Cytochrome P450 mutant enzyme and application

Abstract

The invention belongs to the field of biological catalysis, and particularly relates to a cytochrome P450 mutant enzyme and application thereof in catalyzing fatty acid hydroxylation. The invention relates to a cytochrome P450 mutant enzyme. The mutant enzyme is obtained by mutating a 456 site and at least one of the following sites of CYP153AM. Aq in a cytochrome P450 family; the molecular marker comprises the following sites: G307, D310, L303, M357, I145, V306, F455, T311 and L354. According to the method, CYP153AM. Aq monooxygenase is modified into peroxygenase by utilizing a hydrogen peroxide tunnel engineering strategy, a small CYP153AM. Aq hydrogen peroxide mutant library is constructed, on the basis, a substrate pocket engineering strategy is further combined, fatty acid omega-hydroxylase CYP153AM. Aq is redefined as alpha-hydroxylase, meanwhile, the substrate conversion rate is increased, and the yield is increased. The (R)-enantioselective alpha-hydroxy fatty acid is obtained. In addition, half-scale preparation is carried out on the hydroxylation product, and the separation product can reach 90%.

Description

Technical Field

[0001] This invention belongs to the field of biocatalysis, specifically relating to a cytochrome P450 mutant enzyme and its application in catalyzing fatty acid hydroxylation. Background Technology

[0002] Hydroxy fatty acids are industrially valuable compounds used in the synthesis of various pharmaceuticals, fragrances, foods, biopolymers, and lubricants. Several natural enzymes are known to directly synthesize hydroxy fatty acids, such as cytochrome P450 monooxygenases, 12-hydroxylases, α-dioxygenases, lipoxygenases, and hydratases. Cytochrome P450 enzymes, in particular, have become a focus of research and application in the selective hydroxylation of fatty acids due to their excellent hydroxylation capabilities and superior chemo, regio, and stereoselectivity towards the CH bonds of fatty acids, the CH bonds of aryl groups, and C=C double bonds. For example, CYP102A1 (BM3) from Bacillus subtilis performs hydroxylation reactions at the ω-1, ω-2, and ω-3 positions of fatty acids (C10:0-C18:0). CYP153A from Marinobacter aquaeolei... M.aq The substrate range catalyzed by (CYP153A33) covers the ω-hydroxylation of saturated fatty acid substrates (C9:0-C20:0) and unsaturated fatty acids (C14-C18), but does not include C8 and C19 fatty acids (1. Malca SH, Scheps D, Kühnel L, et al. Bacterial CYP153A monooxygenases for the synthesis of omega-hydroxylated fatty acids[J]. Chemical communications, 2012, 48(42):5115-5117.). However, the vast majority of identified P450 enzymes hydroxylate fatty acids mainly at the terminal and subterminal positions. However, a few P450 monooxygenases also perform intrachain hydroxylation of fatty acids. For example, Jones et al. found that CYP116B46 (P450-TT) can perform intrachain hydroxylation of decanoic acid to generate (S)-5-hydroxydecanoic acid. In recent years, Maseme et al. have discovered that CYP505E3 can regioselectively hydroxylate the ω-7 position in fatty acid (C12-C16) chains.

