Method for constructing tRNA high-throughput sequencing library

Abstract

The invention discloses a method for constructing a tRNA library, and particularly relates to a method for efficiently constructing a full-length tRNA high-throughput sequencing library. The method comprises the steps of: a) providing a sample comprising small RNA; b) deacylating the sample in the step a); c) performing 3'dephosphorization treatment on the deacylation product obtained in the step b) to convert 3 'phosphoric acid and 3' cyclophosphate of RNA into 3 'hydroxyl; d) connecting the dephosphorized product obtained in the step c) with excessive 3'joints to obtain a primary connection product; e) carrying out reverse transcription on the primary connection product by using TGIRT as reverse transcriptase to obtain a reverse transcription product containing cDNA; f) connecting the reverse transcription product with a 5'joint to obtain a secondary connection product; and g) carrying out PCR (Polymerase Chain Reaction) amplification on the secondary connection product to obtain the library containing the full-length tRNA. Through the method, the tRNA library which is high in full-length tRNA proportion and suitable for high-throughput sequencing can be obtained. The invention also relates to a full-length tRNA high-throughput sequencing method which comprises the following steps: constructing the tRNA library by using the method, and then sequencing the constructed tRNA library.

Description

Technical Field

[0001] This invention belongs to the fields of molecular biology and biotechnology, and relates to a method for constructing tRNA libraries, specifically a method for efficiently constructing full-length tRNA high-throughput sequencing libraries that can achieve a full-length tRNA ratio of up to about 90%. Background Technology

[0002] Transfer RNA (tRNA) is a class of small, non-coding RNA molecules, approximately 76-90 nucleotides (nt) in length, widely distributed in organisms and responsible for amino acid transport during peptide chain synthesis. tRNA accounts for about 4%-15% of total cellular RNA and plays a crucial role in protein translation and decoding, primarily translating codons on messenger RNA (mRNA) into proteins. Abnormal tRNA metabolism can lead to various human diseases, including muscle and nervous system disorders, cancer, immunodeficiency, lung and liver diseases, and diabetes. However, the lack of accurate, high-resolution tRNA sequencing and quantification methods has resulted in a lack of full understanding of tRNA level regulation and its physiological significance. Therefore, it is necessary to establish efficient full-length tRNA sequencing technologies and apply them to analyze cell- and tissue-specific tRNA composition to advance innovative research on traditional scientific questions and elucidate the composition, tissue-specificity, and functions and mechanisms of tRNA in various diseases.

[0003] With the rapid development of high-throughput sequencing technology, transcriptome sequencing has been widely applied. Transcriptome sequencing usually refers to mRNA-Seq, which detects the expression levels of mRNAs that produce proteins at the whole genome level. Full-length tRNA molecules have very stable secondary structures and high levels of nucleotide modifications, which seriously affect the full-length extension activity of reverse transcriptase and the alignment analysis of nucleic acid sequences during high-throughput sequencing library construction (for example, typical reverse transcriptases stop when encountering modifications on tRNA, making it difficult to obtain full-length tRNA sequences). Therefore, the progress of tRNA sequencing technology has been very slow.

[0004] Current methods for constructing tRNA libraries suffer from various problems: some methods, such as quantitative mature tRNA sequencing (QuantM-tRNAseq), fail to overcome reverse transcription barriers, resulting in most sequences in the final library being short due to reverse transcription stopping at modification sites; hybridization-based methods avoid the need for cDNA synthesis, but can only distinguish tRNAs differing by at least 8 nucleotides. Since tRNA transcripts have very high sequence similarity, even when reading different codons, they may differ by only one nucleotide, making hybridization-based methods unsuitable for tRNA quantification. Strategies to overcome structure- and modification-induced reverse transcription arrest include tRNA fragmentation; the use of thermostable reverse transcriptases with continuous synthesis capabilities and high fidelity, such as TGIRT-seq and DM-tRNAseq; and the use of demethylases like AlkB to remove partial methylation modifications on tRNA (ARM-seq and DM-tRNAseq). While these methods have improved tRNA sequencing, they still have some limitations: the TGIRT method typically requires the use of cyclases, which can easily lead to intramolecular cyclization of reverse transcription primers, resulting in a large number of adapter self-ligated fragments in the library, and are also expensive; the problem with using the demethylase AlkB is that AlkB treatment has selectivity and damage to tRNA. Furthermore, all these methods only alleviate a small portion of reverse transcription arrest, and can only restore tRNA types with specific methylation modifications, or those tRNA types that are more sensitive to in vitro treatment with demethylases, while having no effect on other modified tRNA types. Summary of the Invention

[0005] The problem to be solved by the present invention

[0006] This invention aims to provide a novel method for constructing tRNA libraries that can efficiently construct tRNA libraries with a high proportion of full-length tRNA, making these libraries suitable for high-throughput sequencing. Preferably, this method does not use the demethylase AlkB and / or cyclase, thus solving, mitigating, or avoiding related problems such as tRNA damage, adapter self-ligation, and / or high cost.

[0007] Problem-solving methods

[0008] In a first aspect, the present invention provides a method for constructing a full-length tRNA library, particularly a full-length tRNA high-throughput sequencing library, the method comprising, substantially comprising, or comprising the following steps:

[0009] a) Provide a sample containing small RNA;

[0010] b) Deacylate the sample from step a);

[0011] c) The deacylated product obtained in step b) is subjected to 3′ dephosphorylation to convert the 3′ phosphate and 3′ cyclic phosphate of RNA into 3′ hydroxyl groups;

[0012] d) Connect the dephosphorization product obtained in step c) with an excess of 3′ connector to obtain a primary connection product;

[0013] e) Use TGIRT as a reverse transcriptase to reverse transcribe the primary ligation product to obtain a reverse transcriptase containing cDNA.

