MTHFD2-loaded siRNA nano-composite and preparation method and application thereof

By loading siRNA onto a nanocomposite of PEI-modified iron hydroxy oxide nanoparticles and hyaluronic acid, the problem of low siRNA delivery efficiency was solved, achieving synergistic induction of ferroptosis in tumor cells and enhancing the killing effect on tumor cells.

CN120860237APending Publication Date: 2025-10-31SHANGHAI JIAOTONG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410529477.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-04-29
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

siRNA is easily degraded by RNases during delivery and has difficulty passing through cell membranes. Furthermore, existing nanocarriers cannot effectively promote ferroptosis when delivering siRNA, resulting in low delivery efficiency.

Method used

PEI-modified iron hydroxy oxide nanoparticles (PFeOOH) are combined with hyaluronic acid to load siRNA via electrostatic attraction, and then coated with a hyaluronic acid film to form a nanocomposite, thereby improving the delivery efficiency of siRNA and the accumulation of iron, and promoting ferroptosis.

Benefits of technology

It achieved efficient siRNA delivery and synergistic accumulation of iron, significantly enhanced ROS and lipid peroxidation in tumor cells, promoted ferroptosis, and improved the killing effect on tumor cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120860237A_ABST
    Figure CN120860237A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of drug delivery, and discloses an MTHFD2siRNA loaded nano-composite as well as a preparation method and application thereof. The nano-composite comprises siRNA and PFeOOH, the siRNA comprises MTHFD2siRNA-1 of a fragment 1 of a target MTHFD2, or MTHFD2siRNA-2 of a fragment 2 of the target MTHFD2, or MTHFD2siRNA-3 of a fragment 3 of the target MTHFD2, and the PFeOOH comprises the siRNA and the PFeOOH. Wherein the sequence of the fragment 1 of the MTHFD2 is as shown in SEQ ID No. 1, and the sequence of the fragment 2 of the MTHFD2 is as shown in SEQ ID No. 2; the sequence of a fragment 3 of the MTHFD2 is as shown in SEQ ID No. 3; the MTHFD2siRNA loaded nano compound provided by the invention can efficiently deliver siRNA, solves the problem of combined delivery of siRNA and an iron agent, and realizes synergistic induction of tumor cell ferroptosis by gene knock-down and iron accumulation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of drug delivery technology, specifically to a nanocomposite loaded with MTHFD2 siRNA, its preparation method, and its application. Background Technology

[0002] Ferroprelation in tumor cells is a hot topic in cancer treatment. In cancer therapy, ferroptosis inducers can be delivered via carriers, or iron can be delivered directly to increase iron accumulation in tumor cells. Methylenetetrahydrofolate dehydrogenase 2 (MTHFD2) is an important metabolic enzyme in the human body, upregulated in most tumors. Inhibition of MTHFD2 can significantly enhance intracellular ROS and lipid peroxidation, reduce intracellular GSH, and downregulate the expression of SLC7A11, GPX4, and NRF2, making it a potential target for ferroptosis therapy. Silencing the MTHFD2 gene with siRNA holds promise for promoting ferroptosis in tumor cells. However, in vivo delivery of siRNA faces many challenges, such as instability in serum, susceptibility to degradation by RNases, easy renal clearance leading to a short half-life in the blood, and large molecular weight and strong electronegativity, making it difficult to cross cell membranes. Protecting siRNA with nanocarriers and facilitating its entry into the cytoplasm is an important method for siRNA delivery. For the delivery of siRNA that promotes ferroptosis, the vector itself should ideally also have a ferroptosis-promoting effect, so as to work synergistically with MTHFD2 siRNA to better promote ferroptosis in tumor cells. This is the goal that this invention aims to achieve. Summary of the Invention

[0003] Therefore, the purpose of this invention is to provide a nanocomposite loaded with MTHFD2 siRNA, its preparation method, and its application. The MTHFD2 siRNA-loaded nanocomposite provided by this invention can efficiently deliver siRNA, solving the problem of combined siRNA and iron agent delivery, and achieving synergistic induction of tumor cell ferroptosis by gene knockdown and iron accumulation.

[0004] The objective of this invention is achieved through the following technical solution:

[0005] A nanocomposite carrying MTHFD2 siRNA, the nanocomposite comprising siRNA and PFeOOH, wherein the siRNA comprises MTHFD2 siRNA-1 targeting fragment 1 of MTHFD2, or MTHFD2 siRNA-2 targeting fragment 2 of MTHFD2, or MTHFD2 siRNA-3 targeting fragment 3 of MTHFD2; wherein the sequence of fragment 1 of MTHFD2 is shown in SEQ ID No. 1, the sequence of fragment 2 of MTHFD2 is shown in SEQ ID No. 2, and the sequence of fragment 3 of MTHFD2 is shown in SEQ ID No. 3.

[0006] The sequence of the MTHFD2 siRNA-1 is as follows:

[0007] Sense 5'-3': CGAAAUGAAGCCGUUGUCAUUTT, as shown in SEQ ID No. 4;

[0008] Antisense 5'-3':AAUGACAACGGCUUCAUUUCGTT, as shown in SEQ ID No. 5;

[0009] The sequence of the MTHFD2 siRNA-2 is as follows:

[0010] Sense 5'-3': CGGUCAUCGAUGUGGGAAUAATT, as shown in SEQ ID No. 6;

[0011] Antisense 5'-3': UUAUUCCCACAUCGAUGACCGTT, as shown in SEQ ID No. 7;

[0012] The sequence of the MTHFD2 siRNA-3 is as follows:

[0013] Sense 5'-3': GCUCAUGAAGAACACCAUUAUTT, as shown in SEQ ID No. 8;

[0014] Antisense 5'-3':AUAAUGGUGUUCUUCAUGAGCTT, as shown in SEQ ID No. 9.