[0003] To date, there are not many natural enzymes that can hydroxylate fatty acids at the α- and β-positions, mainly including P450 from the CYP152 family. SPα P450 BSβ and P450 CLA Superoxygenases, such as P450 SPαPeroxygenases can selectively hydroxylate fatty acids at the α-position using (S)-selectivity, employing H₂O₂ as the oxidant for biocatalytic reaction. This not only eliminates the dependence on the expensive cofactor NAD(P)H and complex electron transport chains but also shortens the catalytic cycle pathway of P450 enzymes, facilitating their in vitro application and enhancing their practical potential. For example, Bangert et al. reported on P450... SPα The substrate conversion rate of medium-chain fatty acids catalyzed by enzymes can reach up to 99%, with a (S)-stereoselectivity of 95%-99%. Furthermore, a semi-scale preparation of α-hydroxyoctanoic acid was achieved, with a TON of up to 42,000. In addition, α-hydroxy fatty acids can serve as intermediates for the synthesis of α-keto acids and α-amino acids, in the construction of biopolyesters, and in the production of drugs, antimicrobial agents, and natural products; short-chain β-hydroxy fatty acids possess antibacterial properties. The direct preparation of α-hydroxy or β-hydroxy fatty acids using enzymes simplifies the synthetic steps and clarifies the reaction conditions. However, the number of naturally occurring α-hydroxylases or β-hydroxylases identified is extremely small, and their stereoselectivity and regioselectivity are relatively limited. Therefore, the development of novel α-hydroxylases or the modification of existing α-hydroxylases using enzyme engineering is of great significance.

[0004] Current literature reports that the modification of fatty acids using strategies such as directed evolution and enzyme engineering mainly focuses on expanding the substrate range of fatty acids and achieving regioselectivity from the ω-1 position to the ω- position. For example, Wahler et al. obtained the P450BM3 mutant 36B7 using directed evolution, which achieved highly regioselective hydroxylation of the palmitic acid ω-position. However, the issue of substrate specificity exists, posing a new challenge to the development of practical α-hydroxylases. Summary of the Invention

[0005] The purpose of this invention is to provide a cytochrome P450 mutant enzyme and its application in catalyzing fatty acid hydroxylation.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A cytochrome P450 mutant enzyme, specifically CYP153A from the cytochrome P450 family. M.aq It is obtained by mutation at position 456 and at least one of the following sites: G307, D310, L303, M357, I145, V306, F455, T311, L354.

[0008] The amino acids at the following sites may be mutated to the same or different values, such as D, N, K, R, H, E, S, T, or Q. The amino acids at the following sites may be mutated to the same or different values, such as S, T, D, or E.

[0009] Furthermore, the mutant enzyme is:

[0010] CYP153A M.aq V456G / G307D (i.e., V456G / G307D), V456G / G307E, V456G / G307N, V456G / D310H, V456G / D310K, V456G / D310R, V456G / L303S, V456G / L303T, V456G / L303I, V456G / L303K, V456G / L303V, V456G / L303N, V456G / M357S, V456G / M357T, V456G / M357D, V456G / M357E, V456G / I145D, V 456G / I145E, V456G / I145S, V456G / I145T, V456G / I145Q, V456G / V306D, V456G / V306E, V45 6G / V06N, V456G / V306Q, V456G / F455S, V456G / F455T, V456G / L354S, V456G / L354T, V456G / T311R, V456G / T311H, V456G / T311K, V456G / T311D, V456G / T311E, V456G / T311Q, V456G / T 311N, V456G / L354A, V456G / L354I, V456G / L354V, V456G / L354N, V456G / L354K, V456G / L35 4C, V456G / L354H, V456G / L354F, V456G / L354M, V456G / L354Q, V456G / L354Y, V456G / L354W

[0011] Furthermore, the mutant is further mutated at at least one of the following sites, wherein the following sites are Q129, P135, S140, V141, A231, A234, T303, L304, I131, M228 and M357.

[0012] Furthermore, the mutant is obtained by mutating the mutant V456G / L354T at at least one of the following sites: Q129, P135, S140, V141, A231, A234, T303, L304, I131, M228, and M357.

[0013] The amino acids at the following sites may be mutated to the same or different F, M, I, V, A, W or L.

[0014] The amino acids at the following sites can be mutated to I, V, or F in the same or different ways.