[0014] f) The reverse transcription product was ligated to the 5′ linker to obtain a secondary ligation product; and

[0015] g) Perform PCR amplification on the secondary ligation product to obtain a library containing full-length tRNA.

[0016] The small RNA-containing sample provided in step a) can be obtained by extracting total RNA from a biological sample and then isolating small RNA from the total RNA extract. The isolation of small RNA from the total RNA extract can be achieved using purification methods known in the art, as long as the desired small RNA can be isolated from the total RNA. Preferably, one or more of Urea-PAGE gels, glass fiber filters, and silica gel centrifuge columns, or combinations thereof, can be used for the above purification and separation. For example, the MEGA Clear kit (catalog number AM1908) purchased from Thermo can be used for the above purification and separation. Preferably, the isolated small RNA is less than 100 nt in length. Enriching small RNA, especially small RNA less than 100 nt, in the above manner can effectively remove rRNA contamination and enrich tRNA, providing a relatively pure tRNA input source for subsequent full-length tRNA library construction.

[0017] In step b), deacylation can be performed using Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride). For example, approximately 100 mM Tris-HCl (pH 9.0) can be used for deacylation.

[0018] The 3′ dephosphorylation process in step c) can be performed using reagents capable of dephosphorylating deacylated tRNA. For example, dephosphorylation can be performed using T4 polynucleotide kinase (T4 PNK) without the addition of ATP, or dephosphorylation can be performed using alkaline phosphatase.

[0019] The ligation reaction in step d) can be performed using RNA ligases known in the art. Preferably, T4 RNA ligase 2 is used, such as T4 RNA ligase 2 (truncated KQ) or T4 RNA ligase 2 (truncated K227Q) purchased from NEB. In some embodiments, to improve ligation efficiency and reduce bias, an excess of 3′ adapter relative to the dephosphated product is added, for example, 2-10 times the excess of 3′ adapter relative to the dephosphated product, such as at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 times the excess of 3′ adapter. In some embodiments, after the ligation reaction in step d), the adenylation on the adapter is removed with a deacylase (e.g., deacylase M0331S purchased from NEB), and then the excess 3′ adapter is removed to reduce or avoid adapter self-ligation. It is preferable to use 5′-3′ DNA exonuclease RecJf (e.g., 5′-3′ DNA exonuclease RecJf purchased from NEB, catalog number M0264L) to remove excess adapters.

[0020] The reverse transcription in step e) can be performed using a thermostable group II intron reverse transcriptase, namely a TGIRT enzyme (e.g., TGIRT from InGex). TM -III) is performed. This reverse transcription is preferably performed at low temperatures, where low temperatures herein mean temperatures not exceeding 60°C, for example, in the ranges of 30-50°C, 35-45°C, 37-42°C, such as about 37°C, about 42°C, or about 50°C. Furthermore, the reverse transcription in step e) is preferably performed in a reaction buffer system with a low KCl salt concentration. Specifically, the reverse transcription in step e) can be performed in a reaction system containing 10-60 mM Tris-HCl (pH approximately 7.5-8.5), 25-100 mM KCl, and 2-4 mM MgCl2; more preferably, the reverse transcription can be performed in a reaction system containing about 50 mM Tris-HCl (pH approximately 8.3), 25-100 mM KCl, and about 3 mM MgCl2. Even more preferably, the reverse transcription can be performed in a reaction system containing about 50 mM Tris-HCl (pH = 8.3), about 75 mM KCl, and about 3 mM MgCl2.

[0021] The reverse transcription in step e) can be carried out for an appropriate time to obtain sufficient cDNA product. For example, reverse transcription can be carried out for at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 hours, etc. Preferably, after reverse transcription is completed, excess reverse transcription primers are digested first, and then RNA is degraded to release the reverse-transcribed cDNA. Preferably, the excess reverse transcription primers are digested using the 3′–5′ single-stranded DNA exonuclease Exo I. Preferably, RNA is degraded by alkaline hydrolysis at high temperature.

[0022] The ligation reaction in step f) can be performed using RNA ligases known in the art. Preferably, T4 RNA ligase 1 is used. More preferably, a high concentration of T4 RNA ligase 1 (e.g., NEB, catalog number M0437MT4 RNA ligase 1; 30 units / μL) is used for the ligation reaction, and even more preferably, overnight ligation is performed.

[0023] The PCR amplification in step g) can be performed using conditions and equipment deemed appropriate by those skilled in the art, as long as a library containing full-length tRNA can be obtained through this step.

