene expression levels in *Aegilops alias* in different tissues, the internal reference genes are RPL7A and RPS6; when correcting gene expression levels in *Aegilops alias* under different starvation periods, the internal reference genes are RPL32 and RPS6; when correcting gene expression levels in *Aegilops alias* at different temperatures, the internal reference genes are RPL7A and RPS6; and when correcting gene expression levels in *Aegilops alias* from different populations, the internal reference genes are RPL13 and H3.

[0016] The present invention discloses the following technical effects:

[0017] This invention uses DNA samples from *Amanita muscaria* (a type of wasp) under different conditions as templates to perform stability analysis on candidate internal reference genes, screening out stable *Amanita muscaria* internal reference genes under different conditions. The screened internal reference genes can be used to correct the expression levels of *Amanita muscaria* genes under different conditions, laying the foundation for research on the functional genes of *Amanita muscaria*.

[0018] The quantitative primers designed in this invention significantly improve the specificity and sensitivity of the PCR process, while shortening the detection time, improving detection efficiency and the reliability of results. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 Melting curve of RPL7A, the internal reference gene of the Ali lice-eating wasp;

[0021] Figure 2 Melting curve of RPL13, the internal reference gene of the Ali lice-eating flea wasp;

[0022] Figure 3 Melting curve of RPS6, the internal reference gene of the Ali lice-eating flea wasp;

[0023] Figure 4 Melting curve of RPL32, the internal reference gene of the Ali lice-eating wasp;

[0024] Figure 5 Melting curve of H3, the internal reference gene of the Ali lice-eating flea beetle;

[0025] Figure 6 Melting curve of GAPDH, the internal reference gene of the Ali lice-eating flea wasp;

[0026] Figure 7 Melting curve of EIF5A, the internal reference gene of the Ali lice-eating flea wasp;

[0027] Figure 8 The standard curves for each internal reference gene of the Ali lice-eating wasp are shown below. A represents the standard curve for internal reference gene RPL7A; B represents the standard curve for internal reference gene RPL13; C represents the standard curve for internal reference gene RPS6; D represents the standard curve for internal reference gene RPL32; E represents the standard curve for internal reference gene H3; F represents the standard curve for internal reference gene GAPDH; and G represents the standard curve for internal reference gene EIF5A.

[0028] Figure 9 The results of the stability analysis of each candidate internal reference gene by geNorm are shown.

[0029] Figure 10 The results of NormFinder's stability analysis of each candidate internal reference gene;

[0030] Figure 11 The results of Delta CT stability analysis of each candidate internal reference gene;

[0031] Figure 12 The results of RefFinder's stability analysis of each candidate internal reference gene;

[0032] Figure 13 The relative expression levels of HSP70 under different conditions. Detailed Implementation

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] The biomaterials in this embodiment of the invention include:

[0039] 1. Test plants

[0040] Murraya exotica L.: Purchased from Lingnan Flower Market, Liwan District, Guangzhou, and planted in... The plants are placed in flowerpots in a dedicated, non-toxic seedling cultivation room and watered and fertilized regularly. Before using Murraya paniculata to propagate citrus psyllids, the Murraya paniculata needs to be pruned to encourage new shoots to facilitate egg-laying by the citrus psyllids.

[0041] 2. Test insects

[0042] Citrus psyllids: Adults were collected from Murraya paniculata (orange jasmine) plants in the greenbelt of Chashan Residential Area, Wushan Road, Tianhe District, Guangzhou City, Guangdong Province. After being brought back to the laboratory, the adult psyllids were bagged and transferred to pre-prepared Murraya paniculata plants. These plants were then placed in breeding cages (60×60×90cm) for subculture and propagation. Regular watering and replacement of the Murraya paniculata plants with newly sprouting buds were carried out to cultivate an experimental population of citrus psyllids for future use. The honeydew secretion of the citrus psyllids in the breeding cages was regularly observed. When excessive secretion occurred, the branches were gently shaken to reduce the amount of honeydew on the branches and leaves, preventing the psyllids from becoming stuck. Simultaneously, the mesh of the breeding cages was sealed to prevent predatory ants from entering and reducing the population, thus ensuring the large-scale reproduction of the citrus psyllid population. Finally, the yellow-bellied citrus psyllids, which were about to lay eggs, were introduced in batches onto the newly sprouted Murraya paniculata plants. These psyllids were then placed in an incubator (26±1℃, RH 80±10%, L:D = 14:10h) to ensure rapid and uniform egg-laying and to guarantee that the psyllids in the experiment developed at the same instar as much as possible.