[0015] The optimal mutant enzyme is:

[0016] CYP153A M.aq V456G / L354T / Q129W (ie, V456G / L354T / Q129W), V456G / L354T / Q129A, V456G / L354T / Q129F, V456G / L354T / Q129I, V456G / L354T / Q12 9L, V456G / L354T / Q129V, V456G / L354T / P135F, V456G / L354T / P135I, V456G / L354T / P135L, V456G / L354T / P135V, V456G / L354T / V14 1W, V456G / L354T / V141F, V456G / L354TV141L, V456G / L354T / V141M, V456G / L354T / V141I, V456G / L354T / V141A, V456G / L354T / A231 W. V456G / L354T / A231F, V456G / L354T / A231V, V456G / L354T / A231M, V456G / L354T / A231L, V456G / L354T / A234V, V456G / L354T / A234 F. V456G / L354T / A234L, V456G / L354T / A234M, V456G / L354T / A234I, V456G / L354T / T303F, V456G / L354T / T303I, V456G / L354T / T303 M, V456G / L354T / T303W, V456G / L354T / T303V, V456G / L354T / L304I, V456G / L354T / L304M, V456G / L354T / L304W, V456G / L354T / L304 F、V456G / L354T / L304V、V456G / L354T / I131F、V456G / L354T / I131I、V456G / L354T / I131V、V456G / L354T / I131M、V456G / L354T / S140 F. V456G / L354T / M228F, V456G / L354T / M228I, V456G / L354T / M228L, V456G / L354T / M228V, V456G / L354T / M357I, V456G / L354T / M357V

[0017] A recombinant expression vector comprising the aforementioned cytochrome P450 mutant enzyme.

[0018] A recombinant strain containing the cytochrome P450 mutant enzyme.

[0019] The use of the mutant enzyme, recombinant expression vector, or recombinant strain in catalyzing α-, β-, and γ-hydroxylation of fatty acids.

[0020] A method for catalytic hydroxylation of fatty acids involves adding the mutant enzyme, fatty acid, and H2O2 to a buffer solution to react and obtain α-hydroxylated fatty acid products.

[0021] That is, to obtain α-hydroxylated fatty acids and (R)-enantioselective α-hydroxylated fatty acids.

[0022] Furthermore, the system is as follows: 0.01 μM to 1 mM of mutant enzyme and 0.1 μM to 300 mM of substrate are added to a buffer solution with pH 4 to 10, and then 1 μM to 600 mM H2O2 is added. The reaction is carried out at 0℃ to 60℃ for 1 min to 24 h to achieve α-hydroxylation of the substrate.

[0023] The buffer solution is PBS buffer.

[0024] The substrate is:

[0025]

[0026] After the reaction, ethyl acetate or n-hexane is added to extract and analyze the reaction system.

[0027] Advantages of this invention:

[0028] This invention utilizes a hydrogen peroxide tunneling strategy to transport CYP153A M.aq By modifying the monooxygenase into a peroxygenase, a small CYP153A was constructed. M.aq Based on the hydrogen peroxide mutant library, and further combined with the substrate pocket engineering strategy, the fatty acid ω-hydroxylase CYP153A was introduced. M.aq Redefined as an α-hydroxylase, it simultaneously improved substrate conversion, yielding (R)-enantioselective α-hydroxy fatty acids. Furthermore, a half-scale preparation of its hydroxylated products was performed, achieving product isolation rates of up to 90%. Detailed Implementation Plan

[0029] The following examples further illustrate specific embodiments of the present invention. It should be noted that the specific embodiments described herein are merely for illustration and explanation and are not intended to limit the scope of the present invention.

[0030] This invention, based on V456G as the parent enzyme, incorporates CYP153A... M.aq peroxygenase heme active pocket A range of amino acids were mutated to polar amino acids to obtain the double mutant V456G-X. Using the hydroxylation of lauric acid as the model reaction, the optimal mutant was screened. Based on this, the CYP153A was combined with a mutant. M.aq The amino acid at the substrate channel inlet (mutated to a hydrophobic amino acid) yielded a mutant enzyme that uses H2O2 as an oxidant to catalyze the hydroxylation of fatty acids, producing α-hydroxylated fatty acids and (R)-enantioselective α-hydroxylated fatty acids. Furthermore, CYP153A... M.aq The optimal mutant of peroxygenase was used to prepare α-hydroxylated fatty acids on a semi-scale basis, with a separation yield of over 90%.

