Pichia pastoris vector for integrating gene to TEF1 site as well as construction method and application of pichia pastoris vector
By constructing a vector containing the TEF1 promoter site in Pichia pastoris, the problems of limited site selection and cumbersome operation in existing technologies have been solved, enabling rapid expression of multiple genes and simplifying operations, thereby improving research efficiency.
Patent Information
- Application Number
- CN202510779573.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-12
- Publication Date
- 2025-10-28
AI Technical Summary
Existing technologies have a limited range of gene integration sites in Pichia pastoris, traditional homologous recombination is cumbersome, and CRISPR technology has a long construction time, making it difficult to rapidly express multiple genes.
By constructing a Pichia pastoris vector containing the TEF1 promoter, the target gene is inserted using the TEF1 promoter site, and combined with antibiotic screening, the operation process is simplified, and the success rate and selectivity are improved.
It expanded the range of gene integration sites that can be selected, shortened the construction time, simplified the operation steps, improved the research progress and safety, and enabled rapid validation of multiple genes.
Smart Images

Figure CN120843571A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of genetic engineering, and more particularly to a Pichia pastoris vector, its construction method, and its application. Background Technology
[0002] Pichia pastoris (hereinafter referred to as Pichia pastoris) has strong growth capacity and can grow in inexpensive, non-selective culture media. Pichia pastoris is a facultative anaerobe with a wide pH tolerance range, generally 3.0-8.0. Due to its rapid reproduction rate and good fermentation foundation, it is highly suitable for achieving high-density fermentation.
[0003] Pichia pastoris can be used to express eukaryotic proteins. Since plasmids are difficult to maintain, a common method is to introduce linearized plasmids into competent cells, and then use the Pichia pastoris' own repair system and antibiotic selection to obtain strains with inserted target genes. Commonly used promoters for Pichia pastoris are the methanol-induced AOX1 (methanol oxidase 1) promoter and the GAP (glyceraldehyde-3-phosphate dehydrogenase) promoter.
[0004] Currently, there are two main methods for modifying Pichia pastoris: homologous recombination represented by plasmids such as pPIC9K, pPICZα, and pGAPZα, and CRISPR technology. Traditional homologous recombination has limited selectable sites, only integrating into the AOX1 promoter, GAP promoter, and His4 site; the selectable promoters are also limited to AOX1 and GAP, and even in studies of other promoters, integration into the His4 site is often the primary focus. While traditional homologous recombination is simple to perform, its limited range of selectable sites makes it difficult to meet research needs. CRISPR technology, on the other hand, allows for scarless gene editing and has a very high success rate using Δku70 strain as a chassis cell. Its disadvantages are long construction time and cumbersome operation.
[0005] If Pichia pastoris needs to express 2-3 genes, traditional methods are difficult to implement, and CRISPR technology requires a long construction time. For methanol-induced protein expression, histidine-deficient strains such as GS115 have both the AOX1 promoter and His4 site available; for constitutive expression using glucose or glycerol, only the GAP promoter site is available. Therefore, if new integration sites are available in addition to traditional methods, research progress can be accelerated, allowing for rapid validation. Summary of the Invention
[0006] To overcome the shortcomings of existing technologies, this invention provides a Pichia pastoris vector that integrates genes into the TEF1 site and its construction method. The target gene to be expressed can be inserted into the TEF1 promoter site. After the target gene is introduced, secretory high-copy expression strains that do not require antibiotic selection can be easily obtained. The invention also simplifies the operation steps, reduces production costs, improves safety, and can accelerate research progress and enable rapid verification.
[0007] To achieve the above objectives, the embodiments of the present invention adopt the following technical solutions:
[0008] According to one aspect of the present invention, the yeast vector of the present invention includes a TEF1 promoter, the sequence of which is:
[0009] ATAACTGTCGCCTCTTTTATCTGCCGCACTGCATGAGGTGTCCCCTTAGTGGGAAAGAGTACTGAGCCAACCCTGGAGGACAGCAAGGGAAAAATACCTACAACTTGCTTCATAATGGTCGTAAAAACAATCCTTGTCGGATATAAGTGTTGTAGACTGTCCCTTATCCTCTGCGATGTTCTTCCTCTCAAAGTTTGCGATTTCTCTCTATC AGAATTGCCATCAAGAGACTCAGGACTAATTTCGCAGTCCCACACGCACTCGTACATGATTGGCTGAAATTTCCCTAAAGAATTTCTTTTTCACGAAAATTTTTTTTTTACACAAGATTTTCAGCAGATATAAAATGGAGAGCAGGACCTCCGCTGTGACTCTTCTTTTTTTTTCTTTTATTCTCACTACATACATTTTAGTTATTCGCCAAC.
[0010] According to one aspect of the present invention, the yeast vector of the present invention includes a prokaryotic replication element, an anti-resistance gene expression cassette, and a gene expression cassette.