[0043] *Ali* citrus psyllid wasp: *Murraya paniculata* was used as a host plant for rearing citrus psyllids. The plant was covered with a collection bag (50cm x 50cm, 100 mesh), and a suitable number of citrus psyllids were introduced. After the psyllids laid eggs, the adults were removed. When they developed into 3rd-4th instar nymphs, a breeding population of 15 *Ali* citrus psyllid wasps was introduced. After the citrus psyllids were parasitized and spun cocoons, the attached *Murraya paniculata* branches were cut and placed in a light- and air-permeable plastic container. Newly hatched *Ali* citrus psyllid wasps were collected daily and placed into culture tubes, fed with 20% honey water. The rearing temperature was 26±1℃, the relative humidity was 70±10%, and the photoperiod was 14L:10D.

[0044] Example

[0045] 1. Sample collection under different treatment conditions

[0046] (1) Sample collection at different developmental stages

[0047] Second- to third-instar nymphs of the citrus psyllid were collected from tender shoots of Murraya paniculata. After bagging, the wasps were inoculated with the parasitic wasp *Ichthyophthirius multifiliis*. After 24 hours of oviposition, the adult wasps were removed, and the citrus psyllids were reared under the same conditions. Each day, the parasitized nymphs were dissected under a stereomicroscope to observe the developmental status of the wasps. Samples of different instars were collected after the larvae hatched. The samples included 30 pupae and 20 adults. Each stage of the sample was tested in triplicate and placed in 1.5 mL RNase-free centrifuge tubes. The tubes were rapidly frozen in liquid nitrogen and then stored at -80°C.

[0048] (2) Collection of samples from different tissues

[0049] Newly emerged female adult wasps of the Ali lice-eating wasp were collected according to the above-described rearing method. After freezing for 5 minutes, they were dissected under a stereomicroscope in RNase-free PBS, and the head, thorax, and abdomen were collected separately. Forty female adults were dissected for each tissue sample, with three replicates, for a total of 120 dissected wasps. The samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and then stored in an ultra-low temperature freezer at -80°C.

[0050] (3) Collection of samples from different populations

[0051] Two populations were collected in this study: the Guangzhou population (GZ) and the Chongqing population (CQ). Both populations were reared indoors in the local area for an extended period. Sixty adults were collected from each sample, with three replicates. The samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and then stored in an ultra-low temperature freezer at -80°C.

[0052] (4) Sample collection at different temperatures

[0053] Female adult wasp *Tetranychus aliphas* were collected and divided into four groups. Each group was treated at 5℃, 15℃, 25℃, and 35℃ for 3 hours, with three replicates for each temperature condition. Twenty female adults were collected from each replicate. Samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and then stored at -80℃.

[0054] (5) Collection of samples from different food processing methods

[0055] Female adult *Aliphatic citrus psyllid* were collected and divided into three groups. They were respectively introduced into 50 mL beekeeping tubes containing *Murraya paniculata* seedlings with citrus psyllid nymphs, 20 mL honey water strips, and 20 mL sucrose water strips. The food was changed daily, and samples were collected after 10 consecutive days. Each food condition was replicated three times, with 20 female adults collected from each replicate. Samples were placed in 1.5 mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen, and then stored at -80°C.

[0056] (6) Sample collection under different starvation times

[0057] Female adult wasp of the Ali lice-eating wasp were collected and divided into 5 groups. After being fed with 20% honey water, samples were collected after starvation for 0h, 4h, 8h and 12h respectively. Each starvation condition was set up in 3 replicates. 20 female adult wasp were collected in each replicate. The samples were placed in 1.5mL RNase-free centrifuge tubes, rapidly frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80℃.

[0058] 2. Total RNA extraction and cDNA synthesis

[0059] 2.1 Total RNA extraction using the Trizol method:

[0060] (1) Add 50 μL of Trizol lysis buffer to a centrifuge tube containing the sample, then grind the sample on ice using an electric tissue homogenizer, and then add 450 μL of Trizol lysis buffer. Let stand at room temperature (15-30℃) for 5 min to allow for complete lysis.

[0061] (2) Centrifuge at 12000×g at 4℃ for 5min, carefully aspirate the supernatant and transfer it to a new centrifuge tube (do not aspirate the precipitate), and discard the waste liquid.

[0062] (3) Add 100 μL of chloroform (1 / 5 volume of Trizol) to the supernatant from step (2) above, tighten the centrifuge tube cap, and mix until the solution turns milky white. Let stand at room temperature for 5 min.