[0031] Example 1:

[0032] CYP153A M.aq Obtaining mutants:

[0033] CYP153A M.aq The wild-type enzyme has the nucleotide sequence EQ ID No. 1, based on the presence of CYP153A. M.aq The vector pET28a-CYP153A containing the wild-type gene M.aq Primer sequences for the mutation sites were designed for the vector. Then, using wild-type (or single mutant, double mutant, etc.) as templates, PCR amplification was performed using primer sequences for different mutation sites to obtain single mutants; then, using single mutants as templates, double mutants were obtained, and so on, to obtain triple mutants, quadruple mutants, etc. 1) Primers for the pET28a-V456G mutation are shown in Table 1.

[0034] Entry Primer Sequence(5'-3') 1 V456G-F GGTCGTGGCTATAGTCGTCTGATG 2 V456G-R AAAATTACTCTGAACACGTTCCGGTTC

[0035] Example 2:

[0036] 2) Based on V456G, double mutants were constructed at positions G307, D310, L303, M357, I145, V306, F455, and L354, respectively. The specific primers are shown in Table 2.

[0037]

[0038]

[0039] 3) Based on V456G / L354T, triple mutants were constructed at positions Q129, P135, V141, A231, A234, L303, L304, I131, S140, M228, and M357, respectively. The specific primers are shown in Table 3.

[0040]

[0041]

[0042]

[0043] Table 4 PCR System

[0044]

[0045]

[0046] Table 5 PCR reaction conditions

[0047] step Temperature (°C) time 1 94 5min 2 94 15s 3 57 15s 4 72 4min 5 Steps 2-4 27 cycles 6 72 10min

[0048] After the reaction, 10 μL of the PCR product was taken out and run on 0.8% agarose gel electrophoresis. After electrophoresis, it was identified under UV conditions whether it was the target band we needed. The PCR product corresponding to the target band was digested with enzymes. The enzyme digestion system is shown in Table 6.

[0049] Table 6. End-restriction enzyme digestion system for the target sequence

[0050]

[0051] The enzyme digestion program is as follows: nitrification at 37℃ for 10 min, inactivation at 80℃ for 15 min, and 4℃ at ∞.

[0052] The enzyme digests described above were then seamlessly cloned and ligated into plasmids. The ligation system is shown in Table 7.

[0053] Table 7 Connection System

[0054]

[0055] Transform 10 μL of the ligation system into E. coli DH5α competent cells, mix gently, and incubate on ice for 30 min; heat shock at 42℃ for 90 s, then incubate on ice for 5 min; add 600 μL of fresh LB liquid medium, and incubate at 37℃ with shaking at 200 rpm for 1 h; spread 200 μL of the bacterial culture onto an LB plate containing 50 μg / ml Kana, and incubate overnight at 37℃.

[0056] Once a single colony has grown on the plate, its gene sequence is determined and analyzed.

[0057] Successfully sequenced plasmids are different CYP153A plasmids. M.aq Mutant.

[0058] Example 3:

[0059] The CYP153A obtained above M.aq The double mutants participate in the α-hydroxylation of lauric acid catalyzed by H2O2, as shown in Table 8 below:

[0060] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM lauric acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0061] The reaction results are shown in Table 8:

[0062]

[0063] Reaction system: 3 μM enzyme, lauric acid: 1 mM, H2O2: 60 mM, 2% DMSO; pH 7.4 PBS, reaction time: 60 min.

[0064] As shown in Table 8, CYP153A M.aq V456G is the parent enzyme. When the amino acid at position L354 is mutated to S and T, the 100% ω-hydroxylation of lauric acid can be converted to 100% α-hydroxylation. The substrate conversion rate of the mutant L354T / V456G is 92.3% at 60 min, which indicates that the amino acid at position L354 plays a key role in regulating the regioselectivity of lauric acid.

