Application of GOT1 inhibitor in preparation of medicine for treating acute myelogenous leukemia

By combining the GOT1 inhibitor compound 2c with a ferroptosis inducer, the GOT1 gene can be targeted and inhibited, thus addressing the issues of drug resistance and toxic side effects in targeted therapy for AML and achieving efficient apoptosis and reduced viability of AML cells.

CN121015652APending Publication Date: 2025-11-28MATERNAL & CHILD HEALTH HOSPITAL OF GUANGXI ZHUANG AUTONOMOUS REGION GUANGXI ZHUANG AUTONOMOUS REGION
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511402297.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-28
Publication Date
2025-11-28

AI Technical Summary

Technical Problem

Current targeted therapies for AML suffer from high drug resistance rates and severe toxic side effects, necessitating the discovery of new regulatory nodes to improve treatment specificity.

Method used

By combining the GOT1 inhibitor compound 2c with a ferroptosis inducer, the sensitivity of ferroptosis inducers is enhanced by targeting and inhibiting the GOT1 gene, thereby synergistically reducing AML cell viability.

Benefits of technology

It significantly reduces AML cell viability and increases AML cell apoptosis levels, enabling more effective targeted therapy for AML and reducing drug resistance and toxic side effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121015652A_ABST
    Figure CN121015652A_ABST
Patent Text Reader

Abstract

The invention relates to application of a GOT1 inhibitor in preparation of a medicine for treating acute myelogenous leukemia. An active component in the GOT1 inhibitor is selected from any one or a combination of at least two of a compound 2c (compound 2c), a pharmaceutically acceptable salt, an isomer, a solvate and a metabolite of the compound 2c. According to the present invention, the research results show that the high expression of the GOT1 gene in the acute myeloid leukemia (AML) is achieved, and the activity of the AML cell can be significantly reduced, the apoptosis level of the AML cell can be improved and the targeted treatment of the AML can be achieved through the gene knock-down (shRNA) or the targeted inhibition of the GOT1 gene by using the small molecule inhibitor; in addition, the GOT1 inhibitor compound 2c can enhance the sensitivity of the ferroptosis inducer, and when the GOT1 inhibitor compound 2c and the ferroptosis inducer are combined for use, the AML cell death effect can be remarkably enhanced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of GOT1 inhibitors in the preparation of drugs for treating acute myeloid leukemia. Background Technology

[0002] AML is a highly heterogeneous hematopoietic malignancy characterized by abnormal proliferation and differentiation arrest of myeloid progenitor cells. Despite advances in chemotherapy and targeted therapy in recent years, drug resistance and relapse remain major challenges in the clinical treatment of AML. Ferroptosis, as a novel programmed cell death mechanism, has attracted widespread attention due to its potential value in cancer treatment; its occurrence depends on the accumulation of iron-dependent lipid peroxides.

[0003] The standard treatment for AML primarily involves chemotherapy and targeted therapies (such as venetoclax combined with cytarabine). CN117205227A discloses the use of a composition in the preparation of a drug for treating acute myeloid leukemia, wherein the composition comprises the CXCR4 antagonist praxaviva, donomycin, cytarabine, and venetoclax in a concentration of 10:1:1:1. Experiments have shown that this composition, compared to existing DAV drug combinations (dnomycin, cytarabine, and venetoclax), significantly increases the apoptosis level of AML cells and the proportion of stem and progenitor cells among apoptotic cells.

[0004] AML treatment strategies targeting ferroptosis can achieve inhibition of AML cells through GPX4 inhibitors. For example, CN120053441A discloses a pharmaceutical composition containing clonidine and a GPX4 inhibitor, which creatively combines clonidine and a GPX4 inhibitor to target the oxidative-antioxidant defense system of AML tumor cells. The inhibition rate of AML cells is significantly higher than that of the drugs alone. The combination of the two drugs can synergistically inhibit AML cell viability, induce mitochondrial damage in AML cells, and promote ferroptosis in AML cells, thereby achieving the goal of treating AML.