[0063] (4) Centrifuge at 12000×g at 4℃ for 15min. Carefully remove the centrifuge tube from the centrifuge. At this point, the homogenate is divided into three layers: a colorless supernatant (containing RNA), a white protein layer in the middle (mostly DNA), and a colored lower organic phase.

[0064] (5) Transfer the supernatant to another new centrifuge tube (do not remove the white intermediate layer). Add 250 μL of isopropanol (half the volume of Trizol) to the supernatant, invert the centrifuge tube to mix thoroughly, and let it stand at room temperature for 10 min.

[0065] (6) Centrifuge at 12000×g at 4℃ for 10 min. After centrifugation, RNA precipitate will appear at the bottom of the test tube. Carefully discard the supernatant and do not touch the precipitate.

[0066] (7) Add about 500 μL of 75% ethanol and gently invert the centrifuge tube to wash the wall.

[0067] (8) After centrifuging at 7500×g at 4℃ for 5min, carefully discard the supernatant and do not touch the precipitate.

[0068] (9) Open the centrifuge tube cap and let the precipitate dry at room temperature for 10 minutes. Do not over-dry.

[0069] (10) After the precipitate is dried, add 20 μL of RNase-free ddH2O to dissolve the RNA sample.

[0070] (11) Take 1.5 μL of sample and measure the OD value of the RNA sample on a Nanodrop2000 ultra-micro spectrophotometer to determine the OD value of the sample. 260 / OD 280 The value is between 1.8 and 2.2.

[0071] 2.2cDNA synthesis:

[0072] Based on TaKaRa PrimeScript TM cDNA was synthesized via reverse transcription using the RT reagent FAST Kit with gDNA Erase kit. The specific steps are as follows:

[0073] Prepare the mixture shown in Table 1 in a 200 μL RNase-free PCR tube.

[0074] Table 1

[0075] 8×gDNA Eraser Premix 2μL RNA samples 1μg <![CDATA[RNase Free H2O]]> Up to 16μL Total 16μL

[0076] After incubating at 42°C for 2 minutes on a gradient PCR instrument, place on ice for the next experiment;

[0077] Add the mixture shown in Table 2 to the above reaction mixture.

[0078] Table 2

[0079] Table 1 Reaction System 16μL 5×RTPremix 4μL Total 20μL

[0080] Reverse transcription was performed in a PCR instrument: incubated at 37°C for 15 min, at 85°C for 5 s, and at 4°C for ∞.

[0081] After diluting the obtained cDNA 10 times, store it in a -20°C freezer or continue with subsequent experimental procedures.

[0082] 3. Design and preliminary screening of candidate internal reference gene primers

[0083] This invention selected seven commonly used candidate internal reference genes: RPL7A (ribosomal protein L7A), RPL13 (ribosomal protein L13), RPS6 (ribosomal protein S6), RPL32 (ribosomal protein L32), H3 (histone 3), GAPDH (glyceraldehyde-3-phosphate dehydrogenase), and EIF5A (eukaryotic translation initiation factor 5A). Gene sequences were downloaded from the Aliphatic wasp transcriptome database. Degenerate primers were designed using Primer Premier 5 software and synthesized by Shanghai Bioengineering Co., Ltd. Primer information is shown in Table 3. Subsequently, conventional PCR was used to amplify the sequences of each internal reference gene; the reaction system is shown in Table 4.

[0084] Table 3 Information on amplification primers

[0085]

[0086] Table 4 PCR reaction system

[0087]

[0088] The PCR reaction program was as follows: 94℃, 5 min; 94℃, 30 s, 55℃, 30 s, 72℃, 1 min, 35 cycles; 72℃, 10 min, 4℃, ∞.

[0089] The PCR products were detected by 1% agarose gel electrophoresis at a voltage of 120V for 25 minutes.

[0090] 4. RT-qPCR detection of candidate internal reference genes

[0091] Real-time quantitative PCR analysis was performed using RT-qPCR primers for each internal reference gene in Table 3. The reaction system is shown in Table 5. A 50 μL mixture was used for three technical replicates, and 15 μL of the mixture was transferred to each well of the quantitative PCR tube. RT-qPCR reactions were performed using a Bio-Rad CFX 96 real-time quantitative PCR instrument. The reaction program was: 95℃ for 3 min; 95℃ for 10 s, 55℃ for 30 s, for a total of 40 cycles. A dissolution program was added after the PCR amplification program: 95℃ for 5 s (4.4℃ / s), 60℃ (2.2℃ / s), 95℃ (0.11℃ / s, taking a picture every 1℃ increase). Then, after a 5-fold serial dilution of the cDNA from *Amanita muscaria*, RT-qPCR reactions were performed to calculate the amplification efficiency and standard curve for each pair of internal reference genes. Amplification efficiency E = (10... [-1 / 斜率] -1)×100. The melting curves and standard curves of each internal reference gene of *Amanita muscaria* are shown below. Figures 1-7 and Figure 8 As shown.

