Application of OsEPSPS-M gene in cultivation of transgenic herbicide-resistant sugarcane

By transgenic modification of the OsEPSPS-M gene, sugarcane has acquired high tolerance to glyphosate and glufosinate, solving the problem of sugarcane varieties lacking herbicide tolerance traits and improving sugarcane production efficiency and sustainable development.

CN120866355APending Publication Date: 2025-10-31SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511387589.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-26
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Existing sugarcane varieties lack glyphosate tolerance traits, leading to reliance on manual labor for weed control in the field and a lack of dedicated selective herbicides, which affects sugarcane production efficiency and sustainable development.

Method used

Transgenic modification was performed using the OsEPSPS-M gene to construct a vector containing OsEPSPS-M, the maize ubiquitin promoter Ubiquitin, the Agrobacterium carmine synthase terminator nos, the Bar gene, etc., to achieve high-efficiency tolerance of sugarcane to glyphosate and glufosinate. The gene was stably expressed in sugarcane through Agrobacterium-mediated genetic transformation technology.

Benefits of technology

It imparts four times the tolerance of sugarcane to medium doses of glyphosate and glufosinate, reducing herbicide use, lowering the difficulty of weed control, and improving sugarcane production efficiency and industrialization level, while not affecting the normal growth and agronomic traits of sugarcane.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866355A_ABST
    Figure CN120866355A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of molecular biology, and particularly relates to application of an OsEPSPS-M gene to cultivation of transgenic herbicide-resistant sugarcane. According to the EPSPS gene mutant disclosed by the invention, stable quadruple medium-dose glyphosate tolerance can be given to a receptor plant. The invention further provides an optimized vector containing the OsEPSPS-M gene, two herbicide-resistant genes can be efficiently expressed at the same time, tolerance of two target herbicides is endowed to sugarcane crops, weed control is carried out by matching with a compound herbicide, the herbicide controlling spectrum is expanded, an important way is provided for cultivating sugarcane varieties matched with the compound herbicide, and the method is worthy of popularization and application. The cultivation of new sugarcane varieties and the improvement of germplasm resources are facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the application of an OsEPSPS-M gene in the cultivation of transgenic herbicide-tolerant sugarcane. Background Technology

[0002] Herbicide-tolerant genetically modified (GM) crops are currently the most commercially available type of GM crop. Their cultivation allows for the use of herbicides, improving weed control efficiency, reducing weeding costs, and facilitating more precise and rational herbicide application, thus reducing the amount of herbicide used. Currently, herbicide-tolerant GM crops are widely used and have become one of the major types of GM crops. Herbicide tolerance has become a key characteristic of GM soybeans, rapeseed, corn, alfalfa, and other crops. As of 2019, approximately 88% of GM crops planted globally possessed herbicide tolerance traits.

[0003] Glyphosate-tolerant transgenic crops are the most widely used type of herbicide-tolerant transgenic crops. The target enzyme of glyphosate, 5-enolpyruvate-shikimate 3-phosphate synthase (EPSPS), is widely found in bacteria, fungi, algae, and higher plants. It is a key enzyme in the shikimate pathway for the synthesis of aromatic amino acids (including tryptophan, phenylalanine, and tyrosine), and is also the target enzyme of the widely used non-selective herbicide glyphosate. After application to plants, glyphosate can rapidly penetrate the cuticle and be translocated within the plant, specifically inhibiting the synthesis of 5-enolpyruvate-shikimate 3-phosphate. This leads to the inhibition of cladonic acid production, interruption of aromatic amino acid biosynthesis, and ultimately plant death (Li et al., Weed Science, 2005, 53(2): 153-159). Based on the mechanism of action of glyphosate, plants can be endowed with glyphosate tolerance by introducing glyphosate-insensitive mutant EPSPS genes obtained through artificial mutagenesis, artificial synthesis, or natural selection. This strategy has been widely used in agricultural production and has become the main technical approach for developing glyphosate-tolerant transgenic crops. Therefore, there is a significant need in the field of crop breeding to develop new and more efficient glyphosate-tolerant EPSPS gene mutants. The application of such new genes can help increase crop yields, simplify field management, and promote sustainable agricultural development.

[0004] Sugarcane (Saccharum spp. hybrid) is an important tropical and subtropical crop. As a major global sugar and bioenergy crop, it has significant application value in the production of ethanol and various natural compounds. Weeds are one of the most significant limiting factors in sugarcane production. Weeds compete with sugarcane for water, nutrients, and sunlight, inhibiting normal growth. Simultaneously, weeds provide suitable hosts for various pests and diseases, increasing the risk of pest and disease outbreaks and further threatening sugarcane growth, development, and yield. Traditional sugarcane breeding focuses on screening for high-yield and high-sugar traits, with insufficient attention paid to herbicide tolerance. This has resulted in a lack of herbicide-tolerant sugarcane varieties. Field weed control still relies mainly on manual labor, and there is a lack of dedicated selective herbicides. The industry urgently needs to develop herbicide-tolerant vectors adapted to sugarcane, especially glyphosate-tolerant genetic transformation vectors.