[0005] However, current targeted therapies for AML suffer from high drug resistance rates, and AML treatment strategies targeting ferroptosis (such as GPX4 inhibitors) have serious toxic side effects, necessitating the discovery of new regulatory nodes.

[0006] Therefore, providing a new therapeutic target for AML to overcome the limitations of current targeted therapies for AML and improve the specificity of treatment has become one of the urgent technical problems to be solved. Summary of the Invention

[0007] In view of the shortcomings of the prior art, the purpose of this invention is to provide the application of GOT1 inhibitors in the preparation of drugs for treating acute myeloid leukemia.

[0008] To achieve this objective, the present invention adopts the following technical solution:

[0009] In a first aspect, the present invention provides the use of GOT1 inhibitors in the preparation of medicaments for treating acute myeloid leukemia.

[0010] The active ingredient in the GOT1 inhibitor is selected from any one or a combination of at least two of compound 2c, its pharmaceutically acceptable salt, isomer, solvate, and metabolite.

[0011] The structure of compound 2c is shown in Formula I:

[0012]

[0013] This invention has found that the GOT1 gene is highly expressed in AML. By knocking down the GOT1 gene (shRNA) or using small molecule inhibitors to target and inhibit the GOT1 gene, the viability of AML cells can be significantly reduced and the level of apoptosis in AML cells can be increased, thus achieving targeted therapy for AML.

[0014] Preferably, the drug further contains pharmaceutically acceptable excipients;

[0015] Preferably, the pharmaceutically acceptable excipients include any one or a combination of at least two of the following: fillers, binders, wetting agents, disintegrants, solubilizers, osmotic pressure regulators, coating materials, colorants, pH adjusters, antioxidants, or antibacterial agents.

[0016] Secondly, this invention provides the application of GOT1 inhibitors in the preparation of inhibitors for the proliferation of acute myeloid leukemia cells.

[0017] The active ingredient in the GOT1 inhibitor is selected from any one or a combination of at least two of compound 2c, its pharmaceutically acceptable salt, isomer, solvate, and metabolite.

[0018] The structure of compound 2c is shown in Formula I:

[0019]

[0020] Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

[0021] Thirdly, the present invention provides the application of GOT1 inhibitors in the preparation of apoptosis promoters for acute myeloid leukemia cells.

[0022] The active ingredient in the GOT1 inhibitor is selected from any one or a combination of at least two of compound 2c, its pharmaceutically acceptable salt, isomer, solvate, and metabolite.

[0023] The structure of compound 2c is shown in Formula I:

[0024]

[0025] Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

[0026] Fourthly, this invention provides the application of GOT1 inhibitors in the preparation of promoters of increased reactive oxygen species in acute myeloid leukemia cells.

[0027] The active ingredient in the GOT1 inhibitor is selected from any one or a combination of at least two of compound 2c, its pharmaceutically acceptable salt, isomer, solvate, and metabolite.

[0028] The structure of compound 2c is shown in Formula I:

[0029]

[0030] Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

[0031] Fifthly, the present invention provides a combination drug composition, wherein the active component in the combination drug composition is composed of a first active component and a second active component.

[0032] The first active component is selected from any one or a combination of at least two of compound 2c, its pharmaceutically acceptable salt, isomer, solvate, and metabolite.

[0033] The second active ingredient is selected from RSL3 or FIN56, or any one or a combination of at least two of the pharmaceutically acceptable salts, isomers, solvates, and metabolites of the aforementioned drugs.

[0034] Preferably, the combined pharmaceutical composition further contains pharmaceutically acceptable excipients.

[0035] Preferably, the pharmaceutically acceptable excipients include any one or a combination of at least two of the following: fillers, binders, wetting agents, disintegrants, solubilizers, osmotic pressure regulators, coating materials, colorants, pH adjusters, antioxidants, or antibacterial agents.

[0036] Preferably, the combined pharmaceutical composition is a single compound preparation or a combination of two separate preparations.

[0037] Preferably, the combined pharmaceutical composition is a combination of two separate formulations, which are administered simultaneously or sequentially.