[0015] Preferably, the sequence of the MTHFD2 siRNA is MTHFD2 siRNA-2, which is fragment 2 targeting MTHFD2.

[0016] The preparation method of PFeOOH includes the following steps:

[0017] S1. Under stirring, the polymer solution is added dropwise to the FeOOH solution to form a mixed solution, and the mixed solution is ultrasonically treated.

[0018] S2. After sonication, the system is centrifuged, the precipitate is collected, washed, and polymer-modified iron hydroxyl oxide nanoparticles PFeOOH are obtained.

[0019] In S1, the polymer is selected from at least one of PEI 25K, PEI 1800, and PEI 800.

[0020] Preferably, the polymer is polyethyleneimine PEI 25K.

[0021] Before addition, the concentration of the polymer solution is 0.1-0.2 mg / mL; the concentration of the FeOOH solution is 1-2 mg / mL.

[0022] In the mixed solution, the mass ratio of the polymer to FeOOH is 1:5 to 1:20.

[0023] The ultrasound conditions in S1 are: ultrasound for 3-5 minutes at 120-150W; the ultrasound is intermittent, with a 3-6 second pause after every 5-8 seconds of ultrasound.

[0024] The centrifugation conditions in S2 are: centrifuge at 12000-15000 rpm for 15-20 min.

[0025] The preparation method of FeOOH includes the following steps:

[0026] Step 1: Dissolve FeCl3·6H2O in ddH2O to form FeCl3 solution;

[0027] Step 2: Stir under heating conditions until the FeCl3 solution turns into a turbid orange-red color (after the reaction is complete, the solution becomes turbid, and the color changes from clear reddish-brown to turbid orange-red).

[0028] Step 3: Cool the product from Step 2, centrifuge, collect the precipitate, wash it, and obtain the FeOOH (iron hydroxy oxide nanoparticles).

[0029] In step 1, the ratio of FeCl3·6H2O to ddH2O is 0.005-0.025.

[0030] In step 2, the heating condition is 80-90℃ water bath heating.

[0031] In step 2, the stirring speed is 400-500 rpm and the stirring time is 2-3 hours.

[0032] In step 3, the cooling conditions are 20-25℃ and the cooling time is 20-30 minutes.

[0033] In step 3, the centrifugation conditions are: centrifuge at 12000-15000 rpm for 15-20 min.

[0034] The nanocomposite loaded with MTHFD2 siRNA was prepared by a method comprising the following steps:

[0035] (1) Prepare PFeOOH solution (using enzyme-free water, distilled water, deionized water, etc.);

[0036] (2) Prepare siRNA solution with enzyme-free water;

[0037] (3) Mix the PFeOOH solution and siRNA solution evenly and incubate for 20-30 min to obtain the PFeOOH / siRNA solution;

[0038] (4) PFeOOH / siRNA solution was added to hyaluronic acid solution under stirring to form a mixture; the mixture was stirred, centrifuged, the precipitate was collected, washed, and the product siRNA-loaded nanocomposite was obtained.

[0039] In step (3), PFeOOH solution needs to be added to the siRNA solution to ensure more uniform mixing of siRNA and PFeOOH, resulting in more complete siRNA loading. Adding the siRNA solution directly to the PFeOOH solution can lead to insufficient mixing and low siRNA loading efficiency.

[0040] In step (3), the mass ratio of PFeOOH to siRNA is 1-25:1;

[0041] In step (4), the concentration of the hyaluronic acid solution is 0.01-3 mg / mL;

[0042] In step (4), the ratio of the amount of hyaluronic acid solution to PFeOOH / siRNA is 1:0.4-1:100.

[0043] <Second aspect>

[0044] The application of the siRNA-loaded nanocomposite in the preparation of antitumor drugs is also within the scope of protection of this invention.

[0045] The tumors mentioned include breast cancer, lung cancer, liver cancer, esophageal cancer, rectal cancer, etc.

[0046] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0047] 1. PEI-modified iron hydroxyl oxide: PEI, as a carrier capable of efficiently delivering siRNA, significantly improves siRNA delivery efficiency when modified with PEI-modified iron hydroxyl oxide. However, using iron hydroxyl oxide alone results in lower siRNA delivery efficiency compared to PEI-modified iron hydroxyl oxide. This application ensures both efficient siRNA delivery and the delivery of iron, promoting ferroptosis.

[0048] 2. The detailed structure of this application is as follows: Iron hydroxyl oxide (IH₂O) and PEI are connected via ultrasound to form positively charged nanoparticles. Nucleic acid, being negatively charged, can be loaded onto PFeOOH using electrostatic attraction through rapid mixing and stirring, ensuring efficient nucleic acid loading. Hyaluronic acid modification is used, utilizing its adhesiveness to coat the nanoparticles with a thin hyaluronic acid film. Hyaluronic acid modification of the nanoparticles has the following advantages: First, it provides physical protection, tightly encapsulating the nucleic acid drug and iron agent together, preventing leakage of the nucleic acid drug during delivery. Second, it alters the charge of the nanoparticles, changing them from positive to negative. The positively charged nanoparticles loaded with nucleic acid are easily cleared during in vivo circulation, leading to the loss of the nucleic acid drug.