[0005] Developing transgenic crops with glyphosate-resistant traits, and using them in combination with multiple herbicides, can effectively enhance weed control in the field and reduce the risk of herbicide-resistant mutations spreading in weeds due to long-term single-herbicide selection. Developing mutant EPSPS genes for sugarcane genetic transformation can meet the urgent needs of the sugarcane planting industry, providing significant support for increasing production, reducing costs, and improving efficiency. Summary of the Invention

[0006] This invention provides an application of the OsEPSPS-M gene in the breeding of transgenic herbicide-tolerant sugarcane.

[0007] The technical solution of this invention is implemented as follows: The first aspect of this invention is to provide a novel, highly efficient herbicide-resistant mutant gene OsEPSPS-M, the nucleotide sequence of which is shown in SEQ ID NO:1 and the amino acid sequence of which is shown in SEQ ID NO:2.

[0008] A second aspect of the present invention is to provide a novel protein encoded by the highly efficient herbicide-resistant mutant gene OsEPSPS-M, the amino acid sequence of which is shown in SEQ ID NO:2.

[0009] A third aspect of the present invention is to provide a vector, host bacterium, or kit containing the mutant gene OsEPSPS-M described in the first aspect of the present invention.

[0010] The fourth aspect of this invention is to provide the application of the mutant gene OsEPSPS-M described in the first aspect of this invention, or the protein described in the second aspect of this invention, or the vector, host bacteria, or kit described in the third aspect of this invention in the cultivation of glyphosate-resistant sugarcane.

[0011] The fifth aspect of this invention is to provide the application of the mutant gene OsEPSPS-M described in the first aspect of this invention, or the protein described in the second aspect of this invention, or the vector, host bacteria, or kit described in the third aspect of this invention in the cultivation of glyphosate-resistant sugarcane without affecting the chlorophyll content, plant height, single plant dry weight, biomass, and / or calorie content of the sugarcane.

[0012] The sixth aspect of the present invention is to provide the application of the mutant gene OsEPSPS-M described in the first aspect of the present invention, or the protein described in the second aspect of the present invention, or the vector, host bacteria, or kit described in the third aspect of the present invention in improving the glyphosate tolerance of sugarcane.

[0013] The seventh aspect of this invention is to provide the application of the mutant gene OsEPSPS-M described in the first aspect of this invention, or the protein described in the second aspect of this invention, or the vector, host bacteria, or kit described in the third aspect of this invention in improving the glyphosate tolerance of sugarcane without affecting the chlorophyll content, plant height, single plant dry weight, biomass, and / or calorie content of sugarcane.

[0014] The eighth aspect of this invention provides a vector for efficiently expressing the mutant gene OsEPSPS-M in sugarcane. The vector backbone is pBWA(V)BU, and further includes the maize ubiquitin promoter Ubiquitin, the Agrobacterium carmine synthase terminator nos, a screening marker for the phosphoramidase Bar gene, the cauliflower mosaic virus 35S promoter CaMV 35S, and the cauliflower mosaic virus mRNA 3' tailing signal CaMV poly(A) signal, all required for Bar gene expression. The Ubiquitin promoter sequence is shown in SEQ ID NO:4; the nos terminator sequence is shown in SEQ ID NO:5; the Bar gene sequence is shown in SEQ ID NO:3; the CaMV 35S promoter sequence is shown in SEQ ID NO:6; and the CaMV poly(A) signal sequence is shown in SEQ ID NO:7.

[0015] A ninth aspect of the invention is to provide the use of the carrier described in the eighth aspect of the invention in the cultivation of herbicide-resistant sugarcane.

[0016] The tenth aspect of the present invention is to provide the application of the carrier described in the eighth aspect of the present invention in the cultivation of herbicide-tolerant sugarcane without affecting the chlorophyll content, plant height, dry weight per plant, biomass and / or succulence of the sugarcane.

[0017] The eleventh aspect of the present invention is to provide the application of the carrier described in the eighth aspect of the present invention in improving the herbicide tolerance of sugarcane.

[0018] The twelfth aspect of the present invention is to provide the application of the carrier described in the eighth aspect of the present invention in improving the herbicide tolerance of sugarcane without affecting the chlorophyll content, plant height, dry weight per plant, biomass and / or calorific value of sugarcane.