[0011] According to one aspect of the invention, the yeast vector of the invention carries a histidine tag and an α-signal peptide.
[0012] According to one aspect of the present invention, the method for constructing a Pichia pastoris vector includes constructing a vector skeleton, obtaining the vector skeleton, obtaining the promoter, transforming the fragment, obtaining and inserting the target gene, and transforming Pichia pastoris.
[0013] According to one aspect of the present invention, the construction of the vector backbone includes: obtaining plasmid backbone 1 using ZTGJ-1-F and ZTGJ-1-R as primers, obtaining plasmid backbone 2 using ZTGJ-2-F and ZTGJ-2-R as primers, and obtaining plasmid backbone 3 using ZTGJ-3-F and ZTGJ-3-R as primers, wherein the primer sequences are as follows:
[0014] ZTGJ-1-F:ATGAGATTTCCTTCAATTTTTACTGC
[0015] ZTGJ-1-R:ATGATGATGATGGTCTCTAGAAAGCTGGCGGCCG
[0016] ZTGJ-2-F:GACCATCATCATCATCATCATTGAG
[0017] ZTGJ-2-R:GGTTTAGTTCCTCACCTTGTCGTAT
[0018] ZTGJ-3-F:GTCCCCCTTTTCCTTTGTCG
[0019] ZTGJ-3-R:TGATCTCATGCATGACCAAAATCCCTT.
[0020] According to one aspect of the present invention, the plasmid backbone 1 is obtained from primers ZTGJ-1-F and ZTGJ-1-R, wherein the plasmid backbone 1 contains an α-signal peptide + restriction site and the template is pGAPZα.
[0021] According to one aspect of the invention, the plasmid backbone 2 is obtained from primers ZTGJ-2-F and ZTGJ-2-R, wherein the plasmid backbone 2 comprises a histidine tag and an AOX1 terminator and a TEF1 / EM7 promoter, and the template is pGAPZα.
[0022] According to one aspect of the invention, the plasmid backbone 3 is obtained from primers ZTGJ-3-F and ZTGJ-3-R, wherein the plasmid backbone 3 contains a CYC1 terminator and an Ori, and the template is pGAPZα.
[0023] According to one aspect of the present invention, obtaining the resistance gene includes: using BB3cH_pGAP_23_pPFK300_Cas9 as a template, designing upstream and downstream primers HYG-F and HYG-R for amplification to obtain the resistance gene, wherein the upstream and downstream primer sequences are as follows:
[0024] HYG-F: GTGAGGAACTAAACCATGGGTAAAAAAGCCTGAACTCACC
[0025] HYG-R: AAGGAAAAGGGGGACTTATTCCTTTGCCCTCGGACG.
[0026] According to one aspect of the present invention, obtaining the promoter includes: using the GS115 genome as a template, and using TEF1-F and TEF1-R as upstream and downstream primers, the primer sequences being:
[0027] TEF1-F: TCATGCATGAGATCAATAACTGTCGCCTCTTTTATCTGCC
[0028] TEF1-R:TGAAGGAAATCTCATGTTGGCGAATAACTAAAATGTATGTAGTG.
[0029] As a further embodiment of the present invention, the fragment conversion step is as follows: take Escherichia coli TOP10 competent cells, melt them on ice, add the ligation product, gently tap the bottom of the tube to mix, incubate on ice for 30 minutes, heat shock at 42°C for 45 seconds, and then incubate on ice for 2 minutes to complete the process.
[0030] As a further aspect of the present invention, the step of transforming the target gene into Pichia pastoris is as follows: Pichia pastoris competent cells are taken, and no more than 1 / 10 volume of linearized vector (total 1-5 μg) is added and mixed. After incubating on ice for 5 minutes, electroporation is performed under the following conditions: voltage 1.5 kV, resistance 400 Ω, and capacitance 25 μF. After electroporation, 1 M sorbitol is quickly added, and the mixture is incubated at 30°C and 170 rpm for 2-3 hours to obtain the Pichia pastoris vector.
[0031] As a further aspect of the present invention, the application of the Pichia pastoris vector integrating the gene into the TEF1 site in obtaining antibiotic-free secretory high-copy-expression strains.
[0032] The advantages of this invention are as follows: By using the TEF1 promoter, the range of options is expanded, and the number of selectable sites increases. While ensuring a high success rate, the construction time is shortened, the operation is simplified, and the needs of practical experiments are met. This method enables Pichia pastoris to express 2-3 genes, and can express multiple genes when used in conjunction with pGAPZα. If bleomycin and hygromycin are used simultaneously for bispecific antibody screening, genes can be inserted at two sites at once, shortening the time, accelerating research progress, and enabling rapid validation, further improving the convenience and applicability of target gene introduction. Attached Figure Description
[0033] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0034] Figure 1 This is the DNA marker used for electrophoretic verification in this invention;
[0035] Figure 2 The electrophoresis verification results of plasmid backbone 1, 2, and 3 as described in this invention;
[0036] Figure 3 The electrophoresis results are for verification of the HYG resistance gene.