[0038] Preferably, the formulation is any pharmaceutically acceptable dosage form.

[0039] Sixthly, the present invention provides the use of the combination drug composition described in the fifth aspect in the preparation of a medicament for treating acute myeloid leukemia.

[0040] This invention creatively discovers that GOT1 inhibitor compound 2c can enhance the sensitivity to ferroptosis inducers, and that the combined use of GOT1 inhibitor compound 2c and ferroptosis inducers has a significant synergistic effect in reducing AML cell viability. The combined drug regimen of compound 2c and ferroptosis inducers provided by this invention shows great promise for the treatment of AML.

[0041] In a seventh aspect, the present invention provides the use of the combination drug composition described in the fifth aspect in the preparation of an inhibitor of acute myeloid leukemia cell proliferation.

[0042] Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

[0043] The numerical range described in this invention includes not only the point values ​​listed above, but also any point values ​​within the numerical ranges not listed above. Due to space limitations and for the sake of brevity, this invention will not exhaustively list all the specific point values ​​included in the range.

[0044] Compared with the prior art, the present invention has the following beneficial effects:

[0045] This invention has found that the GOT1 gene is highly expressed in AML. By knocking down the GOT1 gene (shRNA) or using small molecule inhibitors to target and inhibit the GOT1 gene, the viability of AML cells can be significantly reduced and the level of apoptosis in AML cells can be increased, thus achieving targeted therapy for AML.

[0046] Furthermore, this invention creatively discovers that the GOT1 inhibitor compound 2c can enhance the sensitivity to ferroptosis inducers, and that the combined use of GOT1 inhibitor compound 2c and ferroptosis inducers has a significant synergistic effect in reducing AML cell viability. The combined drug regimen of compound 2c and ferroptosis inducers provided by this invention shows great promise for the treatment of AML. Attached Figure Description

[0047] Figure 1This is a graph showing the cell viability test results of different experimental groups in Example 1.

[0048] Figure 2 This is a graph showing the cell viability test results of different experimental groups in Example 2.

[0049] Figure 3 This is a graph showing the cell viability test results of different experimental groups in Example 3.

[0050] Figure 4 This is a graph showing the results of apoptosis level tests in different experimental groups in Example 3.

[0051] Figure 5 This is a graph showing the cell viability test results of different experimental groups in Example 4.

[0052] Figure 6 This is a graph showing the results of the reactive oxygen species (ROS) level test in different experimental groups in Example 5. Detailed Implementation

[0053] The technical solution of the present invention will be further illustrated below through specific embodiments. Those skilled in the art should understand that the embodiments described are merely illustrative of the present invention and should not be construed as limiting the invention in any way.

[0054] Example 1

[0055] The effect of GOT1 gene knockout on AML cell viability.

[0056] (1) Construction of gene knockout cell lines:

[0057] Using lentiviral vectors, shRNA containing a control sequence (the nucleic acid sequence shown in SEQ ID NO:1, specifically TTCTCCGAACGTGTCACGT) was inserted into THP-1 cells (shNC group, i.e., the control group, used to exclude the influence of exogenous gene insertion on cells) and shRNA targeting the GOT1 gene (the nucleic acid sequence shown in SEQ ID NO:2, specifically GCGTTGGTACAATGGAACAAA) were inserted into the experimental group (shGOT1 group, i.e., the experimental group). Stable transfected cells were obtained after 7-14 days of selection with 2 μg / mL puromycin. RNA and protein were extracted from the selected shNC and shGOT1 cells, and verified by RT-PCR and Western blot. The expression levels of GOT1 mRNA and protein in the shGOT1 group cells were significantly lower than those in the shNC group, indicating successful construction of the GOT1 gene knockout cell line. The above method yielded successfully knocked-out shNC and shGOT1 cells.

[0058] (2) Experimental Groups:

[0059] The THP-1 group (THP-1 cells without gene knockout), the shNC group (shNC cells obtained by inserting a control sequence in step (1)) and the shGOT1 group (shGOT1 cells obtained by inserting a shRNA sequence targeting the GOT1 gene in step (1)).