[0065] Example 4:

[0066] To better characterize CYP153A M.aq To investigate the role of amino acid L354 in the α-hydroxylation of lauric acid in peroxygenase, we performed a saturation mutation on this site.

[0067] The CYP153A obtained above M.aq The double mutants participate in the H2O2-catalyzed α-hydroxylation of lauric acid process, as shown in Table 9 below:

[0068] The reaction system is as follows: 3 μM CYP153A M.aqThe mutant was incubated with 1 mM lauric acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0069] The reaction results are shown in Table 9:

[0070]

[0071] Reaction system: 3 μM enzyme, lauric acid: 1 mM, H2O2: 60 mM, 2% DMSO; pH 7.4 PBS, reaction time: 60 min.

[0072] Table 9 shows that when saturating the amino acid at the L354 site, the polarity or side chain size of different amino acids affected the hydroxylation of lauric acid. The mutants V456G / L354A, S, and T hydroxylated lauric acid to produce α-hydroxylauric acid with 100% selectivity.

[0073] Example 5:

[0074] The CYP153A obtained above M.aq The three mutants participate in the α-hydroxylation of lauric acid catalyzed by H2O2, as shown in Table 10 below:

[0075] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM lauric acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0076] The reaction results are shown in Table 10:

[0077]

[0078]

[0079]

[0080] Reaction system: 3 μM enzyme, lauric acid: 1 mM, H2O2: 60 mM, 2% DMSO; pH 7.4 PBS, reaction time: 60 min.

[0081] Table 10 shows that, based on V456G / L354T, the combined mutation of V456G / L354T / I131V at 60 min resulted in a substrate conversion rate of 93%, slightly higher than that of the parent enzyme V456G / L354T. However, some combined mutants catalyzed lauric acid with small amounts of α-hydroxyundecanoic acid, such as V456G / L354T / V141M, V456G / L354T / V141I, and V456G / L354T / I131V. This is detrimental to the α-hydroxylation of lauric acid and makes it prone to over-oxidation.

[0082] Example 6:

[0083] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of nonanoic acid catalyzed by H2O2, as shown in Table 11 below:

[0084] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM nonanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0085] The reaction results are shown in Table 11:

[0086]

[0087] As shown in Table 11, the V456G / L354T / V141L mutant catalyzed a substrate conversion rate of 64% for nonanoic acid, while achieving 100% α-hydroxylation.

[0088] Example 7:

[0089] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of decanoic acid catalyzed by H2O2, as shown in Table 12 below:

[0090] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM decanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0091] The reaction results are shown in Table 12:

[0092]

[0093] As shown in Table 12, the substrate conversion rate of decanoic acid catalyzed by the V456G / L354T / V141L mutant was 95%, while the V456G / L354T and V456G / L354T / Q129A mutants obtained 100% α-hydroxydecanoic acid.

[0094] Example 8:

[0095] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of undecanoic acid catalyzed by H2O2, as shown in Table 13 below:

[0096] The reaction system is as follows:

[0097] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM undecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0098] The reaction results are shown in Table 13:

[0099]

[0100]

[0101] As shown in Table 13, CYP153AM.aq The main product of undecanoic acid catalysis by peroxygenase is α-hydroxylation. Among them, the substrate conversion rate of undecanoic acid α-hydroxylation catalyzed by the V456G / L354T / V141L mutant is 90%, and the selectivity of α-hydroxyundecanoic acid is 98%.

[0102] Example 9:

[0103] The CYP153A obtained above M.aq The dominant mutants participate in the H2O2-catalyzed α-hydroxylation of tridecanoic acid, as shown in Table 14 below:

[0104] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM tridecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0105] The reaction results are shown in Table 14:

[0106]

[0107]

[0108] As shown in Table 14, the V456G / L354T / M228L mutant yielded superior α-hydroxytridecanoic acid with a selectivity of 89% and a substrate conversion rate of 74%.