[0092] Table 5 RT-qPCR reaction system

[0093]

[0094] 5. Analysis of the stability of internal reference gene expression

[0095] This invention uses geNorm, NormFinder, BestKeeper, the ΔCt method, and the online tool RefFinder to comprehensively evaluate the stability of internal reference genes. During analysis, the obtained Ct values ​​in geNorm and NormFinder software need to be converted. The specific conversion method is as follows: select the lowest Ct value of a candidate gene across all samples, subtract the lowest Ct value from the Ct values ​​of the internal reference gene in other samples (i.e., ΔCt), and then use 2... -ΔCt Calculate the relative expression level of the reference gene in other samples. RefFinder calculates the geometric mean of the ranking values ​​of each candidate reference gene obtained from four software programs: geNorm, Normfinder, BestKeeper, and Delta CT, to obtain a comprehensive ranking index. The smaller the index, the more stable the reference gene is, thus obtaining the comprehensive ranking of the stability of the candidate reference genes.

[0096] The stability analysis results are as follows:

[0097] (1) geNorm analysis

[0098] The stability of each candidate internal reference gene in all treatment groups was analyzed using the geNorm software by calculating the average expressionstability value (M). A smaller M value indicates a more stable internal reference gene. The analysis results are as follows: Figure 9 As shown, the stability ranking of candidate internal reference genes in the developmental stage treatment group was: RPL13|RPL32>EIF5A>RPL7A>RPS6>H3>GAPDH; the stability ranking of candidate internal reference genes in different tissue treatment groups was: RPL13|RPS6>RPL32>RPL7A>EIF5A>H3>GAPDH; and the stability ranking of candidate internal reference genes in different population treatment groups was: H3|GAPDH>EIF5A>RPS6>RPL13>RPL7A>RPL32 The stability ranking of candidate internal reference genes in different dietary treatment groups was: RPL7A|RPS6 > GAPDH > RPL32 > EIF5A > RPL13 > H3; the stability ranking of candidate internal reference genes in different starvation time treatment groups was: RPL13|RPL32 > RPL7A > RPS6 > GAPDH > EIF5A > H3; the stability ranking of candidate internal reference genes in different temperature treatment groups was: RPL7A|RPS6 > RPL32 > RPL13 > GAPDH > EIF5A > H3.

[0099] (2) NormFinder Analysis

[0100] NormFinder software measures gene expression stability by analyzing the M value of each candidate internal reference gene; the smaller the stability value (M), the higher the stability of the internal reference gene. For example... Figure 10 As shown, the stability ranking of candidate internal reference genes in the developmental stage treatment groups was: RPS6 > RPL32 > EIF5A > RPL13 > RPL7A > H3 > GAPDH; the stability ranking of candidate internal reference genes in different tissue treatment groups was: RPS6 > RPL7A > EIF5A > RPL13 > RPL32 > H3 > GAPDH; and the stability ranking of candidate internal reference genes in different population treatment groups was: EIF5A > RPL13 > GAPDH > H3 > RPS6 > RPL7A > RPL32 The stability ranking of candidate internal reference genes in different dietary treatment groups was: EIF5A > RPS6 > RPL32 > GAPDH > RPL7A > RPL13 > H3; the stability ranking of candidate internal reference genes in different starvation time treatment groups was: RPL32 > EIF5A > RPL13 > RPL7A > RPS6 > GAPDH > H3; the stability ranking of candidate internal reference genes in different temperature treatment groups was: RPL13 > RPL7A > EIF5A > RPL32 > RPS6 > GAPDH > H3.