[0019] Furthermore, the herbicide is glyphosate and / or glufosinate.

[0020] The thirteenth aspect of this invention is to provide the use of the mutant gene OsEPSPS-M described in the first aspect of this invention, or the vector, host bacterium, or kit described in the second aspect of this invention, or the vector described in the fifth aspect of this invention, in any of the following: (1) Application in the preparation of genetically modified sugarcane; (2) Application in the improvement of sugarcane germplasm resources.

[0021] The beneficial effects of this invention are reflected in: This invention provides a novel glyphosate-tolerant EPSPS gene mutant that confers stable four-fold tolerance to medium-dose glyphosate in recipient plants, facilitating the development and cultivation of novel herbicide-tolerant crops. Secondly, the OsEPSPS-M gene described in this invention is a plant-derived mutant gene, avoiding the introduction of distantly related genes into recipient plants and reducing concerns about the safety of transgenic crops. Thirdly, this invention provides an optimized vector containing the OsEPSPS-M gene, achieving stable and efficient expression of the herbicide-tolerant gene in sugarcane, enabling transgenic sugarcane to acquire more than four times the tolerance to medium-dose herbicides, ensuring compliance with industrial-scale planting and application standards. Fourthly, this invention breaks through the genetic resources available for cultivating herbicide-tolerant sugarcane, creating a new glyphosate-tolerant trait in sugarcane, contributing to improved efficiency and cost reduction in sugarcane production, providing a new approach for the cultivation of herbicide-tolerant sugarcane varieties, and offering new candidate genes for the preparation of transgenic sugarcane and the improvement of sugarcane germplasm.

[0022] Furthermore, the vector in this invention can simultaneously and efficiently express two herbicide-tolerant genes, conferring tolerance to two target herbicides on sugarcane crops. This allows for the adaptation to compound herbicides for weed control, expanding the weed control spectrum, achieving better weed control effects, slowing the development and spread of herbicide tolerance, and reducing the difficulty of weed control during sugarcane cultivation. This provides a foundation for the industrialization and large-scale development of the sugarcane planting industry. Simultaneously, while conferring tolerance to two target herbicides on sugarcane crops, this invention does not affect the main agronomic traits of sugarcane or its normal growth. It provides an important pathway for breeding sugarcane varieties adapted to compound herbicides, which is beneficial for the breeding of new sugarcane varieties and the improvement of germplasm resources. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 The nucleotide sequences of the mutant gene OsEPSPS-M and the rice EPSPS gene are compared. The nucleotides marked in the boxes are the mutation sites of OsEPSPS-M compared to the rice EPSPS gene.

[0025] Figure 2 The amino acid sequence encoded by the OsEPSPS-M gene is shown in the box. The amino acids marked in the box are the mutation sites of the amino acids encoded by the OsEPSPS-M gene compared to those encoded by the rice EPSPS gene.

[0026] Figure 3 This is a schematic diagram of the T-DNA structure of the herbicide-tolerant sugarcane vector transfected with the OsEPSPS-M gene. LB represents the left boundary of the T-DNA; CaMV poly(A) Signal represents the 3' tailing signal of the cauliflower mosaic virus mRNA; Bar represents the phosphoramidase-encoding marker gene; CaMV 35s represents the cauliflower mosaic virus 35S promoter; Ubi represents the maize ubiquitin promoter; OsEPSPS-M represents an artificially modified rice EPSPS gene mutant; TNOS represents the Agrobacterium carmine synthase terminator; RB represents the right boundary of the T-DNA. Detailed Implementation

[0027] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0028] Example 1

[0029] Construction of OsEPSPS-M gene plant expression vector 1. Artificially synthesized genes To construct a herbicide-tolerant vector transgenic OsEPSPS-M, the rice EPSPS mutant gene OsEPSPS-M was artificially synthesized. Its nucleotide sequence is shown in SEQ ID NO:1 (the terminal tga is a stop codon). This gene sequence was based on the artificially synthesized endogenous EPSPS in rice, and the glyphosate binding region sequence was optimized. Figure 1As shown, compared to the rice EPSPS gene, its nucleotide sequence exhibits mutations at positions 392 (C to G), 515-516 (GA to CG), 529 (C to T), 531 (A to C), 821 (A to G), 931 (A to C), and 1208 (T to C). Correspondingly, the encoded amino acid residues show mutations at positions 131 (A to G), 172 (G to A), 177 (P to S), 274 (K to R), 311 (K to Q), and 403 (V to A), thus acquiring glyphosate insensitivity. Using a plant transformation vector, this gene was transferred into sugarcane and expressed efficiently, resulting in four times the tolerance to medium-dose glyphosate herbicides.