[0049] 3. In the prior art ("An iron oxyhydroxide-based nanosystem sensitizesferroptosis by a "Three-Pronged" strategy in breast cancer stem cells, ActaBiomaterialia, Volume

[0050] The main function of the gene delivered (160, 2023, Pages 281-296, ISSN 1742-7061) is to prevent iron efflux and promote iron accumulation. It only increases iron accumulation; the effect of siRNA delivery is solely in iron accumulation. In "Anovel polyethyleneimine-decorated FeOOH nanoparticle for efficient siRNA delivery, Chinese Chemical Letters, Volume 32, Issue 1, 2021, Pages 102-106, ISSN 1001-8417," the delivered gene can induce apoptosis. Ferrocyte death and apoptosis are two different modes of cell death; the MTHFD2 gene delivered in this invention affects the key factors of ferroptosis, namely ROS and LPO. Knocking out this gene promotes the production of ROS and LPO. The delivery of iron further promotes the production of ROS, thereby promoting ferroptosis.

[0051] 4. This application combines PEI with hyaluronic acid, which increases the dosage and protects the nanoparticles from being removed. Attached Figure Description

[0052] Other features, objects, and advantages of the present invention will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:

[0053] Figure 1 This is an agarose gel electrophoresis result of the verification of PFeOOH nucleic acid binding ability in Example 3;

[0054] Figure 2 The figure shows the cytotoxicity test results for tumor cell-specific toxicity evaluation in performance test example 2.

[0055] Figure 3 The results of the cytotoxicity test for evaluating the toxicity of the target siRNA to tumor cells in Example 3 of the performance test;

[0056] Figure 4 The ROS results for the blank control group in performance test example 4 are shown in the figure, with a magnification of 100x.

[0057] Figure 5 The graph shows the ROS results of the PFeOOH group in Example 2 of Performance Test Example 4, with a magnification of 100x.

[0058] Figure 6 The image shows the ROS results of PFeOOH / siRNA-6 (experimental group 6) in performance test example 4, with a magnification of 100x.

[0059] Figure 7 This is a graph showing the ROS results of PFeOOH / MTHFD2 siRNA-2 (experimental group 9) in performance test example 4, with a magnification of 100x.

[0060] Figure 8 This is a graph showing the ROS results of PFeOOH / MTHFD2 siRNA-2@HA (experimental group 18) in performance test example 4, with a magnification of 100x.

[0061] Figure 9 For the blank control group in performance test example 4, the PFeOOH group in example 2, and the experimental group 6 in example 3, PFeOOH / MTHFD2 siRNA-2 (experimental group 9) and PFeOOH / MTHFD2 siRNA-2@HA (experimental group 18) were semi-quantitatively analyzed by ROS fluorescence.

[0062] Figure 10 The result graph of the blank control group LPO in performance test example 4 is shown, with a magnification of 100x;

[0063] Figure 11 The graph shows the ROS results of the PFeOOH group in Example 2 of Performance Test Example 4, with a magnification of 100x.

[0064] Figure 12The image shows the lpo results of PFeOOH / siRNA-6 (experimental group 6) in performance test example 4, with a magnification of 100x.

[0065] Figure 13 The image shows the lpo results of PFeOOH / MTHFD2 siRNA-2 (experimental group 9) in performance test example 4, with a magnification of 100x.

[0066] Figure 14 The image shows the lpo results of PFeOOH / MTHFD2 siRNA-2@HA (experimental group 18) in performance test example 4, with a magnification of 100x.

[0067] Figure 15 The LPO fluorescence semi-quantitative analysis was performed on the blank control group in performance test example 4, the PFeOOH group in example 2, and the experimental group 6 in example 3, as well as PFeOOH / MTHFD2 siRNA-2 (experimental group 9) and PFeOOH / MTHFD2 siRNA-2@HA (experimental group 18). Detailed Implementation

[0068] The present invention will be described in detail below with reference to embodiments. These embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make several adjustments and improvements without departing from the concept of the present invention. These all fall within the protection scope of the present invention.

[0069] In the following embodiments and comparative examples:

[0070] Table 1

[0071]

[0072]

[0073] Example 1: Preparation of iron hydroxyoxide (FeOOH)

[0074] Step 1: First, dissolve 0.98g of FeCl3·6H2O in 72mL of ddH2O to form a homogeneous and stable solution. Heat in an 80℃ water bath and stir at 400rpm for two hours. After the reaction is complete, the solution becomes turbid, and its color changes from a clear reddish-brown to a turbid orange-red.

[0075] Step 2: Cool the product obtained from the reaction at 25°C for 30 min, centrifuge at 12000 rpm for 15 min, discard the supernatant, collect the precipitate, wash repeatedly with ddH2O to remove impurities, and obtain purified iron hydroxy oxide (FeOOH) nanoparticles.

[0076] Table 2. Particle size, PDI, and potential of FeOOH nanoparticles

[0077] FeOOH nanoparticle size (nm) PDI Zeta potential (mV) 102.4 0.164 +33.5

[0078] The PDI and potential testing methods are as follows:

[0079] Take 50 μL of FeOOH nanoparticles and dilute them 20-fold with 950 μL of enzyme-free water. Add 0.5 mL of each to the microparticle size and potential cells, respectively. Measure the hydrated particle size, zeta potential, and PDI using a Malvern Zetasizer particle size analyzer. Before testing, the particle size and potential cells were rinsed three times with enzyme-free water, the instrument was equilibrated at 25℃ for 120 s, and the detection program was set to automatic. Each sample was measured three times.