[0101] (3) BestKeeper analysis

[0102] The stability of each candidate internal reference gene was analyzed using BestKeeper software. The criterion for determination was that a stable internal reference gene had a high coefficient of determination (R²) in BestKeeper. 2 (Table 6) The stability ranking of candidate internal reference genes in the developmental stage treatment groups was: RPL7A > RPL32 > RPL13 > EIF5A > GAPDH > RPS6 > H3; the stability ranking of candidate internal reference genes in different tissue treatment groups was: RPL32 > RPS6 > RPL7A|RPL13|EIF5A > H3 > GAPDH; the stability ranking of candidate internal reference genes in different population treatment groups was: RPL7A > RPL13 > H3 > RPS6 > GAPDH > EIF5A > RPL3 2; The stability ranking of candidate internal reference genes in different dietary treatment groups was: EIF5A > RPL32 > RPL13 > RPS6 > GAPDH > RPL7A > H3; The stability ranking of candidate internal reference genes in different starvation time treatment groups was: RPS6 > EIF5A > RPL32 > RPL13 > RPL7A > GAPDH > H3; The stability ranking of candidate internal reference genes in different temperature treatment groups was: RPL7A > RPL13|EIF5A > RPS6 > RPL32 > H3|GAPDH.

[0103] Table 6 shows the stability of each candidate internal reference gene analyzed by BestKeeper.

[0104]

[0105] (4) Delta CT analysis

[0106] Delta CT identifies stable reference genes by comparing the relative expression of "gene pairs" composed of candidate reference genes in a sample. If the ΔCt value between two genes in the same sample remains unchanged, the expression of these two genes is considered stable. Therefore, the selection principle of Delta CT software is: the reference gene with the smallest mean standard deviation of ΔCt for all "gene pairs" is considered the most stable reference gene. Figure 11 The stability ranking of candidate internal reference genes in the developmental stage treatment groups was: RPL32|EIF5A > RPL7A > RPS6 > RPL13 > H3 > GAPDH; the stability ranking of candidate internal reference genes in different tissue treatment groups was: RPS6 > RPL7A|EIF5A > RPL32 > RPL13 > H3 > GAPDH; the stability ranking of candidate internal reference genes in different population treatment groups was: RPL13 > H3 > EIF5A > RPL32|RPL7A > GAPDH > RPS6; The stability ranking of candidate internal reference genes in the same dietary treatment group was: RPS6|RPL7A|RPL32>GAPDH>EIF5A>RPL13>H3; the stability ranking of candidate internal reference genes in different starvation time treatment groups was: RPL32>RPS6>RPL13>EIF5A>GAPDH>RPL7A>H3; the stability ranking of candidate internal reference genes in different temperature treatment groups was: RPL7A|RPL13>RPL32|RPS6>EIF5A>GAPDH>H3.

[0107] (5) RefFinder analysis

[0108] To avoid errors from analysis results from a single software, RefFinder software was used to comprehensively analyze the stability of each candidate internal reference gene. This tool allows users to directly input Ct values ​​online and calculate the geometric mean of the ranking values ​​of each candidate internal reference gene obtained from geNorm, NormFinder, BestKeeper, and DeltaCT software as the overall ranking. Figure 12The stability ranking of candidate internal reference genes in the developmental stage treatment groups was: EIF5A > RPL32 > RPL7A > RPS6 > RPL13 > H3 > GAPDH; the stability ranking of candidate internal reference genes in different tissue treatment groups was: RPL7A > RPS6 > EIF5A > GAPDH > RPL32 > RPL13 > H3; the stability ranking of candidate internal reference genes in different population treatment groups was: RPL13 > H3 > RPL32 > EIF5A > RPL7A > GAPDH > RPS6; The stability ranking of candidate internal reference genes in the same diet treatment group was: RPS6 > GAPDH > RPL7A > EIF5A > RPL32 > RPL13 > H3; the stability ranking of candidate internal reference genes in different starvation time treatment groups was: RPL32 > RPS6 > RPL13 > GAPDH > EIF5A > RPL7A > H3; the stability ranking of candidate internal reference genes in different temperature treatment groups was: RPL7A > RPS6 > RPL13 > RPL32 > GAPDH > EIF5A > H3.

[0109] 6. Verification of the stability of internal reference gene expression

[0110] To assess the stability of the candidate reference gene, this invention utilizes the relative expression levels of HSP70, which is stably expressed at various developmental stages of insects, to validate the internal reference gene under six different experimental conditions. The primer sequences for the target gene are as follows: HSP70 forward primer (5'-TCGCTGGCTTGATAATAATACCTTGG-3', SEQ ID NO.15), HSP70 reverse primer (5'-TTGGTCATAATCGGTGAACACTGTC-3', SEQ ID NO.16).

[0111] Internal reference gene validation results showed that in different tissues ( Figure 13 B) Different diets Figure 13 D), different hunger times ( Figure 13 E), different temperatures ( Figure 13 Under the experimental setup of F), the expression pattern and level of HSP70 are inconsistent. This is due to the difference between the most stable candidate internal reference gene and the least stable candidate internal reference gene (except for different developmental stages). Figure 13 A) and different groups ( Figure 13 The findings were obtained through a comparison of C) outside).