[0037] Figure 4 Electrophoresis verification results for the TEF1 promoter;
[0038] Figure 5 The protein marker used for electrophoretic verification in this invention;
[0039] Figure 6 Electrophoretic verification results of the present invention after inserting the target gene CtCBH;
[0040] Figure 7 This is a schematic diagram of the pTEF1Ha recombinant vector described in this invention. Detailed Implementation
[0041] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.
[0042] Example 1
[0043] This invention provides a Pichia pastoris vector that integrates genes into the TEF1 site, allowing the target gene to be inserted into the TEF1 promoter site. For example, CtCBH can be integrated and inserted into the TEF1 promoter site.
[0044] This Pichia pastoris vector that integrates genes into the TEF1 site includes: a prokaryotic replication element, a HYG resistance gene expression cassette, and a TEF1 promoter-driven gene expression cassette.
[0045] The replicon of the prokaryotic replication element is Ori, which ensures high-copy replication of the plasmid in the large intestine. The sequence of the prokaryotic replication element Ori is as follows:
[0046] .
[0047] The HYG resistance gene expression cassette uses HYG as a selection marker to facilitate vector detection and screening. The HYG resistance gene expresses hygromycin resistance in both prokaryotes and eukaryotes. The sequence of the HYG resistance gene is as follows:
[0048]
[0049] The TEF1 promoter-driven gene expression cassette serves as a promoter site, allowing the target gene to be inserted and driving its expression. The TEF1 promoter sequence is as follows:
[0050] ATAACTGTCGCCTCTTTTATCTGCCGCACTGCATGAGGTGTCCCCTTAGTGGGAAAGAGTACTGAGCCAACCCTGGAGGACAGCAAGGGAAAAATACCTACAACTTGCTTCATAATGGTCGTAAAAACAATCCTTGTCGGATATAAGTGTTGTAGACTGTCCCTTATCCTCTGCGATGTTCTTCCTCTCAAAGTTTGCGATTTCTCTCTATC AGAATTGCCATCAAGAGACTCAGGACTAATTTCGCAGTCCCACACGCACTCGTACATGATTGGCTGAAATTTCCCTAAAGAATTTCTTTTTCACGAAAATTTTTTTTTTACACAAGATTTTCAGCAGATATAAAATGGAGAGCAGGACCTCCGCTGTGACTCTTCTTTTTTTTTCTTTTATTCTCACTACATACATTTTAGTTATTCGCCAAC.
[0051] Example 2
[0052] 1. Obtaining the fragments required to construct carrier 1
[0053] 1.1. Acquisition of the Carrier 1 Skeleton
[0054] Primer design
[0055] Using pGAPZα as a template, upstream and downstream primers ZTGJ-1-F and ZTGJ-1-R, ZTGJ-2-F and ZTGJ-2-R, and ZTGJ-3-F and ZTGJ-3-R were designed. The primer sequences are as follows:
[0056] ZTGJ-1-F:ATGAGATTTCCTTCAATTTTTACTGC
[0057] ZTGJ-1-R:ATGATGATGATGGTCTCTAGAAAGCTGGCGGCCG
[0058] ZTGJ-2-F:GACCATCATCATCATCATCATTGAG
[0059] ZTGJ-2-R:GGTTTAGTTCCTCACCTTGTCGTAT
[0060] ZTGJ-3-F:GTCCCCCTTTTCCTTTGTCG
[0061] ZTGJ-3-R:TGATCTCATGCATGACCAAAATCCCTT.
[0062] Acquisition of the carrier skeleton
[0063] The sequences of vector 1 backbones 1, 2, and 3 were amplified by PCR using the designed upstream and downstream primers. Plasmid backbone 1 was obtained using ZTGJ-1-F and ZTGJ-1-R, and it contains an α-signal peptide + restriction enzyme site. Plasmid backbone 2 was obtained using ZTGJ-2-F and ZTGJ-2-R, and it contains a histidine tag, an AOX1 terminator, and a TEF1 / EM7 promoter. Plasmid backbone 3 was obtained using ZTGJ-3-F and ZTGJ-3-R, and it includes a CYC1 terminator and Ori. Electrophoresis of the vector 1 plasmid backbones and the verification images of plasmid backbones 1, 2, and 3 are shown below. Figure 2 As shown, Figure 2 From left to right: marker, plasmid backbone 1, plasmid backbone 2, and plasmid backbone 3. The marker used is as follows: Figure 1 As shown in Table 1.
