A method of enhancing the level of nicotine synthesis in tobacco
By simultaneously overexpressing NtODC1 and NtMYC2 in tobacco plants, constructing expression vectors, and transforming Agrobacterium, the problem of insufficient nicotine synthesis in tobacco in existing technologies was solved, achieving a multiple increase in nicotine content and a significant improvement in the effective components of biopesticides.
Patent Information
- Application Number
- CN202511373815.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-25
- Publication Date
- 2025-12-26
- Estimated Expiration
- 2045-09-25
AI Technical Summary
Existing technologies cannot effectively increase the level of nicotine synthesis in tobacco. The expression of transcription factors NtMYC2, NtMYB305 and NtERF189 can only increase the nicotine content in tobacco by about 40%, and cannot achieve a higher level of improvement.
By simultaneously overexpressing the arginine decarboxylase gene NtODC1 and the transcription factor gene NtMYC2 in tobacco plants, the corresponding expression vectors were constructed and transformed into Agrobacterium to obtain co-expression plants. The NtADC1 was used to enhance substrate supply and the NtMYC2 was used to activate the synthase group, thus overcoming the bottleneck of nicotine synthesis metabolic flux.
The nicotine content was increased several times, with a 210% increase after topping. The yield of effective components of biopesticides was increased by 3.1 times, with no growth inhibition and no significant difference in biomass.
Smart Images

Figure CN120843590B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant biotechnology, and in particular to a method for enhancing the level of tobacco nicotine synthesis. BACKGROUND
[0002] Nicotine (i.e. nicotiana) is the main alkaloid in tobacco, accounting for about 90%~95% of the total content of tobacco alkaloids, and is a key substance that determines the value of tobacco commodities and a key factor affecting tobacco quality and aroma. Nicotine has high insecticidal activity and can effectively alleviate Alzheimer's disease, and has great development value in the fields of biological pesticides and biological medicines. Studying the regulation technology of tobacco nicotine synthesis has important application value.
[0003] Nicotine molecules are composed of a pyrrolidine ring and a pyridine ring, and are synthesized in the roots of tobacco and transported to the aboveground part through the xylem. The pyrrolidine ring of nicotine is closely related to putrescine generated by the nitrogen metabolism pathway, and arginine and ornithine in the nitrogen metabolism pathway are respectively formed into putrescine under the catalysis of arginine decarboxylase (ADC) and ornithine decarboxylase (ODC). The process of synthesizing nicotine from putrescine also requires the participation of multiple biological enzymes such as N-methyltransferase (PMT), N-methylputrescine oxidase (MPO), quinolinic acid phosphoribosyltransferase (QPT), berberine bridge enzyme (BBL) and PIP family isoflavone reductase (A622). The synthesis of nicotine in tobacco and the gene expression of the above-mentioned nicotine synthesis enzymes are induced by the hormone jasmonic acid, and transcription factors such as NtMYC2, NtMYB305 and NtERF189 are involved in the process of jasmonic acid-mediated nicotine synthesis regulation. However, the expression of NtMYC2, NtMYB305 and NtERF189 transcription factors can only increase the nicotine content of tobacco by about 40%, and cannot achieve higher level improvement.
[0004] Therefore, it is necessary to provide a method for enhancing the level of tobacco nicotine synthesis. SUMMARY
[0005] In order to solve the above technical problems, the purpose of the present application is to provide a method for enhancing the level of tobacco nicotine synthesis, which effectively increases the nicotine content of tobacco. The present application first discovers and proposes a method for co-expressing arginine decarboxylase NtODC1 and transcription factor NtMYC2 to improve the level of tobacco nicotine synthesis. This method enhances the function of the putrescine upstream synthesis pathway by overexpressing NtADC1, and provides activation and regulation functions by overexpressing NtMYC2, thereby achieving a fold increase in the nicotine content of tobacco, and providing a new idea and method for cultivating high-nicotine tobacco.
[0006] To achieve the above purpose, the technical scheme adopted by the present application is as follows:
[0007] In a first aspect, the application provides a method for enhancing the synthesis level of tobacco nicotine, which simultaneously overexpresses an arginine decarboxylase gene NtADC1 and a transcription factor gene NtMYC2 in a tobacco plant; the nucleotide sequence of the NtADC1 gene is shown as SEQ ID NO: 13, and the nucleotide sequence of the NtMYC2 gene is shown as SEQ ID NO: 14.