[0024] In some embodiments, after one or more steps b)-g) above, the resulting product is purified or precipitated with ethanol. Specifically, in one embodiment, the product is purified after deacylation in step b), preferably using an RNA Clean & Concentrator-5 kit (Zymo, R1016 or R1015) to replace the reaction buffer. This purification step can also be replaced by ethanol precipitation, but ethanol precipitation takes longer than purification with the RNA Clean & Concentrator-5 kit. In one embodiment, the product is purified after 3′ dephosphorylation in step c), preferably using an RNA Clean & Concentrator-5 kit to replace the reaction buffer and remove proteins / enzymes. This purification step can be replaced by ethanol precipitation, but ethanol precipitation takes longer than purification with the RNA Clean & Concentrator-5 kit. In one embodiment, the ligation product is purified after 3′ adapter ligation in step d), preferably using an RNA Clean & Concentrator-5 kit to replace the reaction buffer and remove proteins / enzymes. This purification step can be replaced by ethanol precipitation, but ethanol precipitation takes longer than purification using the RNAClean & Concentrator-5 kit. In one embodiment, the reverse transcription product is purified after the reverse transcription in step e), preferably using magnetic beads, and more preferably using MyONE Silane magnetic beads. In one embodiment, the secondary ligation product is purified after the 5′ adapter ligation in step f), preferably using magnetic beads, and more preferably using MyONE Silane magnetic beads. In one embodiment, the amplification product is purified and recovered after the PCR amplification in step g), preferably using magnetic beads, such as AMPure XP magnetic beads; this recovery can be performed by agarose gel electrophoresis or polyacrylamide gel electrophoresis (PAGE), preferably by polyacrylamide gel electrophoresis, such as TBE-PAGE. Preferably, the amplification product is purified and recovered to isolate a library containing tRNAs of 180-220 bp in length.

[0025] Preferably, the method for constructing the tRNA library described above does not use the demethylase AlkB and / or cyclase, or does not include demethylation and / or cyclization steps. More preferably, the method for constructing the tRNA library described above does not use the demethylase AlkB and cyclase, or does not include demethylation and cyclization steps.

[0026] Preferably, the 5′ and 3′ adapters used in the above method for constructing tRNA libraries contain protecting groups to prevent adapter molecules from linking to each other.

[0027] In one specific embodiment, the 3′ adapter sequence used in the above method for constructing the tRNA library is 5′rAPP-GATCGGAAGAGCGTCGTG-3′SpC3 (SEQ ID NO:1).

[0028] In one specific embodiment, the 5′ adapter sequence used in the above method for constructing the tRNA library is 5′Phos-NNNNNNNNNNAGATCGGAAGAGCACACGTCTG-3′SpC3 (SEQ ID NO:2).

[0029] In a second aspect, the present invention provides a method for tRNA sequencing, wherein a tRNA library is constructed according to the method of the first aspect described above, and then the constructed tRNA library is sequenced. Sequencing can be performed using sequencing technologies, methods, or platforms known in the art, for example, using... The system performs sequencing.

[0030] Effects of the present invention

[0031] The method of the present invention has one or more of the following advantages:

[0032] First, by not using AlkB to treat substrates containing nucleic acids, the selectivity and damage that AlkB treatment causes to tRNA are avoided, thus ensuring the integrity of tRNA.

[0033] Second, by using TGIRT, a thermostable reverse transcriptase with continuous synthesis capability and high fidelity, the reverse transcriptase is prevented from stopping at the modification site, allowing it to cross the modification site and thus obtain full-length tRNA.

[0034] Third, a linear library construction method was adopted, in which adapters were added to both ends of the RNA, avoiding the use of cyclase, effectively preventing adapter self-ligation, and reducing costs. At the same time, by designing protective groups at the 5′ and 3′ ends of the adapter, adding an excess of the first adapter and removing the excess adapter after the ligation reaction, digesting excess / remaining reverse transcription primers after reverse transcription, and using magnetic beads for purification after the second adapter ligation, adapter self-ligation was reduced and ligation efficiency was improved, thereby ensuring the construction of a high-quality library for subsequent high-throughput sequencing.

[0035] Fourth, according to the method of the present invention, a library containing a high proportion (e.g., higher than about 80%, higher than about 85%, higher than about 87%, or higher than about 90%, or even up to 93%) of full-length tRNA can be obtained. Furthermore, even if mismatches occur at modification sites during reverse transcription, since the sites with the most mismatches are precisely the modified sites, the tRNA library constructed using the present invention can not only obtain full-length tRNA but also information on the modification sites on the tRNA. This is particularly important for most species that have not yet conducted tRNA modification research. In addition, the vast majority of full-length tRNA can be obtained without deviation. Attached Figure Description

[0036] Figure 1 A flowchart illustrating a library construction method according to an embodiment of this application;

[0037] Figure 2 This shows the proportions of various types of RNA in the tRNA library constructed in the embodiments of this application;

[0038] Figure 3 This shows the proportions of tRNAs or tRFs (tRNA fragments) of various lengths in the tRNA library constructed in the embodiments of this application;

[0039] Figure 4 This shows the proportion of tRNA lengths in the tRNA library constructed in the embodiments of this application. Detailed Implementation

[0040] definition

[0041] Unless otherwise specified, the terms used herein should be understood to have their general meanings in the relevant fields. Several terms used herein and their meanings are listed below.

[0042] As used herein, the term "sequencing" generally refers to the methods and techniques used to determine the nucleotide base sequence of one or more polynucleotides. Polynucleotides can comprise nucleic acid molecules, such as deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), including variants or derivatives thereof (e.g., single-stranded DNA). Sequencing can be performed using a variety of systems currently in use, including but not limited to… Pacific Biosciences MGI, Complete Genomics, Oxford Or Life Technologies (Ion) The sequencing system described herein may be used. Alternatively or additionally, nucleic acid amplification, polymerase chain reaction (PCR) (e.g., digital PCR, quantitative PCR, or real-time PCR), or isothermal amplification may be used. Such systems can provide multiple raw genetic data corresponding to the genetic information of a subject (e.g., animal, plant, microorganism, etc.), generated from a sample provided by the subject by the system. In some instances, such systems provide sequencing reads (also referred to herein as “reads”). A read may include a string of nucleic acid bases corresponding to a sequenced nucleic acid molecule sequence. Sequencing may include short-read sequencing or long-read sequencing, or both. In some cases, the systems and methods described herein can be used in conjunction with proteomics information.