[0109] Example 10:

[0110] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of tetradecanoic acid catalyzed by H2O2, as shown in Table 15 below:

[0111] The reaction system is as follows: 3 μM CYP153A M.aqThe mutant was incubated with 1 mM tetradecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0112] The reaction results are shown in Table 15:

[0113]

[0114] As shown in Table 15, the V456G / L354T / M228L mutant yielded superior α-hydroxytetradecanoic acid with a selectivity of 83% and a substrate conversion rate of 53%.

[0115] Example 11:

[0116] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of pentadecanoic acid catalyzed by H2O2, as shown in Table 16 below:

[0117] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM pentadecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0118] The reaction results are shown in Table 16:

[0119]

[0120] As shown in Table 16, the V456G / L354T / V141M mutant yielded superior α-hydroxypentadecanoic acid with a selectivity of 84% and a substrate conversion rate of 27%.

[0121] Example 12:

[0122] The CYP153A obtained aboveM.aq The dominant mutants participate in the α-hydroxylation of hexadecanoic acid catalyzed by H2O2, as shown in Table 17 below:

[0123] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM hexadecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0124] The reaction results are shown in Table 17:

[0125]

[0126]

[0127] As shown in Table 17, the V456G / L354T / V141I mutant yielded superior α-hydroxyhexadecanoic acid with a selectivity of 89% and a substrate conversion rate of 27%.

[0128] Example 13:

[0129] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of heptadecanoic acid catalyzed by H2O2, as shown in Table 18 below:

[0130] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM heptadecanoic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0131] The reaction results are shown in Table 18:

[0132]

[0133] As shown in Table 18, the V456G / L354T / V141L mutant yielded superior α-hydroxyheptadecanoic acid with a selectivity of 90% and a substrate conversion rate of 75%.

[0134] Example 14:

[0135] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of stearic acid catalyzed by H2O2, as shown in Table 19 below:

[0136] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM stearic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0137] The reaction results are shown in Table 19:

[0138]

[0139] As shown in Table 19, the V456G / L354T / A231W mutant yielded superior α-hydroxyoctadecanoic acid with a selectivity of 95% and a substrate conversion rate of 42%.

[0140] Example 15:

[0141] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of oleic acid catalyzed by H2O2, as shown in Table 20 below:

[0142] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM oleic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0143] The reaction results are shown in Table 20:

[0144]

[0145]

[0146] As shown in Table 20, the V456G / L354T / V141M and V456G / L354T / V141L mutants yielded superior α-hydroxydecanoic acid with a selectivity of 100% and substrate conversion rates of oleic acid of 25% and 24%, respectively.

[0147] Example 16:

[0148] The CYP153A obtained above M.aq The dominant mutants participate in the α-hydroxylation of linoleic acid catalyzed by H2O2, as shown in Table 21 below:

[0149] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM linoleic acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was filtered through a 0.22 μM membrane and dehydrated with anhydrous sodium sulfate. The extract was derivatized in an equal ratio with BSFTA:TMCS (99:1) in a metal bath at 75 °C for 30 min. Finally, GC analysis was performed.

[0150] The reaction results are shown in Table 21:

[0151]

[0152]

[0153] As shown in Table 21, the V456G / L354T / V141M and V456G / L354T / V141L mutants yielded superior α-hydroxydecanoic acid with a selectivity of 93% and substrate conversion rates of 41% and 34%, respectively.

[0154] Example 17:

[0155] The CYP153A obtained above M.aq The dominant mutant participates in the process of generating α-hydroxylated lauric acid (R-type product) from lauric acid using H2O2 catalysis, as shown in Table 22 below:

[0156] The reaction system is as follows: 3 μM CYP153A M.aq The mutant was incubated with 1 mM lauric acid (2% DMSO as a co-solvent) at 30 °C for 2 min. Then, 60 mM H2O2 was added to 0.5 mL of pH 7.4 PBS (50 mM). The mixture was reacted in a water bath at 30 °C for 60 min. The reaction was terminated by adding 20 μL of HCl (1 M). The mixture was then extracted with ethyl acetate (0.5 mL) for 4 min. The organic phase was passed through a 0.22 μm membrane and dehydrated with anhydrous sodium sulfate. The EA residue was dried in a fume hood, dissolved in n-hexane, and then subjected to HPLC.