[0008] Further, an expression vector of the NtADC1 gene and an expression vector of the NtMYC2 gene are constructed.
[0009] The expression vectors are respectively transformed into Agrobacterium, and a co-expression plant is obtained through hybridization.
[0010] Further, the preparation method of the expression vector of the NtADC1 gene comprises the following steps:
[0011] The NtADC1 gene is inserted into the NotI and AscI double enzyme digestion sites of pENTR-D-TOPO (purchased from Thermo Fisher, item number K240020) to obtain a pENTR-D-TOPO-NtADC1 vector,
[0012] Then, the pENTR-D-TOPO-NtADC1 vector is connected to a plant expression vector pMDC-attR-Flag (the nucleotide sequence of the vector is shown as SEQ ID NO. 16) through Gateway to obtain a pMDC-NtADC1-Flag vector. The pMDC-attR-Flag is a binary vector obtained by replacing the CaMV35S promoter of pMDC32-HPB (GenBank accession number FJ172534.1) with a 2x CaMV35S promoter and adding a Flag tag coding sequence at the end of the attR segment.
[0013] Further, the preparation method of the expression vector of the NtMYC2 gene comprises the following steps:
[0014] The NtMYC2 gene is inserted into the NotI and AscI double enzyme digestion sites of pENTR-D-TOPO to obtain a pENTR-D-TOPO-NtMYC2 vector,
[0015] The CDS fragment of the NtMYC2 gene is connected to the plant expression vector pBin19-attR-HA (the nucleotide sequence of the vector is shown as SEQ ID NO. 15) through Gateway respectively by the pENTR-D-TOPO-NtMYC2 vector, and the pBin19-NtMYC2-HA vector is obtained. Wherein, the pBin19-attR-HA is a binary vector obtained by replacing the YFP tag coding sequence of pBin19 35S attR-YFP (GenBank accession number AY995145.1) with the HA tag coding sequence.
[0016] In the second aspect of the present application, an expression vector combination is provided, comprising:
[0017] The pMDC-attR-Flag vector is connected with the gene construction shown in SEQ ID NO: 13
[0018] The pMDC-NtADC1-Flag vector,
[0019] The pBin19-attR-HA vector is connected with the gene construction shown in SEQ ID NO: 14
[0020] The pBin19-NtMYC2-HA vector.
[0021] In the third aspect of the present application, an engineering bacterium containing the expression vector combination is provided.
[0022] In the fourth aspect of the present application, a tobacco cultivation system is provided, comprising:
[0023] The expression cassette containing the NtADC1 gene shown in SEQ ID NO: 13;
[0024] The expression cassette containing the NtMYC2 gene shown in SEQ ID NO: 14;
[0025] The expression cassette is operably connected to a plant promoter.
[0026] Compared with the prior art, the present application has the following beneficial effects:
[0027] The present application breaks through the bottleneck of nicotine synthesis metabolic flow by double-gene synergistic regulation (NtADC1 strengthens substrate supply + NtMYC2 activates synthetase group), and realizes:
[0028] (1) The nicotine content is increased by 210% after topping;
[0029] (2) The output of the effective component of the biological pesticide is increased by 3.1 times;
[0030] (3) Stable inheritance and no growth inhibition No significant difference in height / biomass. BRIEF DESCRIPTION OF DRAWINGS
[0031] Figure 1 : Transgenic plant cultivation chart;
[0032] Figure 2 : qPCR identification analysis results of NtMYC2 overexpression transgenic lines (MYC2-OE2, MYC2-OE5, MYC2-OE7) and NtADC1 overexpression transgenic lines (ADC1-OE1, ADC1-OE3, ADC1-OE6);
[0033] Figure 3 : qPCR identification analysis results of NtMYC2 and NtADC1 overexpression hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3);
[0034] Figure 4 : Nicotine content in tobacco leaves before topping;
[0035] Figure 5 : Nicotine content in leaves after 2 weeks after topping. DETAILED DESCRIPTION
[0036] The technical solutions in the present application will be clearly and completely described below in combination with specific embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.
[0037] The terms and product sources involved in the present application are explained as follows:
[0038] NtODC1: Ornithine decarboxylase;
[0039] NtMYC2: Transcription factor;
[0040] NtADC1: Arginine decarboxylase.
[0041] Tobacco variety TN90: from commercially available varieties.