[0064] Table 1. PCR reaction system 1
[0065] Ingredient name volume 2×Phata mixture 25μL Primer 1 2μL Primer 2 2μL pGAPZα 1μL water 20μL total 50μL
[0066] In the above amplification system, primer 1 is the upstream primer, which is ZTGJ-1-F, ZTGJ-2-F or ZTGJ-3-F; primer 2 is the downstream primer, which is ZTGJ-1-R, ZTGJ-2-R or ZTGJ-3-R.
[0067] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0068] 1.2. Obtaining resistance genes
[0069] Using BB3cH_pGAP_23_pPFK300_Cas9 as a template, upstream and downstream primers HYG-F and HYG-R were designed. The primer sequences are as follows:
[0070] HYG-F: GTGAGGAACTAAACCATGGGTAAAAAAGCCTGAACTCACC
[0071] HYG-R: AAGGAAAAGGGGGACTTATTCCTTTGCCCTCGGACG.
[0072] The HYG resistance gene was amplified by PCR using the designed upstream primer HYG-F and downstream primer HYG-R. Electrophoresis was performed after amplification, and the electrophoresis verification image of the HYG resistance gene is shown below. Figure 3 As shown in Table 2, the PCR reaction system is as follows.
[0073] Table 2. PCR reaction system 2
[0074] Ingredient name volume 2×Phata mixture 25μL HYG-F 2μL HYG-R 2μL plasmid 1μL water 20μL total 50μL
[0075] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0076] 1.3. Starter Acquisition
[0077] Using the GS115 genome template, upstream primer TEF1-F and downstream primer TEF1-R were designed. The primer sequences are as follows:
[0078] TEF1-F: TCATGCATGAGATCAATAACTGTCGCCTCTTTTATCTGCC
[0079] TEF1-R:TGAAGGAAATCTCATGTTGGCGAATAACTAAAATGTATGTAGTG.
[0080] Using the GS115 genome as a template, the TEF1 promoter sequence was amplified by PCR using the designed upstream primer TEF1-F and downstream primer TEF1-R. Electrophoresis was performed after amplification, and the electrophoresis results of the TEF1 promoter are shown below. Figure 4 As shown in Table 3.
[0081] Table 3. PCR reaction system 3
[0082] Ingredient name volume 2×Phata mixture 25μL TEF1-F 2μL TEF1-R 2μL GS115 genome 1μL water 20μL total 50μL
[0083] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0084] 2. Fragment connection transformation
[0085] 2.1 Seamless Cloning
[0086] The ligation reaction was performed using 2×CE mixture V3, plasmid backbone 1, plasmid backbone 2, plasmid backbone 3, the HYG resistance gene, the TEF1 promoter, and water. The resulting plasmid is shown below. Figure 7 As shown in Table 4, the seamless cloning connection system is a prime example.
[0087] Table 4 Seamless Cloning Connection System
[0088] Ingredient name volume 2×CE mixture V3 5μL plasmid backbone 1 variable plasmid backbone 2 variable plasmid backbone 3 variable HYG resistance gene variable TEF1 promoter variable water variable total 10μL
[0089] The amount of each fragment added was 0.02 ng * base pairs, and water was added to bring the volume to 10 μL. Ligation was carried out at 50 °C for 30 min to obtain the ligation product, which was then stored on ice.
[0090] 2.2 Fragment Conversion
[0091] Remove E. coli TOP10 competent cells, thaw them on ice and add the ligation product, gently tap the bottom of the tube to mix, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for 2 min to obtain vector 1.
[0092] Resuscitate at 37℃ and 220 rpm for 1 hour, centrifuge at 5000 rpm for 1 minute, aspirate part of the culture medium, retain a small amount of culture medium to resuspend the cells, and spread them on LB plates containing hygromycin (50 mg / L).
[0093] 2.3 Colony PCR Validation
[0094] Single colonies on the plate were selected for PCR verification. Single colonies with the correct size bands were amplified and plasmids were extracted. The PCR reaction system is shown in Table 5.
[0095] Table 5 PCR reaction system 3
[0096] Ingredient name volume 2×Rapid mixture 12.5μL TEF1-F 1μL ZTGJ-2-R 1μL water 10.5μL total 25μL
[0097] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0098] 3. Use of Carrier 1
[0099] 3.1 Insertion of the target gene
[0100] 3.1.1 Linearization of Carrier 1
[0101] Vector 1 was digested with EcoRI, KpnI, NotI, or XbaI, or reverse PCR was performed. The reaction system is shown in Table 6.
[0102] Table 6. Linearization reaction system with carrier 1
[0103] Ingredient name volume EcoRI 1μL XbaI 1μL <![CDATA[rCutSmart TM Buffer solution 5μL Carrier 1 variable water variable total 50μL
[0104] The volume of carrier 1 is not fixed and should be adjusted to 50 μL with water according to the kit instructions.