[0080] The results in Table 2 show that hydroxyl iron oxide nanoparticles were successfully prepared.

[0081] Example 2 uses polyethyleneimine to modify iron hydroxyl oxide (PFeOOH).

[0082] Step 1: Weigh 5g of polyethyleneimine 25K (PEI 25K) and prepare a 0.1mg / mL solution using ddH2O. Disperse the iron hydroxyl oxide (FeOOH) nanoparticles prepared in Example 1 in enzyme-free water to prepare a 1mg / mL solution.

[0083] Step 2: While stirring at 400 rpm, add 2 mL of PEI 25K solution dropwise to 40 mL of FeOOH solution. After mixing, sonicate the reaction system at 120 W for 3 min using an intermittent sonication method (sonicating for 5 seconds, then stopping for 6 seconds).

[0084] Step 3: Place the sonicated system into a centrifuge and centrifuge at 12000 rpm for 15 min. After centrifugation, discard the supernatant, collect the precipitate, wash it with ddH2O, and obtain polyethyleneimine-modified iron hydroxy oxide (PFeOOH) nanoparticles.

[0085] Table 3. Particle size, PDI, and potential of PFeOOH nanoparticles

[0086] PFeOOH particle size (nm) PDI Zeta potential (mV) 105.9 0.139 +35.4

[0087] The PDI and potential testing methods are the same as in Example 1.

[0088] The results in Table 3 show that polyethyleneimine was successfully modified onto iron hydroxyl oxide nanoparticles, resulting in uniform and stable nanoparticles.

[0089] Example 3: Preparation of PFeOOH / siRNA nanocomposite

[0090] (I) Preparation of PFeOOH / siRNA nanocomposite

[0091] 1. Weigh the polyethyleneimine-modified iron hydroxyl oxide nanoparticles (PFeOOH) synthesized in Example 2 into an enzyme-free centrifuge tube, and prepare a PFeOOH solution with enzyme-free water, wherein the concentration of FeOOH in PFeOOH is 1 mg / mL;

[0092] 2. Dissolve the siRNA powder in an enzyme-free aqueous solution to prepare a 300 ng / μL siRNA solution. In an enzyme-free EP tube, add 2 mL of enzyme-free water and 40 μL of siRNA to dilute and mix thoroughly.

[0093] The specific sequence of siRNA is as follows:

[0094] Sense: UUC UCC GAA CGU GUC ACG UTT (SEQ ID No. 10);

[0095] Antisense: ACG UGA CAC GUU CGG AGAATT (SEQ ID No. 11).

[0096] 3. Take PFeOOH solution and add it to the EP tube containing siRNA solution. Mix quickly so that the final mass ratio of PFeOOH to siRNA is WPFeOOH:WsiRNA = 1:1; 3:1; 5:1; 10:1; 15:1; 25:1. Immediately use a 1000mL pipette to repeatedly aspirate 50 times until completely mixed. Incubate at room temperature for 30 minutes.

[0097] Table 4. Particle size, PDI, and potential of PFeOOH / siRNA nanoparticles

[0098]

[0099] Table 4 shows that under the experimental conditions described above, PFeOOH and siRNA can form nanocomposites with controllable particle size and excellent dispersibility. This supports further research on this nanocomposite formulation.

[0100] (II) Verification of PFeOOH nucleic acid binding capacity

[0101] Take appropriate amounts of the formulation sample to achieve PFeOOH to siRNA mass ratios of 1:1, 3:1, 5:1, 10:1, 15:1, 20:1, and 25:1, ensuring a consistent siRNA loading volume of 300 ng per well. Add RNA loading buffer (6×) to the sample and mix thoroughly to prevent sample leakage and ensure experimental accuracy. Simultaneously, load an equal amount of siRNA as a blank control. Pour 1× TBE buffer into the agarose gel electrophoresis tank, then add the prepared gel, ensuring the buffer level covers the gel. Use a pipette to add the sample sequentially to the wells, ensuring the sample settles to the bottom. After addition, connect the electrophoresis tank cap, confirm correct polarity connections, set the voltage to 120V, and electrophoresis for 40 minutes. Use a Bio-rad imaging system to observe and record the brightness of the bands in different wells.

[0102] Figure 1 The results showed that siRNA could be completely loaded into nanoparticles when the mass ratio was 25:1.

[0103] Example 4: Preparation of PFeOOH / MTHFD2 siRNA nanocomposite

[0104] 1. Weigh the hydroxyl iron oxide nanoparticles modified with polyethyleneimine obtained in Example 2 into an enzyme-free centrifuge tube, and prepare a PFeOOH solution by treating it with enzyme-free water, wherein the concentration of FeOOH in the PFeOOH solution is 1 mg / mL.

[0105] 2. MTHFD2 siRNA-1 was designed based on fragment 1 of the MTHFD2 gene (CGAAATGAAGCCGTTGTCATT; as shown in SEQ ID No. 1); MTHFD2 siRNA-2 was designed based on fragment 2 of the MTHFD2 gene (CGGTCATCGATGTGGGAATAA; as shown in SEQ ID No. 2); and MTHFD2 siRNA-3 was designed based on fragment 3 of the MTHFD2 gene (GCTCATGAAGAACACCATTAT; as shown in SEQ ID No. 3) (see Table 5). The three different siRNA powders were dissolved in enzyme-free water to prepare solutions with a concentration of 300 ng / μL. 40 μL of the siRNA solution was added to an enzyme-free EP tube. 2 ml of the PFeOOH solution prepared in step 1 was added to the EP tube containing the siRNA solution and quickly mixed to achieve a PFeOOH:siRNA mass ratio of WPFeOOH:WsiRNA = 25:1. Immediately use a 1000ml pipette to repeatedly aspirate 50 times until completely mixed, then incubate at room temperature for 30 minutes to obtain the PFeOOH / siRNA solution.