[0042] Example 1
[0043] 1. Extraction of total RNA
[0044] Tobacco variety TN90 was selected to be cultured in 1 / 2MS or MS liquid medium, and cultured in a greenhouse with a temperature of 23℃ and a light cycle of 14 h light / 10 h dark for 15-20 days, then 0.1-0.2 g of roots were weighed, ground thoroughly with liquid nitrogen, and total RNA was extracted using the plant RNA extraction reagent Trizol (purchased from Invitrogen company).
[0045] 2 Cloning of CDS fragments of NtMYC2 and NtADC1
[0046] Using the extracted total RNA as a template, the RNA sample was reverse transcribed to synthesize cDNA using a reverse transcription kit (TaKaRa PrimeScript™ II 1stStrand cDNA Synthesis Kit, model number: 6210B);
[0047] According to the CDS sequences of the transcription factors NtMYC2 and NtADC1, primers were designed,
[0048] The primer sequences are as follows:
[0049] NtMYC2-F: CAACTGTTTGTGCTGGGTTTATGGA (SEQ ID NO. 1);
[0050] NtMYC2-R: TAGCGTGTTTCAGCAACTCTGGATG (SEQ ID NO. 2);
[0051] NtADC1-F: ACAGAAGAAGAGATGCCGGCCCTAG (SEQ ID NO. 3);
[0052] NtADC1-R: CACTTCAAGCAGTGCAATAGGACCA (SEQ ID NO. 4);
[0053] Using NtMYC2-F / NtMYC2-R and NtADC1-F / NtADC1-R as primers, respectively, and using high-fidelity enzyme (Vazyme 2 × Phanta® Max Master Mix (Dye Plus), model number: P525-02), PCR amplification was performed on the cDNA template, and the PCR program was as follows: 94℃ pre-denaturation for 2-4 min; 94℃ denaturation for 30-40 s; 58℃ annealing for 30-40 s, 72℃ extension for 30-50 s, 33-35 cycles; 72℃ incubation for 5-10 min;
[0054] PCR reaction system and reaction conditions:
[0055] Table 1
[0056] Composition Manufacturer Volume 2 × Phanta® Max Master Mix Vazyme 25 μL Primer F Sangon 1 μL Primer R Sangon 1 μL cDNA 1 μL ddH2O 22 μL
[0057] The PCR products amplified in the above step were separated by 1%~1.5% agarose gel electrophoresis, and then gel cutting recovery was performed using a gel recovery kit (Vazyme FastPure Gel DNA Extraction Mini Kit, Model: DC301-01) to obtain the CDS fragments of NtMYC2 and NtADC1;
[0058] 2. Construction of overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag
[0059] The obtained CDS fragments of NtMYC2 and NtADC1 were respectively connected to the T vector pMD18-T. Positive single colonies were identified by colony PCR and sequencing. Then primers containing enzyme cutting sites were designed, and the primers were as follows:
[0060] NtMYC2-Etr5: AAACCGCGGATGACTGATTACAGCTTACCC (SEQ ID NO. 5);
[0061] NtMYC2-Etr3: GCGTGTTTCAGCAACTCTGG (SEQ ID NO. 6)
[0062] NtADC1-Etr5: AAACCGCGGATGCCGGCCCTAGGTTGTTG (SEQ ID NO. 7)
[0063] NtADC1-Etr3: AGCAGTGCAATAGGACCAAA (SEQ ID NO. 8)
[0064] The positive single colonies containing NtMYC2 and NtADC1 correctly connected to the pMD18-T vector were cultured and expanded, and plasmids were extracted (Vazyme FastPure Plasmid Mini Kit, Model: DC201-01). The plasmid was used as a template, and the above NtMYC2-Etr5 / NtMYC2-Etr3 and NtADC1-Etr5 / NtADC1-Etr3 were used as primers to perform PCR amplification using high-fidelity enzyme, and the PCR program was as follows: 94°C pre-denaturation for 2~4 min; 94°C denaturation for 30~40 s; 62°C annealing for 30~40 s, 72°C extension for 30~50 s, 33~35 cycles; 72°C incubation for 5~10 min;
[0065] PCR reaction system and reaction conditions:
[0066] Table 2
[0067] Composition Manufacturer Volume 2 × Phanta® Max Master Mix Vazyme 25 μL Primer Etr5 Sangon 1 μL Primer Etr3 Sangon 1 μL Plasmid Self-owned 1 μL ddH2O 22 μL
[0068] The PCR product amplified in the above step was separated by 1%-1.5% agarose gel electrophoresis, and then gel recovery was performed using a gel recovery kit (Vazyme FastPure Gel DNA Extraction Mini Kit, model: DC301-01) to obtain a gene fragment of the transcription factor containing a restriction site. Then, the gene fragment and the entry vector pENTR-D-TOPO (purchased from Thermo Fisher, item number K240020) were subjected to NotI and AscI double enzyme digestion, respectively, and then the gene fragment was connected into the pENTR-D-TOPO vector.