[0105] 3.1.2 Obtaining the target gene to be expressed
[0106] The target gene to be expressed is obtained from the genome or vector using conventional methods. The target gene is then ligated with T4 ligase according to the commonly used ligation method for the target gene to be expressed, or seamless cloning is performed using a 15-25bp homologous arm to be ligated with vector 1. The target gene to be expressed must not contain an AccI site.
[0107] 3.1.3 Use T4 ligase for ligation or perform seamless cloning.
[0108] When using T4 ligase for ligation, the reaction system is shown in Table 7.
[0109] Table 7. T4 ligase ligation system 1
[0110]
[0111] Use the connection system with item number 2011a from the Takara brand.
[0112] The reaction system for seamless cloning is shown in Table 8.
[0113] Table 8. Seamless Cloning Connection System 2
[0114] Ingredient name volume 2×CE mixture V3 5μL Linearized plasmids variable Target gene variable water variable total 10μL
[0115] Use the seamless cloning connection system with product number C117-01 from the Novizan brand.
[0116] The volumes of the linearized plasmid and the target gene are not fixed and should be adjusted to 10 μL with water, according to the kit instructions.
[0117] Vector 1 was ligated to the target gene to be expressed using T4 ligase or seamless cloning to obtain vector 2.
[0118] 3.1.4 PCR verification after transformation
[0119] The single colonies that tested positive were cultured and plasmids were extracted for PCR verification. The reaction system is shown in Table 9.
[0120] Table 9. PCR reaction system 5
[0121] Ingredient name volume 2×Rapid mixture 12.5μL ZTJP-F1 1μL ZTJP-R1 1μL water 10.5μL total 25μL
[0122] ZTJP-F1: GATTTCGATGTTGCTGTTTTGCC
[0123] ZTJP-R1: CGGCTTCTCGTAAGTGCCC.
[0124] 4. Transformation of Pichia pastoris
[0125] 4.1 Linearization of Carrier 2
[0126] 4.1.1 Enzyme digestion linearization
[0127] Vector 2 was linearized using AccI single enzyme. A small amount of the digestion product was run on a gel to confirm the digestion effect, and the remaining digestion product was recovered. The reaction system is shown in Table 10.
[0128] Table 10. Linearization reaction system 2
[0129] Ingredient name volume AccI 1μL <![CDATA[rCutSmart TM Buffer solution 5μL Carrier 2 variable water variable total 50μL
[0130] The volume of carrier 2 is not fixed and should be adjusted to 50 μL with water according to the kit instructions.
[0131] 4.2 Transformation of Pichia pastoris
[0132] Take competent Pichia pastoris cells and add no more than 1 / 10 volume of linearized vector 2, totaling 1-5 μg. Mix and incubate on ice for 5 min before electroporation. Electroporation conditions: voltage 1.5 kV, resistance 400 Ω, capacitance 25 μF. After electroporation, quickly add 1 M sorbitol and incubate at 30℃ and 170 rpm for 2-3 h on a shaker to obtain a Pichia pastoris vector with the integrated gene at the TEF1 site. Centrifuge at 5000 rpm for 1 min, resuspend the cells in a small amount of supernatant, and plate on yeast extract peptone dextrose agar plates containing G418 (200 mg / L). Single colonies are visible after 2-3 days.
[0133] 4.3 PCR verification after transformation
[0134] For colony PCR verification, successfully verified single colonies were transferred to high-antibody plates to screen for multiple copies. The PCR reaction system is shown in Table 11.
[0135] Table 11. PCR reaction system 6
[0136] Ingredient name volume 2×Rapid mixture 12.5μL TEF1JP-F1 1μL TEF1JP-R1 1μL water 10.5μL total 25μL
[0137] TEF1JP-F1:TCTTGCCCATTCCAACTCGT
[0138] TEF1JP-R1: GGATGCTGCGAATAAAACAGCAG.
[0139] Example 3
[0140] 1. Obtaining the fragments required to construct carrier 1
[0141] 1.1. Acquisition of the Carrier 1 Skeleton
[0142] Using pGAPZα as a template, upstream and downstream primers ZTGJ-1-F and ZTGJ-1-R, ZTGJ-2-F and ZTGJ-2-R, and ZTGJ-3-F and ZTGJ-3-R were designed. The primer sequences are as follows:
[0143] ZTGJ-1-F:ATGAGATTTCCTTCAATTTTTACTGC
[0144] ZTGJ-1-R:ATGATGATGATGGTCTCTAGAAAGCTGGCGGCCG
[0145] ZTGJ-2-F:GACCATCATCATCATCATCATTGAG
[0146] ZTGJ-2-R:GGTTTAGTTCCTCACCTTGTCGTAT
[0147] ZTGJ-3-F:GTCCCCCTTTTCCTTTGTCG
[0148] ZTGJ-3-R:TGATCTCATGCATGACCAAAATCCCTT.