[0060] (3) Experimental methods:

[0061] THP-1, shNC, and shGOT1 cells were seeded into 96-well plates at an initial density of 2000 cells per milliliter (100 μL per well) using RPMI 1640 basal medium (with 10% fetal bovine serum added). After mixing, the plates were incubated at 37°C in a 5% CO2 cell culture incubator. After 24, 48, and 72 hours, 10 μL of CCK-8 reagent was added to each well of the 96-well plate. The plates were gently shaken to mix, and the plates were incubated in the cell culture incubator in the dark for another 2 hours. The plates were then removed, and the OD value at 450 nm was measured using a microplate reader to calculate cell viability.

[0062] (4) Experimental results:

[0063] The cell viability test results of each experimental group are as follows: Figure 1 As shown, the cell proliferation rate of the GOT1 knockdown cell line is significantly reduced.

[0064] Example 2

[0065] Validation of the synergistic effect of GOT1 gene knockout and ferroptosis inducer in inhibiting AML cell proliferation.

[0066] (1) Experimental Groups:

[0067] shNC group, shGOT1 group, shNC+RSL3 group, shGOT1+RSL3 group, shNC+FIN56 group, shGOT1+FIN56 group.

[0068] (2) Experimental methods:

[0069] Based on 5 × 10 per milliliter volume 5Cell density: The shNC cells and shGOT1 cells obtained in Example 1 were seeded into 96-well plates (100 μL per well), with three replicates for each type of cell culture. The culture medium was RPMI 1640 basal medium (with 10% fetal bovine serum added). Subsequently, 0.5 μM RSL3 (after 24 h of culture, shNC+RSL3 group and shGOT1+RSL3 group) or 0.5 μM FIN56 (after 24 h of culture, shNC+FIN56 group and shGOT1+FIN56 group) were added to each well, mixed well, and placed in a cell culture incubator for further culture. At 24 h of culture, 10 μL of CCK-8 reagent was added to each well of the 96-well plate, the plate was gently shaken to mix, and the plate was incubated in the cell culture incubator in the dark for another 2 h. After incubation, the OD value at 450 nm was measured using a microplate reader, and cell viability was calculated.

[0070] (3) Experimental results:

[0071] The cell viability test results of each experimental group are as follows: Figure 2 As shown, the combination of GOT1 knockdown cell lines and the ferroptosis inducers RSL3 / FIN56 can more effectively kill AML cells and reduce cell viability.

[0072] Example 3

[0073] Effects of GOT1 inhibitor compound 2c on AML cell viability and apoptosis levels.

[0074] (1) Experimental method:

[0075] AML cell lines (including THP-1, MV411, and KG-1α cells) were seeded into 96-well plates. A control group (DMSO) and groups with different concentrations (5, 10, 20, 40, and 80 μM) of the GOT1 inhibitor compound 2c were set up. The cells were treated accordingly, and cell viability and apoptosis levels were detected.

[0076] (1.1) Cell viability test:

[0077] Based on 5 × 10 per milliliter volume 5The cell density was determined by seeding THP-1, MV411, and KG-1α cells into 96-well plates (100 μL per well) using RPMI 1640 basal medium (with 10% fetal bovine serum added). DMSO (control group) and different concentrations (5, 10, 20, 40, 80 μM) of the GOT1 inhibitor compound 2c were then added to the 96-well plates (four replicates for each gradient). After mixing, the plates were incubated at 37°C in a 5% CO2 cell culture incubator. After 24 and 48 hours, 10 μL of CCK-8 reagent was added to each well. The plates were gently shaken to mix, and then incubated in the cell culture incubator for another 2 hours in the dark. The cells were then removed, and the OD value at 450 nm was measured using a microplate reader to calculate cell viability.