[0112] Taking the verification of HSP70 expression in different tissues as an example, when the expression level of the HSP70 target gene in different tissues of *Acer aristatus* was corrected using the most stable internal reference genes RPL7A and RPS6 provided by this invention, the relative expression level of the HSP70 target gene was highest in the abdominal tissue, followed by the thorax tissue, and lowest in the head tissue. When the expression level of the HSP70 target gene in different tissues of *Acer aristatus* was corrected using the least unstable internal reference genes RPL13 and H3 provided by this invention, the relative expression level of the HSP70 target gene was highest in the thorax tissue, followed by the abdominal tissue, and lowest in the head tissue. Figure 13 (B).

[0113] The combined results of HSP70 target gene expression level correction indicate that the results obtained using the unstable internal reference genes RPL13 and H3 for HSP70 target gene expression level correction do not match the HSP70 target gene expression level obtained from transcriptome sequencing. However, the results obtained using the stable internal reference genes RPL7A and RPS6 provided by this invention for HSP70 target gene expression level correction are consistent with the HSP70 target gene expression level obtained from transcriptome sequencing.

[0114] In summary, the most stable internal reference genes at different developmental stages of the wasp *Amanita muscaria* were EIF5A (SEQ ID NO. 17) and PRL32 (SEQ ID NO. 21); the most stable internal reference genes in different tissues were RPL7A (SEQ ID NO. 18) and RPS6 (SEQ ID NO. 20); the most stable internal reference genes in different populations were RPL13 (SEQ ID NO. 19) and H3 (SEQ ID NO. 21); the most stable internal reference genes under different dietary conditions were RPS6 (SEQ ID NO. 20) and GAPDH (SEQ ID NO. 22); the most stable internal reference genes under different starvation conditions were RPL32 (SEQ ID NO. 21) and RPS6 (SEQ ID NO. 20); and the most stable internal reference genes at different temperatures were RPL7A (SEQ ID NO. 18) and RPS6 (SEQ ID NO. 20).

[0115] EIF5A gene sequence (SEQ ID NO.17):

[0116] ATGGCAGATATTGAAGATACTCATTTCGAGACTGGTGACTCAGGAGCCTCTGTTACATACCCTATGCAGTGCTCAGCTCTGCGTAAAAATGGATTTGTTATGTTAAAATCCAGACCATGTAAAATTGTAGAAATGTCTACATCCAAGACTGGCAAGCATGGTCACGCCAAGGTTCACCTTGTTGGTATTGACATCTTCTCATCCAAGAAGTATGAAGATATCTGCCCTTCAACACACAACATGGATGTCCCCTTCGTCAAGCGAGAGGACTATCAGCTAACAGACATATCTGATGATGGATACTTATGTTTAATGGCTGACAATGGAGACTTACGTGAAGATCTCAAAATCCCAGAAGGAGAGTTGGGCGTACAGCTTCGTCTTGACTACAATGCTGGCAAAGAACTTCTTTGTACGGTGCTAAAGGCCTGCAATGAAGAGGTAGTCATTGCTATCAAAACCAACACTGCCCTTGATAAATAA。

[0117] RPL7A gene sequence (SEQ ID NO.18):

[0118] ATGGTGCAAAAGAAGCCTAAGAAGAAGGTCGGAAAGAAGGTAGCAGCAGCTCCTTTAGCTGTTAAGAAAGCAGAACCCAAGAAGGTCACAAACCCTCTGTTTGAAAAGCGCACTCGCATCTTTGGCATTGGCCAAGACATTCAGCCAAACCGTGACCTCAGCCGTTTCGTTAGATGGCCAAAGTACATTCGTATTCAAAGGCAAAAGTCAGTTTTGACTAAGAGATTGAAGGTTCCCCCACCAATCAACCAATTCACCCAAACTTTGGACAAACAAACCGCAACTCAACTGTTCAAGATTTTGGACAAATACAGGCCAGAAAGTGCAGCGGCCAAGAAGCTCAGGCTTAAAGCTAGAGCTGAAGAGAAAGTAGAAAAGAAATCGGACACTCCAACCAAGAGGCCCAACACCTTGAGAAGTGGAGCCAATGCTGTCACAACCTTGGTTGAACAGAAGAAAGCTCAACTTGTTGTCATTGCTCATGATGTTGATCCTATTGAAGTCGTTCTATTCTTGCCCGCTCTTTGCCGTAAAATGGGTGTCCCATACTGCATTGTGAAAGGCAAGGCCAGACTTGGACGTCTTGTTAGGAGGAAGACCTGCACAGCTGTTGCTCTGACACAGGTTGATTCTGGAGACAGAGCTAACTTCACTAAGGTTGTTGAGGCCATTAAGACCAACTTCAATGACCGTCACGATGAGATCAGACGTCACTGGGGAGGTGGTCTCCTTGGTAGCAAGTCTGCTGCTAGGATAGCTAAGTTGGAGAAGGCTAAAGCTAAAGAACAAGCTCAAAAACAAGGTTAA。