[0106] Table 5

[0107]

[0108] Table 6. Particle size, PDI, and potential of PFeOOH / MTHFD2 siRNA nanoparticles

[0109]

[0110] Table 6 shows that under the above experimental conditions, PFeOOH and three different siRNAs (MTHFD2 siRNA-1, MTHFD2 siRNA-2, and MTHFD2 siRNA-3) that knock down the target gene MTHFD2 can form nanocomposites with controllable particle size and excellent dispersibility.

[0111] Example 5: Hyaluronic acid (HA) modified PFeOOH / siRNA nanocomposite

[0112] Step 1: Weigh hyaluronic acid powder into an enzyme-free EP tube, and prepare hyaluronic acid solutions with concentrations of 3 mg / mL, 1 mg / mL, 0.5 mg / mL, 0.1 mg / mL, 0.02 mg / mL, and 0.01 mg / mL using enzyme-free water.

[0113] Step 2: Add the PFeOOH / siRNA-6 solution prepared in test group 6 of Example 3 (diluted with enzyme-free water to a FeOOH concentration of 1 mg / mL) to the hyaluronic acid solution under stirring. Stir the mixture at a constant speed of 400 rpm for 15 hours at room temperature, then centrifuge at 9000 rpm for 15 min at 4°C. Collect the precipitate to obtain the product PFeOOH / siRNA@HA, then wash it three times with enzyme-free water and store it for later use.

[0114] Table 7. Particle size, PDI, and potential of PFeOOH / siRNA@HA nanoparticles

[0115]

[0116] The results in Table 7 show that the above experimental method can successfully modify the surface of PFeOOH / siRNA with hyaluronic acid film, and the modified nanoparticles have good dispersibility and stability.

[0117] Example 6: Hyaluronic acid-modified PFeOOH / MTHFD2 siRNA nanocomposite

[0118] Step 1: Weigh hyaluronic acid powder into an enzyme-free EP tube and prepare a hyaluronic acid solution with a concentration of 0.02 mg / mL using enzyme-free water.

[0119] Step 2: Add the hyaluronic acid solution to the PFeOOH / MTHFD2 siRNA solutions prepared in test groups 8-10 of Example 4 under stirring (diluted with enzyme-free water to a FeOOH concentration of 1 mg / mL). Stir the mixture at a constant speed of 400 rpm for 15 hours at room temperature, then centrifuge at 9000 rpm for 15 minutes at 4°C. Collect the precipitate, wash with enzyme-free water, and obtain the product PFeOOH / siRNA@HA, which is stored for later use.

[0120] Table 8. Particle size, PDI, and potential of PFeOOH / siMTHFD2@HA nanoparticles

[0121]

[0122] The results in Table 8 show that the above experimental method can successfully modify the surface of PFeOOH / MTHFD2siRNA with hyaluronic acid film, and the modified nanoparticles have good dispersibility and stability, making them suitable for further research.

[0123] Performance test examples

[0124] The complete culture medium is prepared as follows: Add 50 mL of FBS and 5 mL of penicillin / streptomycin antibiotic solution to 500 mL of DMEM medium and mix well.

[0125] DMEM medium: Thermo Fisher Scientific, USA.

[0126] Performance Test Example 1: MTHFD2 Gene Knockdown Effect Test

[0127] The ability of the nanocomposites prepared in experimental groups 8-10 of Example 4 and experimental groups 17-19 of Example 6 to knock down MTHFD2 in cells was verified. The specific steps are as follows:

[0128] 1. Spread 4T1 cells at 5 × 10⁶ cells per well 4 Cells were seeded at a density of 100 cells / well in 24-well plates and cultured overnight in a cell culture incubator until the cells adhered to the plate.

[0129] 2. The PFeOOH / MTHFD2 siRNA nanoparticles prepared in experimental groups 8-10 and the PFeOOH / MTHFD2 siRNA@HA nanoparticles prepared in experimental groups 17-19 were diluted to 100ug / mL in DMEM medium (the concentration was based on the FeOOH in the solution), incubated for 30min, and mixed evenly to form the experimental groups.

[0130] The blank control group was prepared using DMEM culture medium;

[0131] The negative control group was PFeOOH / siNC@HA-5 (experimental group 15);

[0132] The positive control group was Lipo2000 / MTHFD2 siRNA-2. The positive control group was prepared by mixing lipo2000 (Invitrogen, USA) with 300 ng / uL of MTHFD2 siRNA-2 prepared with enzyme-free water at a volume ratio of 1:1, and then diluting it with DMEM medium to make the final siRNA concentration 100 nM.