[0078] (1.2) Apoptosis level test:

[0079] In step (1.1), after culturing cells in cell culture incubators for 24h and 48h, the cells were transferred to 1.5mL EP tubes, centrifuged at 500g for 5min, the supernatant was discarded, and the cells were resuspended in 500μL Binding Buffer. The cells were then cultured at a rate of 1×10⁻⁶ cells / mL. 5 Cells were incubated with the corresponding ratio of 5 μL Annexin V-APC to 10 μL PI antibody, mixed thoroughly, and incubated at room temperature in the dark for 10 min. The apoptosis level (Annexin V) was then detected by flow cytometry. + (cell ratio).

[0080] (2) Experimental results:

[0081] The cell viability test results after treatment in each experimental group are as follows: Figure 3 As shown in the figure, cell viability was significantly reduced after treatment with the GOT1 inhibitor compound 2c.

[0082] The results of apoptosis level tests in each experimental group after treatment are as follows: Figure 4 As shown in the figure, treatment with the GOT1 inhibitor compound2c significantly increased the level of apoptosis.

[0083] Example 4

[0084] The effect of combined drug combinations on AML cell viability.

[0085] (1) Experimental Groups:

[0086] Control group (DMSO), compound 2c monotherapy group (10 μM), RSL3 monotherapy group (0.5 μM), FIN56 monotherapy group (0.5 μM), combination therapy group 1 (10 μM compound 2c + 0.5 μM RSL3), and combination therapy group 2 (10 μM compound 2c + 0.5 μM FIN56).

[0087] (2) Experimental methods:

[0088] Based on 5 × 10 per milliliter volume 5 The cell density was determined by seeding THP-1, MV411, and KG-1α cells into 96-well plates (100 μL per well) using RPMI 1640 basal medium (with 10% fetal bovine serum added). The drugs from each experimental group were then added, mixed thoroughly, and placed in a 37°C, 5% CO2 cell culture incubator for static culture. After 24 hours, the 96-well plates were removed, and 10 μL of CCK-8 reagent was added to each well. The plates were gently shaken to mix, and then incubated in the cell culture incubator in the dark for another 2 hours. The cells were then removed, and the OD value at 450 nm was measured using a microplate reader to calculate cell viability.

[0089] (2) Experimental results:

[0090] The cell viability test results after treatment in each experimental group are as follows: Figure 5 As shown, the GOT1 inhibitor compound 2c works synergistically with ferroptosis inducers RSL3 or FIN56 to significantly reduce cell viability to below 50%.

[0091] Example 5

[0092] Effects of GOT1 inhibitor compound 2c on reactive oxygen species levels in AML cells.

[0093] (1) Experimental method:

[0094] AML cell lines (including THP-1, MV411, and KG-1α cells) were seeded in 12-well plates. An experimental group (containing 10 μM compound 2c) and a control group (containing an equal volume of DMSO) were set up. The cells were treated accordingly, and the reactive oxygen species levels of each cell were measured.

[0095] The specific method is as follows: 5 × 10 per milliliter volume. 5Cell density: THP-1, MV411, and KG-1α cells were seeded separately in 12-well plates (1 mL per well) using RPMI 1640 basal medium (with 10% fetal bovine serum added). 10 μM Compound 2C or an equal volume of DMSO was added to each well, and the cells were incubated for 24 and 48 hours. Cells were then removed from the plates, transferred to 1.5 mL EP tubes, centrifuged at 500g for 5 min, and resuspended in 400 μL of RPMI 1640 medium per well. The probe DCFH-DA was diluted 1:1000 with RPMI 1640 medium to a final concentration of 10 μM. An appropriate volume of DCFH-DA probe was then added to the resuspended cells, mixed, and incubated in the dark for 20 min. The cells were then washed three times with PBS, the supernatant was discarded, and the cells were resuspended in an appropriate amount of PBS. The reactive oxygen species level was detected by flow cytometry. The fluorescence spectrum of DCFH-DA was very similar to that of FITC, and DCFH-DA could be detected using the parameters of FITC.

[0096] (2) Experimental results:

[0097] The reactive oxygen species levels in each cell after compound 2c treatment are as follows: Figure 6 As shown, the GOT1 inhibitor compound2c significantly increased the reactive oxygen species (ROS) level in AML cells. Compared with the control group, the ROS level in the inhibitor-treated group increased by 60-80%, further verifying that compound2c accelerates AML cell apoptosis.