[0119] RPL13 gene sequence (SEQ ID NO.19):

[0120] ATGGGAAAGAGGAACAATATGATCCCTAATGGGCACTTCCACAAGGATTGGCAGCGTTTTGTCAAGACGTGGTTCAACCAGCCTGCTCGTAAATACCGCAGAAAAACCAACCGTATAAAGAAAGCCCGTTCCGTTGCACCAAGGCCAGTAGCAAAATTGAGGCCTGTTGTACATTGTCCAACAATACGTTACAACACTAAGACACGCTTAGGCAGAGGATTCACTCTTGCTGAGATTAAGGCTGCTGGTTTCTGCAAGCAAGAAGCTATGTCCTTTGGTATTTCTGTTGATCCAAGAAGGCGCAACAAATCTGTTGAAAGTCTCCAACAGAATGCTCAGCGACTCAAGGAGTACAACTCCAAATTGATCAGATTCCCCAAGAATGAGAAGAAGATCAAGAAGGGAGAAGCTACTCCTGAAGAATGCAAGCTTGCCACTCAGTTCAAGGGTGACATTATGCCTGTTCACCAGTCTACAGGAAAGTCTAAGGCTCGTGTTATCACTGAAGATGAAAAGAAATTCCAAGCCTACATCACCCTCCGTAAAGCACGTGCTGATGCCAGACTTGTAGGTATCAGGGCTAAGCGTGTTAAAGATGCTGCTGAAAATCCAGATGATGTCACAAAAGTGACAAAAGACAAGAAAGCTAAGAAGTAA。

[0121] RPS6 gene sequence (SEQ ID NO.20):

[0122] ATGAAGCTGAACGTGTCTTTCCCTGCAACAGGGTCTCAAAAACTTTTTGAGATCGCTGATGAGCACAAGCTCCGTGTGTTTTATGAAAAGCGCATGGGTGCTGAAGTCCCAGCTGATTCTCTTGGTGACGAATGGAAAGGTTATGTCGTTCGTATTGCTGGAGGAAACGACAAACAAGGTTTCCCAATGAAACAGGGAGTCCTTACCAATGGTCGTGTTAGATTGTTGTTGTCTAAGGGACACTCTTGCTACAGACCACGTCGTGATGGAGAACGTAAACGTAAATCTGTTCGTGGTTGCATCGTAGATGCTAACTTGAGTGTTTTAGCTCTTGTCATCGTAAAGAAGGGTGAAACGGAAATTCCCGGACTAACAGACGTGAATATTCCTCGTCGTTTGGGACCAAAGAGGGCAAGCAAAATCCGCAAACTGTTCAACTTGACAAAACAAGATGATGTTCGCCGATTTGTTGTAAAGCGCCCGATTACAAAAGAAGGAAAGAAAGAGCGCTTCAAGGCTCCTAAGATTCAGAGGCTCATTACTCCTCTGACATTACAGAGGAAGAGACATCGTGTTGCTCTCAAGAAGAGGCGTTCCGTTGCTCGCAAAGAGCAAGCCGATGAATACCACAAGTTATTGGCTCTAAGACAGAAAGAAGCTAGAGCTTCACATGCAAAGGAACTGAAGAGAAAGCGTAGTGCTTCTATGCGCGATTCAAAATCATCGAATCAGTCTGCACCTGCTGTTGCAAAGTAA。

[0123] RPL32 gene sequence (SEQ ID NO.21):

[0124] ATGTCGATCCGACCGGTGTACAGGCCAAAAATCGTAAAAAAGCGTACGAAGAAGTTCATACGCCATCAAAGTGATCGCTATGACAAACTCAAGAGGAACTGGAGAAAGCCTAAAGGTATTGATAACAGAGTCCGTAGGAGGTTCAAGGGACAATATTTAATGCCCAACATTGGTTATGGTAGCAACAAAAAGACCCGTCATATGCTCCCAACTGGTTTCAAGAAGGTCCTTGTACACAATGTTAAGGAATTGGAAGTCCTTATGATGCAGAACCGCAAATACTGCGCAGAAATTGCTCATGCAGTCAGCAGTAAAAAGCGAAAGAGCATTGTTGAACGTGCTCAGCAACTTTCTATTCGTGTGACGAATGCCAATGCTCGTCTCCGCTCCGAAGAAAATGAATGA。