[0069] Then, the CDS fragments of NtMYC2 and NtADC1 genes were connected to plant expression vectors pBin19-attR-HA (the nucleotide sequence of the vector is shown as SEQ ID NO. 15) and pMDC-attR-Flag (the nucleotide sequence of the vector is shown as SEQ ID NO. 16), respectively, by Gateway vector system (purchased from Invitrogen Company) LR reaction, and then the LR reaction products were transformed into competent E. coli DH5a (Sangon), followed by colony PCR identification, and overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag plasmids were extracted for standby use (Vazyme FastPure Plasmid Mini Kit, model: DC201-01).
[0070] LR reaction system and reaction conditions:
[0071] Table 3
[0072] Composition Manufacturer Volume Gateway® Entry Vector pENTR-D-TOPO with target fragment Invitrogen 10-15 μL pBin19-attR-HA or pMDC-attR-Flag vector Self-owned 1-2 μL 1 × TE Buffer Sangon 2-3 μL LR Clonase™ Invitrogen 2 μL
[0073] Reaction conditions: 25-28°C
[0074] 3. Obtaining of tobacco transgenic plants
[0075] The E. coli plasmid of the overexpression vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag obtained above was transformed into Agrobacterium by heat shock method, and then infected into the leaves of tobacco by leaf disc method. The specific steps are as follows:
[0076] (1) Agrobacterium expressed by the transformation vectors pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were streaked on YEB solid medium containing kanamycin and rifampicin, respectively, and cultured at 28°C for 2-3 days. Single-clone Agrobacterium colonies were inoculated into 5-8 ml of YEB liquid medium containing kanamycin and rifampicin by pipetting, and then placed in a shaker at 28°C and 200 rpm for 2-3 days. The culture was then transferred to 50-80 ml of YEB liquid medium containing kanamycin and rifampicin and cultured overnight. The next day, the 50-80 ml of YEB liquid medium was centrifuged at 800 rpm for 10 min and resuspended in 40-50 ml of fresh YEB liquid medium for later use.
[0077] (2) Select leaves of TN90 tobacco variety that have grown for 60-80 days and cut them into pieces of about 1 cm. 2 Small leaflets were prepared and immersed in 40-50 ml of YEB liquid suspension for 5-7 min. Leaves infected with Agrobacterium tumefaciens pBin19-NtMYC2-HA were then transferred to MS solid medium containing kanamycin, cephalosporins, and 6-BA. Leaves infected with Agrobacterium tumefaciens pMDC-NtADC1-Flag were also transferred to MS solid medium containing kanamycin, cephalosporins, and 6-BA. The plants were cultured in a greenhouse at 23°C with a photoperiod of 14 h light / 10 h dark for 2-3 months. After the infected leaves produced regenerated seedlings, the seedlings were transferred to 1 / 2 MS solid medium containing only cephalosporins and cultured in the same greenhouse for another 1-2 months to obtain T0 generation transgenic tobacco plants overexpressing NtMYC2 and NtADC1. Figure 1 (As shown).
[0078] Example 2: Identification of transgenic plants
[0079] The transgenic tobacco plants overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were cultured in a greenhouse until flowering, then self-pollinated, and T1 generation seeds were harvested. Subsequently, the tobacco seeds overexpressing NtMYC2 and NtADC1 were sown on MS medium containing kanamycin and hygromycin, respectively, and cultured until resistant seedlings emerged for transgenic plant identification.
[0080] Following the same RNA extraction method described above, leaf RNA was extracted from wild-type tobacco TN90 and transgenic tobacco plants, and reverse transcribed into cDNA. qPCR primers were designed based on the CDS sequences of NtMYC2 and NtADC1.