[0043] As used in this article, the term "small RNA" refers to RNA molecules that are less than 200 nucleotides in length. These mainly include non-coding RNAs such as microRNA (miRNA), small interfering RNA (siRNA), and transfer RNA (tRNA).

[0044] As used in this article, the term "high-throughput sequencing" generally refers to a technique that sequentially determines the sequence of multiple nucleic acid molecules (DNA or RNA) at once, ranging from hundreds of thousands to millions. It can also be called next-generation sequencing (NGS). Compared to Sanger sequencing (or first-generation sequencing), high-throughput sequencing allows sequencing to be performed on a much larger scale.

[0045] As used in this article, the term "library" refers to a collection of nucleic acid fragments.

[0046] As used herein, the term "sample" generally refers to a biological sample from a subject containing a substance of interest (such as tRNA), where the subject can be an animal, such as a mammal (e.g., human) or bird (e.g., bird), or other organism; a plant (e.g., rice, corn, soybean); or a microorganism (e.g., bacteria, fungi, archaea, virus). Biological samples can contain many macromolecules, such as cellular macromolecules. Samples can be cell samples. Samples can be cell lines or cell cultures. Samples can include one or more types of cells. Samples can include one or more microorganisms. Biological samples can be nucleic acid samples or protein samples. Samples can be cell-free samples. Cell-free samples can include extracellular polynucleotides. Samples may be enriched prior to processing.

[0047] As used herein, the term "linker" and its derivatives generally refer to any linear oligonucleotide that can be attached to the nucleic acid molecules of this disclosure. In some embodiments, the linker is substantially non-complementary to the 3' or 5' end of any target sequence present in the sample. In some embodiments, suitable linker lengths are in the range of about 10-60 nucleotides, about 15-50 nucleotides, about 15-40 nucleotides, about 15-35 nucleotides, and about 20-30 nucleotides.

[0048] Unless specifically stated or clearly indicated from the context, the term "about" as used herein is understood to mean within the normal permissible range in the field, such as within two standard deviations of the mean. "About" can be understood as within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.1%, 0.05%, or 0.01% of the stated value. All numerical values ​​provided herein are modified by the term "about" unless otherwise clearly indicated from the context.

[0049] The ranges provided in this document should be understood as abbreviations of all values ​​within that range. For example, the range 1 to 50 should be understood as including any number, combination of numbers, or subrange of numbers selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50, and all decimal values ​​between the integers mentioned above (e.g., 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, and 1.9). Regarding subranges, consider specifically “nested subranges” that extend from any endpoint of the range. For example, nested subranges of the exemplary range 1-50 could include 1-10, 1-20, 1-30, and 1-40 in one direction, or 50-40, 50-30, 50-20, and 50-10 in another direction.

[0050] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.

[0051] Example

[0052] The methods of obtaining the various materials and reagents described in the following examples are merely to provide experimental methods for full disclosure and should not be construed as limiting the sources of the materials and reagents used in this invention. In fact, the sources and methods of obtaining the materials and reagents used are wide-ranging, and any materials (including biological materials) and reagents that can be obtained without violating laws and ethical standards can be substituted and used according to the concept of this invention. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores. Furthermore, the nucleotide or amino acid sequences involved in the examples can all be synthesized using known techniques.

[0053] The sequencing platform used in this embodiment is the Illumina sequencing platform. For this sequencing platform, the inventors designed and synthesized the following adapter and primer sequences:

[0054]

[0055] In the sequences shown in the table above, rAPP represents adenylate acylation; Phos represents phosphorylation modification; SpC3 represents 3′ spacer C3; N is any one of the four nucleotides A, T, G, and C, which are random nucleotides inserted during primer synthesis. The 5′ linker contains these 10 consecutive random nucleotides to remove PCR repetitive sequences during library amplification.

[0056] In the Index primers 1-3 in the table above, the underlined portion represents the six-base tag sequence "IIIIII", where I represents one of the four nucleotides A, T, G, and C. These tag sequences in the index primers are used to label different samples or libraries in multi-sample mixed libraries on a sequencing platform (i.e., different index primers are used for PCR amplification of different samples or libraries) to distinguish them subsequently. In other words, the tag sequence in each individual index primer is a defined six-base sequence, but the tag sequences in different index primers are different from each other for differentiation; apart from the tag sequence, the other sequences in the index primers are identical to each other. This embodiment exemplarily uses Index primers 1-3 shown in the table above for three different samples, but those skilled in the art will understand that other index primers, differing only in the tag sequence, can be constructed and synthesized according to actual conditions and needs.

[0057] Figure 1A flowchart illustrating a library construction method according to an embodiment of this application is provided below. For illustrative purposes and not for limitation, the process of constructing a full-length tRNA high-throughput sequencing library from rice spikelet samples and sequencing it using a sequencing platform, in order to identify the types and sites of protein-binding RNAs in plants, is described.

[0058] 1. Extract total RNA

[0059] 1) This example involves three different rice spikelet samples. 100 mg of each sample was placed in three different mortars and ground into a very fine powder. 1 mL of TRIzol (Thermo, 15596018) was added and mixed well.