[0133] 3. Add the prepared DMEM medium containing nanoparticles (positive control, negative control, and experimental groups) from step 2 to the cell culture wells. The blank group uses DMEM medium. Add 500 μL to each well and incubate at 37°C and 5% CO2 for 4 hours. After incubation, replace the original medium in the cell culture wells with complete medium and continue incubation for 44 hours. Aspirate the culture medium and wash the cells three times with PBS buffer. Add 400 μL of lysis buffer (Nanjing Novizan Biotechnology Co., Ltd.) to each well and extract and purify the RNA according to the manufacturer's instructions. Store the obtained RNA at 80°C. Measure the concentration of the extracted RNA using Nanodrop and standardize the final RNA concentration for all groups to 300 ng / μL. Prepare the master mixture according to the manufacturer's instructions. Once prepared, place the mixture in a qPCR instrument and perform reverse transcription at 42°C for 40 min and 85°C for 5 min. Perform 40 cycles at 95°C for 5 s and 60°C for 25 s. After the amplification cycle, the temperature was lowered to 60℃ and then raised to 95℃ to obtain denatured DNA products. The data obtained from qPCR were processed using a relative quantification method. Using the gene expression level in the control group as a standard, the expression percentage of MTHFD2 in the experimental group relative to the control group was calculated to verify the knockout effect of the nanosystem.

[0134] The results are shown in Table 9. Based on the RT-qPCR results, we found that the nanocomplexes in the experimental groups all showed a certain inhibitory effect on MTHFD2 compared with the blank group. Among them, the knockdown effect of experimental groups 8-10 was weaker than that of experimental groups 17-19, proving that hyaluronic acid modification is beneficial to the delivery process and can improve the efficiency of gene silencing. Comparison revealed that MTHFD2 siRNA-2 had the best effect, and the nanoparticles in experimental group 18 showed the best effect. First, this means that PFeOOH / MTHFD2 siRNA@HA can knock down MTHFD2 in 4T1 cells. Second, the preparation method of experimental group 18, which loads MTHFD2 siRNA-2, can achieve the best gene silencing effect.

[0135] Table 9

[0136]

[0137] Where: Knockdown efficiency = MTHFD2 expression level in the experimental group / MTHFD2 expression level in the blank group * 100%.

[0138] Performance Test Example 2: Evaluation of Tumor Cell-Specific Toxicity

[0139] For the nanocomposite (PFeOOH / MTHFD2 siRNA-2@HA) prepared in experimental group 18 of Example 6, its toxicity to tumor cells was verified. The main experimental methods are as follows: the toxicity of nanoparticles to cells was detected by CCK-8 assay. By analyzing the changes in cell survival rate among different groups after administration, the toxicity of different formulation groups to cells was explored.

[0140] To investigate the specific toxicity of iron accumulation to tumor cells, mouse breast cancer cells 4T1 were selected as a tumor cell model, and mouse embryonic fibroblast cells 3T3 were selected as a healthy cell model. The cell viability of the two cell types was compared to investigate the specific toxicity of the formulation to tumor cells.

[0141] The specific procedure is as follows: 4T1 and 3T3 cells in the logarithmic growth phase were digested using trypsin (Thermo Fisher Scientific, USA). The digestion procedure was as follows: 1 mL of trypsin was added to the culture flask, and the flask was placed in a cell culture incubator at 37°C with 5% CO2 for 8 minutes. After digestion, 3 mL of complete culture medium was added to the culture flask to stop the digestion. The flask was then centrifuged at 1000 rpm for 3 minutes, and the pellet was collected. 4 Inoculate cells into 96-well plates at a density per well and incubate at 37°C with 5% CO2 for 12 hours until cell attachment. During this period, monitor cell growth closely to ensure optimal growth and appropriate cell density. After cell attachment, wash cells 2-3 times with sterile PBS and warm the PBS at 37°C for 5 minutes. Add 200 μL of PFeOOH / MTHFD2siRNA-2@HA solution to each well, prepared in DMEM medium at concentrations of 5 μg / mL, 25 μg / mL, 50 μg / mL, 75 μg / mL, and 100 μg / mL (based on FeOOH concentration in the solution). After four hours, discard the medium, wash cells 2-3 times with sterile PBS and warm the PBS at 37°C for 5 minutes. Add complete culture medium and continue culturing for 40 hours. Wash 2-3 times with sterile PBS, then add 100 μL of CCK-8 solution diluted with DMEM medium to each well, so that the final amount of CCK-8 solution added to each well is 10 μL. Incubate for another hour in a cell culture incubator, and then measure the absorbance at 450 nm.

[0142] At low concentrations (5-50 μg / mL), the PFeOOH / MTHFD2 siRNA-2@HA nanoparticles in experimental group 18 showed no significant difference in cytotoxicity between 3T3 and 4T1 cell types. When the drug concentration exceeded 50 μg / mL, differences in cell survival rates gradually emerged between the groups, with the overall cell survival rate trend showing 3T3 > 4T1. This indicates that the nanoparticles in experimental group 18 exhibited stronger cytotoxicity against 4T1 cells, and this difference was statistically significant. This demonstrates that nanoparticle formulations, after delivering the target drug to the tumor site, can specifically kill tumor cells and better exert their anti-tumor effect (see...). Figure 2 ).

[0143] Performance Test Example 3: Evaluation of the toxicity of siRNA to tumor cells.

[0144] For the nanocomposite (PFeOOH / MTHFD2 siRNA-2@HA) prepared in experimental group 18 of Example 6, its cytotoxicity against tumor cells was verified, and the cytotoxicity resulting from the knockdown of MTHFD2 was investigated. Experimental group 15 (PFeOOH / siNC@HA-5) in Example 5 was used as a negative control group.

[0145] The experimental method is as follows: The toxicity of nanoparticles to cells was detected by the CCK-8 assay. By analyzing the changes in cell survival rate among different groups after drug administration, the toxicity of different formulation groups to cells was explored.