[0125] H3 gene sequence (SEQ ID NO.22):

[0126] CATCGTTACAGGCCAGGAACTGTTGCTCTTCGTGAAATCCGTCGCTACCAGAAGAGCACGGAGCTTTTAATCCGCAAGTTACCTTTCCAACGTCTCGTGCGTGAAATTGCTCAGGATTTCAAGACCGATCTCCGCTTCCAAAGTTCAGCTGTGATGGCTCTCCAAGAGGCCAGTGAGGCTTACCTCGTTGGGCTTTTCGAGGACACCAACCTTTGCGCCATCCATGCCAAGCGTGTCACTATCATGCCGAAGGATATTCAATTGGCAAGACGCATCCGTGGAGAACGAGCTTAA。

[0127] GAPDH gene sequence (SEQ ID NO.23):

[0128]

[0129] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A reference gene for the Ali parasitic wasp, characterized in that, Including internal reference genes EIF5A, RPL7A, RPL13, H3, GAPDH, RPS6, and RPL32; The nucleotide sequence of the internal reference gene EIF5A is shown in SEQ ID NO.17; the nucleotide sequence of the internal reference gene RPL7A is shown in SEQ ID NO.18; the nucleotide sequence of the internal reference gene RPL13 is shown in SEQ ID NO.19; the nucleotide sequence of the internal reference gene RPS6 is shown in SEQ ID NO.20; the nucleotide sequence of the internal reference gene RPL32 is shown in SEQ ID NO.21; the nucleotide sequence of the internal reference gene H3 is shown in SEQ ID NO.22; and the nucleotide sequence of the internal reference gene GAPDH is shown in SEQ ID NO.

23.

2. A primer for detecting the reference gene of the Ali lice-eating wasp as described in claim 1, characterized in that, The detection primer sequences for the internal reference gene EIF5A are shown in SEQ ID NO. 13-14; the detection primer sequences for the internal reference gene RPL7A are shown in SEQ ID NO. 1-2; the detection primer sequences for the internal reference gene RPL13 are shown in SEQ ID NO. 3-4; the detection primer sequences for the internal reference gene RPS6 are shown in SEQ ID NO. 5-6; the detection primer sequences for the internal reference gene RPL32 are shown in SEQ ID NO. 7-8; the detection primer sequences for the internal reference gene H3 are shown in SEQ ID NO. 9-10; and the detection primer sequences for the internal reference gene GAPDH are shown in SEQ ID NO. 11-12.

3. A method for screening the reference gene of the Ali lice-eating wasp as described in claim 1, characterized in that, Includes the following steps: Candidate reference genes were selected, and the DNA of samples of Ali lice-eating fleas under different conditions was used as templates. The candidate reference genes were detected by real-time fluorescence quantitative PCR. The real-time fluorescence quantitative PCR data were analyzed, and the reference gene with the highest stability was selected as the reference gene of Ali lice-eating fleas. The different conditions include different developmental stages, different tissues, different diets, different periods of starvation, different temperatures, and different populations.

4. The application of the internal reference gene of *Amanita muscaria* as described in claim 1 or the detection primer as described in claim 2 in the correction of gene expression levels of *Amanita muscaria* under different conditions.

5. The application according to claim 4, characterized in that, The different conditions include different developmental stages, different tissues, different diets, different periods of starvation, different temperatures, and different populations.

6. The application according to claim 4, characterized in that, When correcting gene expression levels in *Aegilops alias* at different developmental stages, the internal reference genes are EIF5A and RPL32; when correcting gene expression levels in *Aegilops alias* under different dietary conditions, the internal reference genes are RPS6 and GAPDH; when correcting gene expression levels in *Aegilops alias* in different tissues, the internal reference genes are RPL7A and RPS6; when correcting gene expression levels in *Aegilops alias* under different starvation periods, the internal reference genes are RPL32 and RPS6; when correcting gene expression levels in *Aegilops alias* at different temperatures, the internal reference genes are RPL7A and RPS6; when correcting gene expression levels in *Aegilops alias* from different populations, the internal reference genes are RPL13 and H3.

Images