[0149] The sequences of vector 1 backbones 1, 2, and 3 were amplified by PCR using the designed upstream and downstream primers. Plasmid backbone 1 was obtained using ZTGJ-1-F and ZTGJ-1-R, and it contains an α-signal peptide + restriction enzyme site. Plasmid backbone 2 was obtained using ZTGJ-2-F and ZTGJ-2-R, and it contains a histidine tag, an AOX1 terminator, and a TEF1 / EM7 promoter. Plasmid backbone 3 was obtained using ZTGJ-3-F and ZTGJ-3-R, and it includes a CYC1 terminator and Ori. The electrophoresis verification images of plasmid backbones 1, 2, and 3 after electrophoresis of vector 1 are shown below. Figure 2 As shown, Figure 2From left to right: marker, plasmid backbone 1, plasmid backbone 2, and plasmid backbone 3. The marker used is as follows: Figure 1 As shown in Table 12.
[0150] Table 12. PCR reaction system 7
[0151] Ingredient name volume 2×Phata mixture 25μL Primer 1 2μL Primer 2 2μL pGAPZα 1μL water 20μL total 50μL
[0152] In the above amplification system, primer 1 is the upstream primer, which is ZTGJ-1-F, ZTGJ-2-F or ZTGJ-3-F; primer 2 is the downstream primer, which is ZTGJ-1-R, ZTGJ-2-R or ZTGJ-3-R.
[0153] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0154] 1.2. Obtaining resistance genes
[0155] Using BB3cH_pGAP_23_pPFK300_Cas9 as a template, upstream and downstream primers HYG-F and HYG-R were designed. The primer sequences are as follows:
[0156] HYG-F: GTGAGGAACTAAACCATGGGTAAAAAAGCCTGAACTCACC
[0157] HYG-R: AAGGAAAAGGGGGACTTATTCCTTTGCCCTCGGACG.
[0158] The HYG resistance gene was amplified by PCR using the designed upstream primer HYG-F and downstream primer HYG-R. Electrophoresis was performed after amplification, and the electrophoresis verification image of the HYG resistance gene is shown below. Figure 3 As shown in Table 13.
[0159] Table 13. PCR reaction system 8
[0160] Ingredient name volume 2×Phata mixture 25μL HYG-F 2μL HYG-R 2μL plasmid 1μL water 20μL total 50μL
[0161] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0162] 1.3. Starter Acquisition
[0163] Using the GS115 genome template, upstream primer TEF1-F and downstream primer TEF1-R were designed. The primer sequences are as follows:
[0164] TEF1-F: TCATGCATGAGATCAATAACTGTCGCCTCTTTTATCTGCC
[0165] TEF1-R:TGAAGGAAATCTCATGTTGGCGAATAACTAAAATGTATGTAGTG.
[0166] Using the GS115 genome as a template, the TEF1 promoter sequence was amplified by PCR using the designed upstream primer TEF1-F and downstream primer TEF1-R. Electrophoresis was performed after amplification, and the electrophoresis results of the TEF1 promoter are shown below. Figure 4 As shown in Table 14.
[0167] Table 14. PCR reaction system (9)
[0168]
[0169] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0170] 2. Fragment connection transformation
[0171] 2.1 Seamless Cloning
[0172] The ligation reaction was performed using 2×CE mixture V3, plasmid backbone 1, plasmid backbone 2, plasmid backbone 3, the HYG resistance gene, the TEF1 promoter, and water. The resulting plasmid is shown below. Figure 7 As shown in Table 15, the seamless cloning connection system is a prime example.
[0173] Table 15. Seamless Cloning Linkage System
[0174] Ingredient name volume 2×CE mixture V3 5μL plasmid backbone 1 variable plasmid backbone 2 variable plasmid backbone 3 variable HYG resistance gene variable TEF1 promoter variable water variable total 10μL
[0175] The amount of each fragment added was 0.02 ng * base pairs, and water was added to bring the volume to 10 μL. Ligation was carried out at 50 °C for 30 min to obtain the ligation product, which was then stored on ice.
[0176] 2.2 Fragment Conversion
[0177] Remove E. coli TOP10 competent cells, thaw them on ice and add the ligation product, gently tap the bottom of the tube to mix, incubate on ice for 30 min, heat shock at 42℃ for 45 s, incubate on ice for 2 min to obtain vector 1.
[0178] Resuscitate at 37℃ and 220 rpm for 1 hour, centrifuge at 5000 rpm for 1 minute, aspirate part of the culture medium, retain a small amount of culture medium to resuspend the cells, and spread them on LB plates containing hygromycin (50 mg / L).
[0179] 2.3 Colony PCR Validation
[0180] Single colonies on the plate were selected for PCR verification. Single colonies with the correct size bands were amplified and plasmids were extracted. The PCR reaction system is shown in Table 16.