[0146] The specific procedure for selecting mouse breast cancer cells 4T1 as a tumor cell model is as follows: 4T1 and 3T3 cells in the logarithmic growth phase are digested and then... 4Inoculate cells into 96-well plates at a density per well and incubate at 37°C with 5% CO2 for 12 hours until cell attachment. During this period, monitor cell growth closely to ensure optimal growth and appropriate cell density. After cell attachment, discard the culture medium and wash 2-3 times with sterile PBS, followed by warming the PBS at 37°C for 5 minutes. Add 200 μL of pre-prepared DMEM medium at concentrations of 10 nM, 30 nM, 50 nM, and 100 nM (as indicated by siRNA concentration) for each well (5 replicates per group). After four hours, discard the culture medium and wash 2-3 times with sterile PBS. Add complete culture medium containing 10% FBS and continue incubation for 44 hours. After culture, wash 2-3 times with sterile PBS, and add 100 μL of CCK-8 solution diluted with culture medium to each well, so that the final amount of CCK-8 solution added to each well is 10 μL. After incubation at 37°C and 5% CO2 for 1 hour, the absorbance is measured at 450 nm.

[0147] At concentrations of 10 nM and 30 nM, there was no significant difference in toxicity of the two nanoparticles, PFeOOH / siNC@HA-5 (experimental group 15) and PFeOOH / MTHFD2siRNA-2@HA (experimental group 18), to 4T1 cells. As drug concentration increased, differences in cell survival rates gradually emerged between the groups, with the overall cell survival rate trend showing that experimental group 15 > experimental group 18. The difference was most pronounced when the siRNA concentration increased to 100 nM (e.g., ...). Figure 3 The study demonstrated that nanoparticles with knockdown of the MTHFD2 gene exhibited significantly stronger cytotoxicity against 4T1 cells. In summary, PFeOOH / MTHFD2 siRNA-2@HA not only reduces cell viability through iron accumulation but also enhances cytotoxicity by knocking down MTHFD2, achieving a better tumor-killing effect than iron alone.

[0148] Performance Test Example 4: Validation of the nanocomposite's ability to induce ferroptosis in tumor cells

[0149] For the PFeOOH prepared in Example 2, and the nanocomposites prepared in experimental groups 6 in Example 3, 9 in Example 4, and 18 in Example 6, by comparing the changes in ferroptosis-related indicators before and after gene loading and before and after hyaluronic acid modification, it was demonstrated that the nanoparticles loaded with MTHFD2 knockout siRNA and modified with hyaluronic acid had the best inducing effect on ferroptosis.

[0150] The specific operating method is as follows:

[0151] 1. Prepare nanocomposite solutions with a concentration of 1 mg / mL of FeOOH using enzyme-free water, respectively, using PFeOOH prepared in Example 2, experimental group 6 in Example 3, experimental group 9 in Example 4, and experimental group 18 in Example 6.

[0152] 2. Add the cells to a six-well plate containing cell slides (Shanghai Wohong Biotechnology Co., Ltd.) at a concentration of 2 × 10⁻⁶. 5 Four T1 cells were seeded at a density of 4 cells / well and cultured overnight in an incubator until the cells adhered. After washing with sterile PBS, 2 mL of the nanocomposite solution prepared in step 1 was added, including (DMEM medium as a blank control, PFeOOH from Example 2, PFeOOH / siRNA-6 from experimental group 6 in Example 3, PFeOOH / MTHFD2 siRNA-2 from experimental group 9 in Example 4, and PFeOOH / MTHFD2 siRNA-2@HA from experimental group 18 in Example 6, with 3 replicates per group), and incubated in an incubator for 24 h. After incubation, the cells were washed three times with sterile PBS.

[0153] Preparation of DCFH-DA probe solution and BODIPY TM 581 / 591C11 probe solution. Add 1 mL of diluted probe solution to each well, incubate in the dark for 20 min, wash three times with sterile PBS, fix with 4% paraformaldehyde, and incubate statically for 10 min. Perform nuclear staining using the nuclear dye DAPI; add 500 μL DAPI staining solution to each well under dark conditions, incubate at room temperature for 5 min, and wash three times with PBS. After preparing slides for microscopic observation...

[0154] The specific preparation process of the probe:

[0155] BODIPY TM 581 / 591C11 (Thermo Scientific, USA): Dilute BODIPY using serum-free medium. TM 581 / 591C11, to achieve a final concentration of 5 μM;

[0156] DCFH-DA probe (Shanghai Beyotime Biotechnology Co., Ltd.): Dilute with DMEM medium to a final concentration of 3 μM.

[0157] like Figure 4-9 As shown, almost no DCFH-DA fluorescence signal was detected in the blank control group, demonstrating that the ROS level of cells was low without drug induction. This is because the formulation contains PFeOOH and Fe... 2+PFeOOH can undergo a Fenton reaction with intracellular H2O2 to generate ROS, so the green fluorescence of the formulation group PFeOOH was significantly enhanced compared to the blank control group, indicating a stronger ROS induction level. In Example 3, the PFeOOH / siRNA-6 in experimental group 6 was a fully tested and validated non-silencing siRNA, which did not have the ability to silence the MTHFD2 gene. Therefore, the ROS production levels of PFeOOH in Example 2 and PFeOOH / siRNA-6 (experimental group 6 in Example 3) were similar, and there was no significant difference between the groups. The PFeOOH / MTHFD2 siRNA-2 and PFeOOH / MTHFD2siRNA-2@HA formulation groups showed a stronger ROS induction level compared to the PFeOOH group, with a significant difference. This demonstrates that knockdown of MTHFD2 can effectively enhance ROS production in cells. The final formulation group showed the strongest ROS level, possibly because the modification with hyaluronic acid increased the uptake by tumor cells.