[0060] 2) Centrifuge the mixture at 12000g for 10 minutes at 4℃, and discard the precipitate;

[0061] 3) Transfer the supernatant to a new centrifuge tube, add 200 μL of chloroform, shake for 15 seconds, and let stand for 5 minutes;

[0062] 4) Centrifuge the solution at 12000g for 10 minutes at 4℃ after standing, and carefully aspirate the upper aqueous phase;

[0063] 5) Add 1.5 times the volume of isopropanol, mix well, and let stand at -20℃ for 30 minutes;

[0064] 6) Centrifuge at 4℃, 12000g for 30 minutes, and discard the supernatant;

[0065] 7) Wash the precipitate with 70% ethanol, centrifuge at 12000g for 30 minutes at 4°C, carefully remove all supernatant, and dry at room temperature for 5 minutes;

[0066] 8) Add 300 μL of DEPC-H2O to resuspend the precipitate and mix thoroughly by pipetting.

[0067] 9) Add an equal volume of phenolform (150 μL water-saturated phenol and 150 μL chloroform), shake to mix for 15 seconds, and let stand for 3 minutes.

[0068] 10) Centrifuge at 12000g for 10 minutes at 4℃, carefully remove the upper aqueous phase, add 30μL of 3M sodium acetate (pH 5.2) and 3 times the volume of anhydrous ethanol, and mix well;

[0069] 11) Let stand at -20℃ for at least 30 minutes;

[0070] 12) Centrifuge at 12000g for 30 minutes at 4℃, then discard the supernatant;

[0071] 13) Wash the precipitate with 1 mL of 70% ethanol, centrifuge at 12000×g for 10 minutes at 4℃, carefully remove all supernatant, and dry at room temperature for 5 minutes;

[0072] 14) Add 30-50 μL of DEPC-H2O to resuspend the precipitate, mix well by pipetting, and then measure the RNA concentration using a Nanodrop or other spectrophotometer under A260 conditions. When A260 / A280 is close to 2, it indicates that the RNA purity is high. Use the total RNA extract obtained in this way for the next step.

[0073] 2. Isolation and purification of small RNAs

[0074] Small RNAs smaller than 100 nt were isolated and purified from the total RNA extract obtained in the previous step using the MEGA Clear kit (Thermo, AM1908). The maximum capacity of the kit column is 500 μg.

[0075] 1) Take 5-500 μg of total RNA (50 μg of total RNA in this example) and add it to elution buffer to 100 μL, then mix by pipetting.

[0076] 2) Add 350 μL of binding buffer and mix thoroughly by pipetting;

[0077] 3) Add 250 μL of anhydrous ethanol and mix thoroughly by blowing.

[0078] 4) Transfer the mixture into a filter tube and centrifuge at 12000g for 30 seconds;

[0079] 5) Retain flow-through (RNA in flow-through is less than 100nt, which can effectively remove most of the rRNA and mRNA), add 3μL glycogen (Thermo, R0551), 45μL 3M sodium acetate (pH 5.2), 900μL anhydrous ethanol, and let stand at -20 degrees for more than 1 hour.

[0080] 6) Centrifuge at 4 degrees Celsius and 13,000 rpm for at least 30 minutes, then discard the supernatant;

[0081] 7) Wash the precipitate with 1 mL of 75% ethanol, centrifuge at 13000 rpm for 10 minutes at 4 degrees Celsius, and discard the supernatant;

[0082] 8) Dry in room temperature air for 5 minutes;

[0083] 9) Resuspend in 50-100 μL of DEPC water and measure RNA concentration using Nanodrop or other spectrophotometers under A260 conditions;

[0084] 10) Take 200 ng of small RNA for subsequent tRNA library construction, and store the remaining small RNA in a -80 degree freezer for later use.

[0085] 3. Deacylation of purified small RNA

[0086] Since tRNA is treated with aminoacyl-tRNA synthetase to add amino acids, it is deacylated with Tris-HCl before library construction. Add the RNA obtained in the previous step and Tris-HCl (pH 9.0) according to the table below, mix well, and incubate at 37°C for 45 minutes.

[0087] Volume (μL) <![CDATA[RNA(200ng)+H2O]]> 18 1M Tris-HCl pH9.0 2

[0088] 4. Recovery of deacylated RNA

[0089] The deacylated product obtained in the previous step was recovered using the RNA Clean & Concentrator-5 kit (Zymo, R1016).

[0090] All centrifugations were performed at 10,000–16,000 g.

[0091] RNA washing buffer pretreatment: When using this kit for the first time, add 48 ml of anhydrous ethanol to the 12 ml washing buffer included in the kit.

[0092] 1) Add water to each of the three RNA samples to a final volume of 50 μL, then add 2 volumes (100 μL) of RNA binding buffer and mix well.

[0093] 2) Add 600 μL of anhydrous ethanol and mix well;

[0094] 3) Transfer to a collection tube, centrifuge for 30 seconds, and discard the stream;

[0095] 4) Add 400 μL RNA Prep Buffer, centrifuge for 30 seconds, and discard the flow-through;

[0096] 5) Add 700 μL of pretreated RNA washing buffer, centrifuge for 30 seconds, and discard the flow-through;

[0097] 6) Add 400 μL of pretreated RNA washing buffer, centrifuge for 2 minutes, and transfer the column to a new dorf tube;

[0098] 7) Add 11 μL of DEPC-treated water to the center of the column to dissolve the RNA, incubate at room temperature for 2 min, centrifuge for 30 seconds, and discard the column.

[0099] 5. T4-PNK dephosphorization treatment

[0100] The recovered product obtained in the previous step was subjected to dephosphorization treatment using T4-PNK (NEB, M0201L).