[0181] Table 16. PCR reaction system (10)
[0182] Ingredient name volume 2×Rapid mixture 12.5μL TEF1-F 1μL ZTGJ-2-R 1μL water 10.5μL total 25μL
[0183] The PCR reaction conditions were as follows: 95℃ for 3 min pre-denaturation; 95℃ for 15 s denaturation, 58℃ for 15 s annealing, 72℃ for 30-60 s / kb extension, for a total of 30 cycles; and 72℃ for 5 min for complete extension.
[0184] 3. Use of Carrier 1
[0185] 3.1 Insertion of the target gene
[0186] 3.1.1 Linearization of Carrier 1
[0187] Vector 1 was digested with EcoRI, KpnI, NotI, or XbaI, or reverse PCR was performed. The reaction system is shown in Table 17.
[0188] Table 17. Linearization reaction system with carrier 1
[0189] Ingredient name volume EcoRI 1μL XbaI 1μL <![CDATA[rCutSmart TM Buffer solution 5μL Carrier 1 variable water variable total 50μL
[0190] The volume of carrier 1 is not fixed and should be adjusted to 50 μL with water according to the kit instructions.
[0191] 3.1.2 Obtaining the target gene to be expressed
[0192] The target gene CtCBH, constructed by Shanghai Sangon Biotech Co., Ltd., has the following nucleic acid sequence:
[0193]
[0194] Vector 1 was ligated to the target gene to be expressed using T4 ligase or seamless cloning to obtain vector 3.
[0195] 3.1.3 PCR verification was performed after transformation.
[0196] The single colonies that were verified as positive were cultured and plasmids were extracted for PCR verification. The reaction system is shown in Table 18.
[0197] Table 18. PCR reaction system 11
[0198] Ingredient name volume 2×Rapid mixture 12.5μL ZTJP-F1 1μL ZTJP-R1 1μL water 10.5μL total 25μL
[0199] ZTJP-F1: GATTTCGATGTTGCTGTTTTGCC
[0200] ZTJP-R1: CGGCTTCTCGTAAGTGCCC.
[0201] 4. Transformation of Pichia pastoris
[0202] 4.1 Linearization of Carrier 3
[0203] 4.1.1 Enzyme digestion linearization
[0204] Vector 3 was linearized using AccI single enzyme. A small amount of the digestion product was run on a gel to confirm the digestion effect, and the remaining digestion product was recovered. The reaction system is shown in Table 19.
[0205] Table 19. Linearization reaction system with carrier 4
[0206] Ingredient name volume AccI 1μL <![CDATA[rCutSmart TM Buffer solution 5μL Carrier 3 variable water variable total 50μL
[0207] The volume of carrier 3 is not fixed and should be adjusted to 50 μL with water according to the kit instructions.
[0208] 4.2 Transformation of Pichia pastoris
[0209] Take competent Pichia pastoris cells and add no more than 1 / 10 volume of linearized vector 3, totaling 1-5 μg. Mix and incubate on ice for 5 min before electroporation. Electroporation conditions: voltage 1.5 kV, resistance 400 Ω, capacitance 25 μF. After electroporation, quickly add 1 M sorbitol and incubate at 30℃ and 170 rpm for 2-3 h on a shaker to obtain a Pichia pastoris vector with the integrated gene at the TEF1 site. Centrifuge at 5000 rpm for 1 min, resuspend the cells in a small amount of supernatant, and plate on yeast extract peptone dextrose agar plates containing G418 (200 mg / L). Single colonies are visible after 2-3 days.
[0210] 4.3 PCR verification after transformation
[0211] For colony PCR verification, successfully verified single colonies were transferred to high-antibody plates to screen for multiple copies. The PCR reaction system is shown in Table 20.
[0212] Table 20. PCR reaction system 12
[0213] Ingredient name volume 2×Rapid mixture 12.5μL TEF1JP-F1 1μL TEF1JP-R1 1μL water 10.5μL total 25μL
[0214] TEF1JP-F1:TCTTGCCCATTCCAACTCGT
[0215] TEF1JP-R1: GGATGCTGCGAATAAAACAGCAG.
[0216] 4.4 Electrophoresis verification was performed after transformation.
[0217] Successfully validated single colonies were then verified by electrophoresis, using protein markers such as... Figure 5 As shown, the electrophoresis verification results after inserting the target gene CtCBH are as follows: Figure 6 As shown.
[0218] The TEF1 promoter sequence, replicon sequence, resistance gene sequence, primer sequence, and target gene sequence used in this invention are shown in Table 21 below:
[0219] Table 21. Sequence List
[0220]
[0221]
[0222]
[0223] Advantages of this invention: The above-described scheme reduces costs. Compared to traditional homologous recombination methods, it expands the range of options and increases the number of selectable sites. It shortens construction time while maintaining a high success rate, simplifies operations, and meets practical experimental needs. This method enables Pichia pastoris to express 2-3 genes while shortening construction time compared to Cri-SPR technology, accelerating research progress, facilitating rapid validation, and further improving the convenience and applicability of target gene introduction.