[0157] The reaction results are shown in Table 22:

[0158] enzymes α-Hydroxylauric acid ee%(R) V456G / L354T / L304F 99

[0159] The results showed that the mutant V456G / L354T / L304F obtained more than 99% (R)-α-hydroxylauric acid.

[0160] As can be seen from the above embodiments, CYP153A M.aq The mutant peroxygenase converts ω-hydroxylation of lauric acid to α-hydroxylation, achieving 100% selectivity for α-hydroxylated lauric acid. Extending this system to the hydroxylation of other fatty acids (C8-C12, oleic acid, and linoleic acid), high selectivity for α-hydroxylation of fatty acids was also achieved, with 100% selectivity for α-hydroxylation of decanoic acid and a substrate conversion rate as high as 95%. Additionally, CYP153A... M.aq The peroxygenase mutant also yielded a product with superior (R)-enantioselectivity, with an (R)-enantioselectivity of α-hydroxylated lauric acid greater than 99%. This is the first report of (R)-stereoselectivity in the α-hydroxylation products of fatty acids.

[0161] Example 18:

[0162] The CYP153A obtained above M.aq The superior mutant was used to prepare α-hydroxylauric acid on a half-scale basis. α-hydroxylauric acid was prepared on a half-scale basis using V456G / L354T / L304F and obtained. The separation rate of α-hydroxylauric acid reached 90%, which indicates that the system has great potential for industrial application.

[0163] In summary, this patent, based on hydrogen peroxide tunnel engineering and combined with protein engineering strategies, rationally designed and obtained CYP153A. M.aqA mutant of the peroxygenase (V456G / L354T) can convert the ω-hydroxylation of lauric acid to α-hydroxylation, yielding a (R)-α-hydroxy product with a purity greater than 99%. Furthermore, this catalytic system can be applied to fatty acids of other chain lengths and unsaturated fatty acids (C8-C18, oleic acid, and linoleic acid). Additionally, CYP153A was selected. M.aq A semi-scale preparation was carried out using the dominant mutant of the peroxygenase (V456G / L354T / L304F), with a product isolation rate of up to 90%. This indicates that the catalytic system has the potential to regulate the hydroxylation of inactive CH4.

[0164] SEQ ID No. 1 (CYP153A) M.aq )