[0101] 1) Add the following reagents to 10 μL of RNA sample and mix well;

[0102] reagents Volume (μL) 10×PNK buffer 2 T4-PNK 1 RiboLock RNase Inhibitor (Thermo, EO0381) 1 <![CDATA[H2O]]> 6

[0103] 2) Incubate the mixed system at 37°C for 1 hour;

[0104] 3) Incubate at 65℃ for 20 minutes to perform PNK thermal inactivation.

[0105] 6. Recovery of dephosphated RNA

[0106] RNA was recovered from the product obtained in the previous step using the RNA Clean & Concentrator-5 kit (Zymo, R1016).

[0107] 1) Add water to each sample to a final volume of 50 μL, then add 2 times the volume (100 μL) of RNA binding buffer and mix well.

[0108] 2) Add 600 μL of anhydrous ethanol and mix well;

[0109] 3) Transfer to a collection tube, centrifuge for 30 seconds, and discard the stream;

[0110] 4) Add 400 μL RNA Prep Buffer, centrifuge for 30 seconds, and discard the flow-through;

[0111] 5) Add 700 μL RNA Wash Buffer, centrifuge for 30 seconds, and discard the flow-through;

[0112] 6) Add 400 μL RNA Wash Buffer, centrifuge for 2 minutes, and transfer the column to a new dorf tube;

[0113] 7) Add 7 μL of DEPC-treated water to the center of the column to dissolve the RNA, incubate at room temperature for 2 min, centrifuge for 30 seconds, and discard the column.

[0114] 7.3′ Connector Connection

[0115] 1) Add 2 μL of 20 μM 3′ adapter to the RNA sample obtained in the previous step and mix well;

[0116] 2) Denature at 82℃ for 2 minutes, then immediately place on ice;

[0117] 3) Prepare the 3′ adapter ligation mixture according to the table below. The reagents required in the table below are from T4 RNAligase 2, truncated KQ (NEB, M0373L).

[0118]

[0119]

[0120] 4) Add 12 μL of the above mixture to each RNA sample, pipette thoroughly, and incubate at 25°C for 3 hours;

[0121] 5) Deadenylate ligation of the linker: Add 1 μL of 5′ deadenylate enzyme (NEB, M0331S) to the ligation product, mix well by pipetting, and react at 30°C for 1 h;

[0122] 6) Degradation of unconnected 3′ linkers: Add 2 μL of RecJf exonuclease (NEB, MO264L) to the above reactants, mix well by pipetting, and react at 37°C for 1 h;

[0123] 7) Heat inactivation: Incubate at 70℃ for 20 minutes.

[0124] 8. Recover RNA with 3′ adapters

[0125] The ligation product obtained in the previous step was recovered using the RNA Clean & Concentrator-5 kit.

[0126] 1) Add water to each of the three RNA samples to a final volume of 50 μL, then add 2 volumes (100 μL) of RNA binding buffer and mix well.

[0127] 2) Add 600 μL of anhydrous ethanol and mix well;

[0128] 3) Transfer to a collection tube, centrifuge for 30 seconds, and discard the stream;

[0129] 4) Add 400 μL RNA Prep Buffer, centrifuge for 30 seconds, and discard the flow-through;

[0130] 5) Add 700 μL of RNA washing buffer, centrifuge for 30 seconds, and discard the flow-through;

[0131] 6) Add 400 μL of RNA washing buffer, centrifuge for 2 minutes, and transfer the column to a new dorf tube;

[0132] 7) Add 10 μL of DEPC-treated water to the center of the column to dissolve the RNA, incubate at room temperature for 2 min, centrifuge for 30 seconds, and discard the column.

[0133] 9. TGIRT-III reverse transcription

[0134] 1) Add 2 μL of 4 μM reverse transcription primer (RT primer) to 9 μL of RNA sample and mix well by pipetting;

[0135] 2) Denature at 82℃ for 2 minutes, then immediately place on ice;

[0136] 3) Prepare the reverse transcription mixture according to the table below:

[0137]

[0138]

[0139] 5× Low Salt Buffer: 250mM Tris-HCl pH 8.3, 375mM KCl, 15mM MgCl2;

[0140] 4) Add the mixture from step 3) to the RNA sample and reverse transcription primers from step 2), and mix well. Reverse transcribe at approximately 50 degrees Celsius for 16 hours;

[0141] 5) Reverse transcriptase inactivation: Incubate at 80℃ for 10 min;

[0142] 6) Remove excess reverse transcription primers: Add 1 μL of Exonuclease I (NEB, M0293S) to the reverse transcription product and digest at 37°C for 30 minutes;

[0143] 7) Terminate the reaction by adding 1 μL of 0.5M EDTA to the enzyme digestion reaction;

[0144] 8) Alkaline hydrolysis destroys RNA: Add 5 μL of 1M NaOH, mix well, and then take the pipette tip residue on pH test paper to test. The pH is about 11. Test at 95 degrees for 3 minutes, and then immediately place on ice.

[0145] 9) Add 4.5 μL of 1M HCl to neutralize, mix well, and then take a sample of the pipette tip residue on pH test paper for testing. The pH is approximately 8.

[0146] 10. MyONE Silane magnetic beads for cDNA purification

[0147] The MyONE Silane I used was purchased from Thermo, product number 37002D.

[0148] 1) Each of the three samples corresponds to a 1.5 mL low-adsorption dorf tube. Add 10 μL of MyONE Silane magnetic beads to a new low-adsorption dorf tube, separate them on a magnetic rack, and remove the supernatant.