[0158] like Figure 10-15 As shown, there were significant differences in LPO levels between the blank control group and the nanocomposites prepared in experimental groups 6 of Example 3, 9 of Example 4, and 18 of Example 6. The blank control group exhibited the weakest green fluorescence, indicating that almost no LPO was produced intracellularly in the absence of drug interference, similar to the level in the blank control group in the intracellular ROS experiment. All other drug-treated groups contained PFeOOH, which can induce ROS production in cells, thereby promoting lipid peroxidation. Notably, there was a significant difference between the formulation group loaded with MTHFD2 siRNA and the PFeOOH group. This may be because, in addition to PFeOOH generating ROS, the knockdown of MTHFD2 in the drug-loaded nanoparticles can also affect the Fenton reaction, thus promoting LPO accumulation.

[0159] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A nanocomposite loaded with MTHFD2 siRNA, characterized in that, The nanocomposite comprises siRNA and PFeOOH, wherein the siRNA comprises MTHFD2 siRNA-1 targeting fragment 1 of MTHFD2, or MTHFD2 siRNA-2 targeting fragment 2 of MTHFD2, or MTHFD2 siRNA-3 targeting fragment 3 of MTHFD2; wherein the sequence of fragment 1 of MTHFD2 is shown in SEQ ID No. 1, the sequence of fragment 2 of MTHFD2 is shown in SEQ ID No. 2, and the sequence of fragment 3 of MTHFD2 is shown in SEQ ID No. 3; The sequence of the MTHFD2 siRNA-1 is as follows: Sense 5'-3': CGAAAUGAAGCCGUUGUCAUUTT, as shown in SEQ ID No. 4; Antisense 5'-3':AAUGACAACGGCUUCAUUUCGTT, as shown in SEQ ID No. 5; The sequence of the MTHFD2 siRNA-2 is as follows: Sense 5'-3': CGGUCAUCGAUGUGGGAAUAATT, as shown in SEQ ID No. 6; Antisense 5'-3': UUAUUCCCACAUCGAUGACCGTT, as shown in SEQ ID No. 7; The sequence of the MTHFD2 siRNA-3 is as follows: Sense 5'-3': GCUCAUGAAGAACACCAUUAUTT, as shown in SEQ ID No. 8; Antisense 5'-3':AUAAUGGUGUUCUUCAUGAGCTT, as shown in SEQ ID No.

9.

2. The nanocomposite loaded with MTHFD2 siRNA according to claim 1, characterized in that, The preparation method of PFeOOH includes the following steps: S1. Under stirring, the polymer solution is added dropwise to the FeOOH solution to form a mixed solution, and the mixed solution is ultrasonically treated. S2. After sonication, the system is centrifuged, the precipitate is collected, washed, and polymer-modified iron hydroxyl oxide nanoparticles PFeOOH are obtained.

3. The nanocomposite loaded with MTHFD2 siRNA according to claim 2, characterized in that, In S1, the polymer is selected from at least one of PEI 25K, PEI 1800, and PEI 800.

4. The nanocomposite loaded with MTHFD2 siRNA according to claim 2, characterized in that, In S1, before addition, the solubility of the polymer solution is 0.1-0.2 mg / mL; the concentration of the FeOOH solution is 1-2 mg / mL; and the mass ratio of the polymer to FeOOH in the mixed solution is 1:5-1:

20.

5. The nanocomposite loaded with MTHFD2 siRNA according to claim 2, characterized in that, The preparation method of FeOOH includes the following steps: Step 1: Dissolve FeCl3·6H2O in ddH2O to form FeCl3 solution; Step 2: Stir under heating conditions until the FeCl3 solution turns into a turbid orange-red color; Step 3: Cool the product from Step 2, centrifuge, collect the precipitate, wash it, and obtain the FeOOH.

6. The nanocomposite loaded with MTHFD2 siRNA according to claim 1, characterized in that, The nanocomposite loaded with MTHFD2siRNA was prepared by a method comprising the following steps: (1) Prepare PFeOOH solution; (2) Prepare siRNA solution with enzyme-free water; (3) Mix the PFeOOH solution and siRNA solution evenly and incubate for 20-30 min to obtain the PFeOOH / siRNA solution; (4) PFeOOH / siRNA solution is added to hyaluronic acid solution under stirring to form a mixture; the mixture is stirred, centrifuged, the precipitate is collected, washed, and the product siRNA-loaded nanocomposite is obtained.

7. The nanocomposite loaded with MTHFD2 siRNA according to claim 6, characterized in that, In step (3), the PFeOOH solution and siRNA solution are mixed by adding the PFeOOH solution to the siRNA solution.

8. The nanocomposite loaded with MTHFD2 siRNA according to claim 6, characterized in that, In step (3), the mass ratio of PFeOOH to siRNA is 1-25:

1. In step (4), the concentration of the hyaluronic acid solution is 0.01-3 mg / mL; the ratio of the hyaluronic acid solution to PFeOOH / siRNA is 1:0.4-1:

100.

9. The use of a nanocomposite as described in any one of claims 1-8 in the preparation of a medicament for treating antitumor diseases.

10. The application according to claim 9, characterized in that, The tumors include breast cancer, lung cancer, liver cancer, esophageal cancer, or rectal cancer.