[0098] The applicant declares that the technical solution of this invention is illustrated by the above embodiments, but this invention is not limited to the above embodiments, that is, it does not mean that this invention must rely on the above embodiments to be implemented. Those skilled in the art should understand that any improvements to this invention, equivalent substitutions of raw materials for the products of this invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of this invention.

[0099] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details of the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0100] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not describe the various possible combinations separately.

Claims

1. Application of GOT1 inhibitors in the preparation of drugs for the treatment of acute myeloid leukemia; The active component in the GOT1 inhibitor is selected from any one or a combination of at least two of the following: compound 2c, its pharmaceutically acceptable salts, isomers, solvates, and metabolites. The structure of compound 2c is shown in Formula I:

2. The application according to claim 1, characterized in that, The drug also contains pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include any one or a combination of at least two of the following: fillers, binders, wetting agents, disintegrants, solubilizers, osmotic pressure regulators, coating materials, colorants, pH adjusters, antioxidants, or antibacterial agents.

3. Application of GOT1 inhibitors in the preparation of inhibitors for the proliferation of acute myeloid leukemia cells; The active component in the GOT1 inhibitor is selected from any one or a combination of at least two of the following: compound 2c, its pharmaceutically acceptable salts, isomers, solvates, and metabolites. The structure of compound 2c is shown in Formula I: Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

4. Application of GOT1 inhibitors in the preparation of apoptosis promoters for acute myeloid leukemia cells; The active component in the GOT1 inhibitor is selected from any one or a combination of at least two of the following: compound 2c, its pharmaceutically acceptable salts, isomers, solvates, and metabolites. The structure of compound 2c is shown in Formula I: Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

5. Application of GOT1 inhibitors in the preparation of agents that promote increased intracellular reactive oxygen species in acute myeloid leukemia cells; The active component in the GOT1 inhibitor is selected from any one or a combination of at least two of the following: compound 2c, its pharmaceutically acceptable salts, isomers, solvates, and metabolites. The structure of compound 2c is shown in Formula I: Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

6. A combination drug composition, characterized in that, The active component in the combined drug composition consists of a first active component and a second active component; The first active component is selected from any one or a combination of at least two of the following: compound 2c, its pharmaceutically acceptable salts, isomers, solvates, and metabolites; The second active ingredient is selected from RSL3 or FIN56, or any one or a combination of at least two of the pharmaceutically acceptable salts, isomers, solvates, and metabolites of the aforementioned drugs.

7. The combination drug composition according to claim 6, characterized in that, The combined drug composition also contains pharmaceutically acceptable excipients; Preferably, the pharmaceutically acceptable excipients include any one or a combination of at least two of the following: fillers, binders, wetting agents, disintegrants, solubilizers, osmotic pressure regulators, coating materials, colorants, pH adjusters, antioxidants, or antibacterial agents.

8. The combination drug composition according to claim 6 or 7, characterized in that, The combined drug composition is a single compound preparation or a combination of two separate preparations; Preferably, the combined pharmaceutical composition is a combination of two separate formulations, which are administered simultaneously or sequentially. Preferably, the formulation is any pharmaceutically acceptable dosage form.

9. Use of the combination drug composition according to any one of claims 6-8 in the preparation of a medicament for treating acute myeloid leukemia.

10. The use of the combination drug composition according to any one of claims 6-8 in the preparation of an inhibitor of acute myeloid leukemia cell proliferation; Preferably, the acute myeloid leukemia cells are selected from THP-1 cells, MV411 cells, or KG-1α cells.

Citation Information

Patent Citations

  • Application of composition in preparation of medicine for treating acute myelogenous leukemia

    CN117205227A

  • Pharmaceutical composition for treating acute myelogenous leukemia and application thereof

    CN120053441A

  • Therapeutic method and biomarker for MDM2 inhibitors

    CN113337602A

  • Methods and compositions for treating acute myeloid leukemia

    US20230136218A1

  • Treating tissue inflammation

    WO2023023538A2