[0149] 2) Wash the magnetic beads with 500 μL RLT buffer (QIAGEN, 79216), separate them on a magnetic rack, and discard the supernatant;

[0150] 3) Resuspend the magnetic beads in 94.5 μL of RLT buffer;

[0151] 4) Mix the magnetic beads thoroughly and add them to the reverse transcription product to be purified. Mix well by pipetting.

[0152] 5) Add 114 μL of anhydrous ethanol and mix thoroughly by suction and whisking;

[0153] 6) Let stand at room temperature for 5 minutes, mixing twice during this period;

[0154] 7) Separate on a magnetic rack and discard the supernatant;

[0155] 8) Wash the magnetic beads with 1 mL of 80% ethanol, transfer the magnetic beads to a new tube, separate them on a magnetic rack, and remove the supernatant;

[0156] 9) Wash the magnetic beads again with 1 mL of 80% ethanol, separate them on a magnetic rack, and remove the supernatant;

[0157] 10) Centrifuge at 800 rpm for 3 seconds, remove residual droplets, and air dry on a magnetic rack for 5 minutes;

[0158] 11) Resuspend the magnetic beads in 5 μL of 5 mM Tris-HCl (pH 7.5).

[0159] 11.5′ connector connection

[0160] 1) Add 1.3 μL of 100 μM 5′ connector and 1 μL of DMSO to the magnetic beads and mix thoroughly by suction and whisking;

[0161] 2) Denature at 82℃ for 2 minutes, then immediately place on ice;

[0162] 3) Prepare the 5′ adapter ligation mixture according to the table below; all reagents in the table are derived from RNALigase 1, Highconcentration (NEB, M0437M).

[0163]

[0164]

[0165] Mix well, add 12.7 μL of the above mixture to each sample, and slowly mix by blowing with a pipette;

[0166] 4) 25-degree heating block, 1300 rpm, 1 minute rotation every 10 minutes, 16 hours.

[0167] 12. MyONE Silane magnetic beads for cDNA purification

[0168] 1) Each of the three samples corresponds to a 1.5 mL low-adsorption dorf tube. Take 5 μL of MyONE Silane magnetic beads, separate them on a magnetic rack, and remove the supernatant.

[0169] 2) Wash the magnetic beads with 500 μL RLT buffer, separate them on a magnetic rack, and discard the supernatant;

[0170] 3) Resuspend the magnetic beads in 60 μL of RLT buffer;

[0171] 4) Mix the magnetic beads thoroughly and add them to the bonding product after connecting with the 5′ connector, then mix thoroughly by suction and beating.

[0172] 5) Add 60 μL of anhydrous ethanol and mix thoroughly by suction and whisking;

[0173] 6) Let stand at room temperature for 5 minutes, mixing twice during this period;

[0174] 7) Separate on a magnetic rack and discard the supernatant;

[0175] 8) Wash the magnetic beads with 1 mL of 80% ethanol: Transfer the magnetic beads to a new tube, separate them on a magnetic rack, and remove the supernatant;

[0176] 9) Wash the magnetic beads again with 1 mL of 80% ethanol, separate them on a magnetic rack, and remove the supernatant;

[0177] 10) Centrifuge at 800 rpm for 3 seconds, remove residual droplets, and air dry on a magnetic rack for 5 minutes;

[0178] 11) Resuspend the magnetic beads in 55 μL of 10 mM Tris-HCl (pH 7.5), heat on a 25°C heating block at 1300 rpm for 5 min, separate on a magnetic rack, and aspirate 50 μL into a new tube.

[0179] 13. PCR amplification library

[0180] 1) Prepare the PCR mixture according to the table below. The three libraries correspond to one of the Index primers 1-3.

[0181] reagents Volume (μL) Q5, High-Fidelity 2×PCR Master Mix (NEB, M0492S) 25 universal primers 1 Index primers 1 / 2 / 3 1 cDNA 15 <![CDATA[H2O]]> 8

[0182] 2) Set up the PCR instrument according to the procedure in the table below.

[0183]

[0184]

[0185] 14. Purify the PCR-amplified library using magnetic beads.

[0186] The amplification product obtained in step 13 was purified using AMPure XP magnetic beads (Beckman, A63881). Alternatively, Novizan DNA Clean Beads (N411-02) can be used for this step.

[0187] 1) Add 2x (i.e. 90μL) AMPure XP magnetic beads to the amplified PCR product, mix well, and let stand at room temperature for 5 minutes;

[0188] 2) Place on the magnetic rack and let it separate for 5 minutes;

[0189] 3) Carefully aspirate the supernatant, leaving a little liquid to prevent it from pulling away the magnetic beads;

[0190] 4) Wash the magnetic beads with 200 μL of 80% ethanol and discard the supernatant;

[0191] 5) Repeat the cleaning process once more, carefully removing all residual liquid;

[0192] 6) Dry on a magnetic rack at room temperature for 5 minutes;

[0193] 7) Remove the PCR tube from the magnetic rack, add 15 μL of water to resuspend the magnetic beads, and incubate at room temperature for 5 minutes;

[0194] 8) Separate on a magnetic rack, aspirate 14 μL of supernatant into a new PCR tube, and add 3 μL of 6x DNA loading buffer.

[0195] 15. TBE-PAGE gel library

[0196] 1) Purify PCR products using 6% TBE-PAGE gel.

[0197] Prepare 6% TBE-PAGE gel according to the table below. One 0.75mm thick mini gel sheet requires 5mL, and two sheets require 10mL. The table below shows the formula for 10mL, which is suitable for preparing two gel sheets.

[0198]

[0199] 2) 135V, electrophoresis for 50 minutes, then use SYBR. TM The gel was stained with Safe DNA gel dye (Thermo, S33102), and then the gel was recovered following the steps below.