[0081] Primer sequences are as follows:
[0082] qNtMYC2-F: TTAGCTGTTTCTTCTCCTGCTTAT (SEQ ID NO. 9);
[0083] qNtMYC2-R: AACAAACGATTGGGTCATGGAA (SEQ ID NO. 10);
[0084] qNtADC1-F: AATGGTGGTGGTGGTGGTGATG (SEQ ID NO. 11);
[0085] qNtADC1-R: GCTGTGTGGGCTATCGCTCTG (SEQ ID NO. 12).
[0086] qPCR amplification was performed using qPCR enzyme (Vazyme ChamQ Universal SYBR qPCR Master Mix, Model: Q711-02), and the qPCR program was as follows: 94°C~96°C pre-denaturation for 5~6 min; 94°C~96°C denaturation for 20~40 s, 58°C~60°C annealing for 30~40 s, 72°C extension for 30~50 s, 40~45 cycles.
[0087] qPCR reaction system and reaction conditions:
[0088] Table 4
[0089] Composition Manufacturer Volume 2 × ChamQ Universal SYBR qPCR Master Mix Vazyme 12.5 μL qNtMYC2-F Sangon 1 μL qNtMYC2-R Sangon 1 μL cDNA 1 μL ddH2O 9.5 μL
[0090] The qPCR identification analysis results of the NtMYC2 overexpression transgenic lines (MYC2-OE2, MYC2-OE5, MYC2-OE7) and the qPCR identification analysis results of the NtADC1 overexpression transgenic lines (ADC1-OE1, ADC1-OE3, ADC1-OE6) are shown in Table 4. Figure 2
[0091] Figure 2 The qPCR results of Table 4 show that the expression amount of NtMYC2 in the NtMYC2 overexpression transgenic lines MYC2-OE2, MYC2-OE5, MYC2-OE7 is higher than that of the control group (Control), and the expression amount of NtADC1 in the NtADC1 overexpression transgenic lines ADC1-OE1, ADC1-OE3, ADC1-OE6 is also higher than that of the control group (Control). The above results show that the three NtMYC2 overexpression transgenic lines and the three NtADC1 overexpression transgenic lines obtained according to the present embodiment are all positive plants.
[0092] Example 3, Hybridization of tobacco plants and identification
[0093] 1. Hybridization of tobacco plants overexpressing NtMYC2 and NtADC1
[0094] T0 generation transgenic tobacco plants overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were cross-pollinated at flowering stage to obtain F1 generation hybrid seeds.
[0095] 2. Identification of hybrid tobacco plants overexpressing NtMYC2 and NtADC1
[0096] Seeds of hybridization materials were sowed on MS medium containing kanamycin and hygromycin, and after resistant seedlings grew, transgenic positive plants were identified by the above-mentioned transgenic plant identification method.
[0097] The results of qPCR identification analysis of hybrid tobacco lines (Hyb-1, Hyb-2, Hyb-3) overexpressing NtMYC2 and NtADC1 are shown in Table 2. Figure 3 The qPCR results show that the expression amounts of NtMYC2 and NtADC1 in hybrid tobacco lines Hyb-1, Hyb-2, and Hyb-3 are higher than those in the control group (Control). The above results show that the three hybrid tobacco lines obtained according to the present embodiment are all positive lines.
[0098] Example 4, Nicotine content of tobacco plants
[0099] 1. Culture of tobacco plants and sample collection
[0100] Using the above-mentioned method, F1 generation hybrid seeds overexpressing pBin19-NtMYC2-HA and pMDC-NtADC1-Flag were sowed on MS medium containing kanamycin and hygromycin, tobacco seeds overexpressing NtMYC2 were sowed on MS medium containing kanamycin, and tobacco seeds overexpressing NtADC1 were sowed on MS medium containing hygromycin, and after resistant seedlings grew, they were transplanted into flowerpots and cultured in a greenhouse. At the same time, wild-type tobacco was sowed on MS medium without antibiotics, and after the seeds germinated, they were transplanted into flowerpots and cultured in a greenhouse.
[0101] The tobacco plants were cultured to flowering, and the middle leaf materials before topping were collected, respectively; then the plants were topped, and the middle leaf materials after topping were collected 2 weeks later; and the collected leaf materials were used for nicotine content determination.