[0224] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A Pichia pastoris vector for integrating a gene into the TEF1 site, characterized in that, The yeast vector includes a prokaryotic replication element, an antibiotic resistance gene expression cassette, and a gene expression cassette. The gene expression cassette includes a TEF1 promoter, the sequence of which is as follows: ATAACTGTCGCCTCTTTTATCTGCCGCACTGCATGAGGTGTCCCCTTAGTGGGAAAGAGTACTGAGCCAACCCTGGAGGACAGCAAGGGAAAAATACCTACAACTTGCTTCATAATGGTCGTAAAAACAATCCTTGTCGGATATAAGTGTTGTAGACTGTCCCTTATCCTCTGCGATGTTCTTCCTCTCAAAGTTTGCGATTTCTCTCTATC AGAATTGCCATCAAGAGACTCAGGACTAATTTCGCAGTCCCACACGCACTCGTACATGATTGGCTGAAATTTCCCTAAAGAATTTCTTTTTCACGAAAATTTTTTTTTTACACAAGATTTTCAGCAGATATAAAATGGAGAGCAGGACCTCCGCTGTGACTCTTCTTTTTTTTTCTTTTATTCTCACTACATACATTTTAGTTATTCGCCAAC.
2. The Pichia pastoris carrier according to claim 1, characterized in that, The resistance gene expression cassette includes the HYG resistance gene.
3. The Pichia pastoris carrier according to claim 1, characterized in that, The Pichia pastoris vector carries a histidine tag and an α-signal peptide.
4. A method for constructing the Pichia pastoris vector according to any one of claims 1 to 3, characterized in that, The method includes the following parts: Construct the carrier skeleton; Acquire resistance genes; Obtain the promoter; The vector is obtained by linking the vector backbone, resistance gene, and promoter; Fragment conversion; The target gene was transformed into Pichia pastoris.
5. The method for constructing a Pichia pastoris vector according to claim 4, characterized in that, The construction of the vector backbone includes: obtaining plasmid backbone 1 using ZTGJ-1-F and ZTGJ-1-R as primers, obtaining plasmid backbone 2 using ZTGJ-2-F and ZTGJ-2-R as primers, and obtaining plasmid backbone 3 using ZTGJ-3-F and ZTGJ-3-R as primers. The primer sequences are as follows: ZTGJ-1-F:ATGAGATTTCCTTCAATTTTTACTGC ZTGJ-1-R:ATGATGATGATGGTCTCTAGAAAGCTGGCGGCCG ZTGJ-2-F:GACCATCATCATCATCATCATTGAG ZTGJ-2-R:GGTTTAGTTCCTCACCTTGTCGTAT ZTGJ-3-F:GTCCCCCTTTTCCTTTGTCG ZTGJ-3-R:TGATCTCATGCATGACCAAAATCCCTT.
6. The construction method according to claim 4, characterized in that, The acquisition of the resistance gene includes: using BB3cH_pGAP_23_pPFK300_Cas9 as a template, designing upstream and downstream primers HYG-F and HYG-R for amplification to obtain the resistance gene HYG. The primer sequences are as follows: HYG-F: GTGAGGAACTAAACCATGGGTAAAAAAGCCTGAACTCACC HYG-R: AAGGAAAAGGGGGACTTATTCCTTTGCCCTCGGACG.
7. The construction method according to claim 4, characterized in that, The acquisition of the promoter includes: using the GS115 genome as a template, and using TEF1-F and TEF1-R as upstream and downstream primers, with the primer sequences as follows: TEF1-F: TCATGCATGAGATCAATAACTGTCGCCTCTTTTATCTGCC TEF1-R:TGAAGGAAATCTCATGTTGGCGAATAACTAAAATGTATGTAGTG.
8. The carrier construction method according to claim 4, characterized in that, The fragment transformation steps are as follows: take E. coli TOP10 competent cells, melt them on ice, add the ligation product, gently tap the bottom of the tube to mix, incubate on ice for 30 min, heat shock at 42℃ for 45 s, and then incubate on ice for 2 min to complete the process.
9. The carrier construction method according to claim 4, characterized in that, The steps for transforming the target gene into Pichia pastoris are as follows: Take competent Pichia pastoris cells, add no more than 1 / 10 volume of linearized vector (total 1-5 μg), mix, incubate on ice for 5 min, and then perform electroporation under the following conditions: voltage 1.5 kV, resistance 400 Ω, capacitance 25 μF. After electroporation, quickly add 1 M sorbitol and revive at 30℃ and 170 rpm for 2-3 h to obtain the Pichia pastoris vector.
10. The application of a Pichia pastoris vector that integrates a gene into the TEF1 site, wherein the Pichia pastoris is used to obtain antibiotic-free secretory high-copy-expression strains.