[0200] 3) Use a blade to cut off the strip around 180-220bp and place it into a pre-prepared 600μL low adsorption EP tube (the bottom of the tube has been poked with 1-2 small holes by a 10mL syringe that has been burned with an alcohol lamp). Put the 600μL EP tube into the 2mL low adsorption EP tube and centrifuge at 12000rpm for 5 minutes to crush the strip.

[0201] 4) After centrifugation, discard the 600μL EP tube and add 300μL DNAgel extraction buffer (DNA gel extraction buffer: 300mM NaCl, 10mM Tris-HCl pH8.0, 1mM EDTA) to the 2mL EP tube containing PAGE gel fragments. Soak the gel at 55℃ for 1-2 hours.

[0202] 5) Transfer the crushed gel to a Filtration Column (CORNING, CLS8163), centrifuge at 12000 rpm for 2 min to collect the liquid, and discard the centrifuge column;

[0203] 6) Add 2 μL of glycogen (Thermo, R0561), 30 μL of 3M sodium acetate (pH 5.2) and 1 mL of anhydrous ethanol in sequence, mix well and precipitate at -80℃ for 1 hour to overnight;

[0204] 7) Take out the precipitate product at -80℃ and centrifuge it at 12000 rpm for 30 min in a refrigerated centrifuge pre-cooled to 4℃;

[0205] 8) Carefully remove the supernatant, being careful not to aspirate the white precipitate. Add 1 ml of freshly prepared 70% ethanol to the EP tube and centrifuge at 12000 rpm for 10 min in a refrigerated centrifuge pre-cooled to 4°C.

[0206] 9) Carefully remove the supernatant, being careful not to aspirate the white precipitate. Briefly centrifuge to collect any remaining liquid on the tube wall to the bottom of the tube, carefully remove the remaining liquid, and allow to air dry at room temperature for about 5 minutes with the cap open.

[0207] 10) Add 15 μL of Nuclease-free H2O to dissolve the precipitate.

[0208] 16. High-throughput sequencing

[0209] Sequencing was performed using the Nova-seq platform in PE150 mode, with each library containing 5GB of data. A total of three samples were used. Each sample underwent two biological replicates. High-throughput analysis showed that tRNA accounted for approximately 90% or more of all reads. Figure 2 Full-length tRNAs account for 87%-93% of all tRNA reads. Figure 3 and Figure 4 ).

[0210] The FINE-tRNA-seq library obtained according to the steps described above in this embodiment has the following sequence (where the hyphen "-" between A, B, C, the tag sequence, and D is added only for readability and does not represent any special structure or linkage between these sequences in the actual library):

[0211] ABC-hexabase tag sequence-D,

[0212] The sequence A is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO:8), B is the sequence of the negative strand of tRNA, C is NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC (SEQ ID NO:9), the six-base tag sequence is IIIIII (as defined above), and D is ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO:10).

[0213] The foregoing has exemplarily described a method for identifying the types and sites of RNA that bind to proteins in plants. While embodiments have been described with reference to specific exemplary models, it will be apparent that various modifications and variations can be made to these examples without departing from the broader scope of the inventive subject matter. Therefore, this specification and the accompanying drawings should be considered in an illustrative rather than restrictive sense.

Claims

1. A method for constructing a full-length tRNA library, the method comprising the following steps: a) Provide a sample containing small RNA; b) Deacylate the sample from step a); c) The deacylated product obtained in step b) is subjected to 3′ dephosphorylation to convert the 3′ phosphate and 3′ cyclic phosphate of RNA into 3′ hydroxyl groups; d) Connect the dephosphorization product obtained in step c) with an excess of 3′ connector to obtain a primary connection product; e) Use TGIRT as a reverse transcriptase to reverse transcribe the primary ligation product to obtain a reverse transcriptase containing cDNA. f) The reverse transcription product was ligated to the 5′ linker to obtain a secondary ligation product; and g) Perform PCR amplification on the secondary ligation product to obtain a library containing full-length tRNA.

2. The method according to claim 1, wherein the method does not use demethylase AlkB and / or cyclase, or does not include a demethylation step and / or a cyclization step; preferably, the method does not use demethylase AlkB and cyclase and does not include a demethylation step and a cyclization step.

3. The method according to claim 1, wherein the 3′ connector used in step d) and the 5′ connector used in step f) contain protective groups to prevent the connector molecules from connecting to each other.

4. The method according to any one of claims 1-3, wherein the obtained product is purified after one or more or all of steps b)-g), for example, after all of steps b)-g).

5. The method according to any one of claims 1-3, wherein in step d), an excess of 3′ connectors relative to the dephosphorization product is added, for example, an excess of 3′ connectors of 2-10 times relative to the dephosphorization product, for example, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times the excess of 3′ connectors.

6. The method according to any one of claims 1-3, wherein after the ligation reaction in step d), the adenylation on the 3′ adapter is removed with a deacylase, and excess 3′ adapter is removed with a 5′-3′ single-stranded DNA exonuclease.

7. The method according to any one of claims 1-3, wherein the reverse transcription in step e) is performed at a low temperature not higher than 60°C.

8. The method according to any one of claims 1-3, wherein the amplification product is purified and recovered after step g) to separate tRNA of length 180-220 bp.

9. A method for high-throughput sequencing of full-length tRNA, wherein the method comprises constructing a tRNA library according to the method of claim 1, and then sequencing the constructed tRNA library.

10. The method of claim 9, wherein the method uses The system performs sequencing.

Images