[0102] 2. Nicotine content determination of tobacco plants
[0103] The nicotine contents in the leaves of F1 generation tobacco plants and the control group before topping and 2 weeks after topping were determined by gas chromatography method. The determination results are shown in Table 3.Figure 4 and Figure 5 as shown.
[0104] Figure 4 The results show that the nicotine content of the leaf of the F1 hybrid tobacco strain (Hyb-1, Hyb-2, Hyb-3) before topping is about 190% higher than that of the control group, while the nicotine content of the leaf of the NtMYC2 overexpression tobacco strain is about 40% higher than that of the control group, and the nicotine content of the leaf of the NtADC1 overexpression tobacco strain is about 15% higher than that of the control group.
[0105] Figure 5 The results show that the nicotine content of the leaf of the F1 hybrid tobacco strain (Hyb-1, Hyb-2, Hyb-3) after topping is about 210% higher than that of the control group, while the nicotine content of the leaf of the NtMYC2 overexpression tobacco strain is about 35% higher than that of the control group, and the nicotine content of the leaf of the NtADC1 overexpression tobacco strain is about 5% higher than that of the control group.
[0106] In order to more intuitively prove the synergistic effect, the list is shown as follows:
[0107] Table 5
[0108] Group Nicotine before topping (mg / g) Nicotine after topping (mg / g) Wild type 10.3±0.8 22.1±1.2 Double gene co-expression 23.6±2.3** 36.8±3.1**
[0109] **p<0.01 vs wild type;
[0110] The above results show that the co-expression of tobacco NtMYC2 and NtADC1 can increase the nicotine content of the leaf of tobacco by about 2 times, which is significantly higher than the increase of the nicotine content of the leaf of the NtMYC2 or NtADC1 single gene overexpression.
[0111] Although the preferred embodiments of the present application have been described, those skilled in the art can make further changes and modifications to these embodiments once they know the basic inventive concept. Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application belong to the scope of equivalent technologies of the present application, the present application also intends to include these modifications and variations.
Claims
1. A method of enhancing the level of nicotine synthesis in tobacco, characterized in that, The method comprises simultaneously overexpressing an arginine decarboxylase gene NtADC1 and a transcription factor gene NtMYC2 in a tobacco plant; the nucleotide sequence of the NtADC1 gene is shown as SEQ ID NO: 13, and the nucleotide sequence of the NtMYC2 gene is shown as SEQ ID NO:
14.
2. The method of claim 1, wherein, The method specifically comprises: constructing an expression vector of the NtADC1 gene and an expression vector of the NtMYC2 gene; transforming the expression vectors into Agrobacterium, respectively, and obtaining a co-expression plant through hybridization; The preparation method of the expression vector of the NtADC1 gene comprises: inserting the NtADC1 gene into NotI and AscI double enzyme digestion sites of pENTR-D-TOPO to obtain a pENTR-D-TOPO-NtADC1 vector, then connecting the CDS fragment of the NtADC1 gene to the plant expression carrier pMDC-attR-Flag through Gateway to obtain a pMDC-NtADC1-Flag vector; The preparation method of the expression vector of the NtMYC2 gene comprises: inserting the NtMYC2 gene into NotI and AscI double enzyme digestion sites of pENTR-D-TOPO to obtain a pENTR-D-TOPO-NtMYC2 vector; then connecting the CDS fragment of the NtMYC2 gene to the plant expression carrier pBin19-attR-HA through Gateway to obtain a pBin19-NtMYC2-HA vector.
3. An expression vector combination, characterized by, comprises: a pMDC-NtADC1-Flag vector constructed by connecting the gene shown as SEQ ID NO: 13 to the pMDC-attR-Flag carrier, and a pBin19-NtMYC2-HA vector constructed by connecting the gene shown as SEQ ID NO: 14 to the pBin19-attR-HA carrier.
4. An engineering bacterium containing the expression vector combination of claim 3. comprises: an expression cassette containing the NtADC1 gene shown as SEQ ID NO: 13; 5. A tobacco growing system, characterised in that, an expression cassette containing the NtMYC2 gene shown as SEQ ID NO: 14; The expression cassette is operably connected to a plant promoter.
Citation Information
Patent Citations
Tobacco transcription factor NtMYB305 and application thereof in regulation and control of tobacco nicotine biosynthesis
CN113151298A
Transcription factor NtERF221 and methods of use thereof
CN114501987A
Reduced-exposure tobacco products
CN1838878A