[0165] ATGCCGACCCTGCCGCGTACCTTTTGATGATATTCAGAGTCGTCTGATTAATGCAA

[0166] CCAGCCGTGTTGTGCCGATGCAGCGTCAGATTCAGGGTCTGAAATTTCTGATGAGT

[0167] GCCAAACGTAAAACCTTTGGCCCGCGTCGCCCGATGCCGGAATTTGTTGAAACCC

[0168] CGATTCCGGATGTGAATACCCTGGCACTGGAAGATATTGATGTTAGCAATCCGTTTC

[0169] TGTATCGCCAGGGTCAGTGGCGCGCCTATTTTAAACGCCTGCGTGATGAAGCCCCG

[0170] GTTATTATCAGAAAAATAGCCCGTTTGGTCCGTTTTGGAGCGTGACCCGTTTTGA

[0171] AGATATTCTGTTTGTTGATAAGAGCCATGATCTGTTTAGCGCAGAACCGCAGATTAT

[0172] TCTGGGTGATCCGCCGGAAGGTCTGAGTGTGGAAATGTTTATTGCAATGGACCCTC

[0173] CGAAACATGATGTGCAGCGCAGTAGCGTGCAGGGTGTTGTTGCACCGAAAAATCT

[0174] GAAAGAAATGGAAGGTCTGATTCGCAGCCGTACCGGCGATGTGCTGGATAGCCTG

[0175] CCGACCGATAAACCGTTTAATTGGGTGCCGGCAGTGAGCAAAGAACTGACCGGCC

[0176] GCATGCTGGCAACCCTGCTGGATTTTCCGTATGAAGAACGTCATAAACTGGTTGAA

[0177] TGGAGCGATCGTATGGCAGGTGCAGCCAGCGCCACCGGTGGTGAATTTGCCGATG

[0178] AAAATGCCATGTTTGATGATGCAGCCGATATGGCACGTAGTTTTAGTCGTCTGTGGC

[0179] GCGATAAAGAAGCCCGTCGTGCCGCAGGCGAAGAACCGGGTTTTGATCTGATTAG

[0180] TCTGCTGCAGAGCAATAAAGAAACCAAAGATCTGATTAACCGTCCGATGGAATTTA

[0181] TTGGCAATCTGACCCTGCTGATTGTTGGCGGCAATGATACCACCCGTAATAGCATG

[0182] AGTGGTGGCCTGGTGGCAATGAATGAATTTCCGCGCGAATTTGAAAAACTGAAAG

[0183] CCAAACCGGAACTGATTCCGAATATGGTGAGCGAAATTATTCGCTGGCAGACCCCG

[0184] CTGGCCTATATGCGCCGTATTGCAAAACAGGATGTTGAACTGGGTGGCCAGACCAT

[0185] TAAAAAAGGTGATCGCGTTGTTATGTGGTATGCCAGCGGTAATCGTGATGAACGTA

[0186] AATTTGATAATCCGGATCAGTTTATTATCGATCGCAAAGATGCACGTAATCATATGAG

[0187] TTTTGGCTATGGTGTTCATCGCTGTATGGGCAATCGCCTGGCCGAACTGCAGCTGC

[0188] GTATTCTGTGGGAAGAAATTCTGAAACGCTTTGATAATATCGAAGTTGTTGAAGAA

[0189] CCGGAACGTGTTCAGAGTAATTTTGTGCGTGGCTATAGTCGTCTGATGGTTAAACT

[0190] GACCCCGAATAGT

Claims

1. A cytochrome P450 mutant enzyme, characterized in that: The mutant enzyme is CYP153A from the cytochrome P450 family. M.aq It is obtained by mutation at position 456 and at least one of the following sites: G307, D310, L303, M357, I145, V306, T311, F455, L354.

2. The cytochrome P450 mutant enzyme according to claim 1, characterized in that: The amino acids at the following sites may be mutated to the same or different values ​​as D, N, K, R, H, E, S, T, or Q.

3. The cytochrome P450 mutant enzyme according to claim 2, characterized in that: The amino acids at the following sites can be mutated to the same or different S, T, D or E.

4. The cytochrome P450 mutant enzyme according to any one of claims 1-3, characterized in that: The mutant is further mutated at at least one of the following sites, wherein the following sites are Q129, P135, S140, V141, A231, A234, T303, L304, I131, M228 and M357.

5. The cytochrome P450 mutant enzyme according to claim 4, characterized in that: The amino acids at the following sites may be mutated to the same or different F, M, I, V, A, W or L.

6. The cytochrome P450 mutant enzyme according to claim 5, characterized in that: The amino acids at the following sites can be mutated to I, V, or F in the same or different ways.

7. A recombinant expression vector comprising the cytochrome P450 mutant enzyme of claim 1.

8. A recombinant strain comprising the cytochrome P450 mutant enzyme of claim 1.

9. An application as described in claim 1, 5, or 6, characterized in that: The application of the mutant enzyme, recombinant expression vector, or recombinant strain in catalyzing fatty acid α-hydroxylation.

10. A method for catalytic hydroxylation of fatty acids, characterized in that: The mutant enzyme described in claim 1, fatty acid, and H2O2 are added to a buffer solution and reacted to obtain the fatty acid α-hydroxylated product.

Images