[0030] Using the synthesized product as a template, a 50 μL system was prepared for amplification.

[0031] Nuclease-free Water 20 μL Biorun Pfu PCR Mix 25 μL Primer- E10214_0S1(+) 2 μL Primer- E10214_0S1(-) 2 μL DNA template 1 μL total 50 μL

[0032] Primer E10214_0S1(+): ggtgttacttctgttgcaacatggcggcgaccatggcg; Primer E10214_0S1(-): tgaagacagagctagttacatcagttcctgacgaaagtgcttagaacg. Amplification conditions are as follows: 94℃ 5 min 94℃ 30 s 50℃ 45 s 72℃ 93 s Go to step 2 for 32 cycles 72℃ 10 min 16℃ 5 min The OsEPSPS-M gene band (1548 bp) was cut and recovered under UV light using 1% agarose gel electrophoresis at 5 V / cm for 20 minutes. The product was then recovered by gel electrophoresis according to the kit instructions (rDNA E1). After sequencing confirmed that the product was correct, it was recombined with the vector.

[0033] 2. Construct a complete T-DNA expression vector The vector backbone pBWA(V)BU was digested with Eco31I (BsaI) in the following reaction system: Nuclease-free Water 13 μL 10*Buffer 2 μL BsaI / Eco31I 1 μL pBWA(V)BU 4 μL total 20 μL The reaction conditions were 37℃ for 1 h.

[0034] The vector enzyme digestion products were purified using a PCR purification kit and then used for the recombination reaction. The reaction system was as follows: Biorun 2*EasyClone Mix 10 μL OsEPSPS-M gene synthesis amplification product 5 μL pBWA(V)BU vector digestion product 5 μL total 20 μL The ligation reaction was carried out at 37°C for 30 h to obtain the T-DNA vector ( Figure 3(As shown). The vector backbone of this invention is pBWA(V)BU (provided by Wuhan Boyuan Biotechnology, based on the vector sequence modified by Cambia, http: / / www.cambia.org / daisy / cambia / 585), and also includes the maize ubiquitin promoter Ubiquitin, Agrobacterium carmine synthase terminator nos required for OsEPSPS-M expression, the phosphoramidase Bar gene as a screening marker, the cauliflower mosaic virus 35S promoter CaMV 35S required for Bar gene expression, the cauliflower mosaic virus mRNA 3' end tailing signal CaMVpoly(A) signal, and other elements necessary for transformation and expression.

[0035] Example 2

[0036] Obtaining genetically modified herbicide-tolerant sugarcane 1. High-quality embryogenic callus induction: The recipient sugarcane variety ROC22 (New Taiwan Sugar 22) was detoxified using a virus-free process to obtain virus-free seedlings, which were then planted in greenhouses or in virus-free environments. After 4-6 months, young leaf tissue from the apical meristem of healthy sugarcane plants was collected as explants. After sterilization with alcohol and mercuric chloride, the tissue was cut into thin slices approximately 1 mm thick and cultured in a callus induction medium at 28°C in the dark. The callus induction medium was changed approximately every 14 days until embryogenic callus was obtained. The callus induction medium was based on B5 medium, with the addition of 20-30 g / L sucrose, 2 mg / L 2,4-D, 1 mg / L 6-BA, 7-9 g / L Phytoblend, and a pH of 5.8, depending on the recipient variety.

[0037] 2. Preparation of Agrobacterium-mediated bacterial culture: Add 1 μg of purified plasmid DNA to Agrobacterium EHA105 competent cells (thawed on ice), mix well, and incubate on ice for 5 min. Then, flash freeze in liquid nitrogen for 5 min, immediately heat shock at 37°C for 5 min, add 800 μL of YEP (antibiotic-free) liquid medium, and incubate at 28°C with gentle shaking for 2 h. Centrifuge, remove part of the supernatant, resuspend the cells in the remaining 400 μL of bacterial solution, spread on YEP plates with the appropriate antibiotics, incubate at 28°C for 48 h, pick single colonies and shake to activate, obtaining Agrobacterium containing the target T-DNA vector.

[0038] Agrobacterium containing the target T-DNA vector was removed from a -80°C ultra-low temperature freezer and streaked onto solid YEP plates until single colonies grew. Single colonies were picked and cultured overnight in liquid YEP medium with shaking. Molecular identification of the Agrobacterium suspension was performed during this period, including PCR detection of the target gene and vector selection marker gene on the plasmid vector to confirm the accuracy of the plasmid and the bacterial suspension. Agrobacterium cells were collected by centrifugation at 5000 rpm / min and cultured in starter medium for 1-2 hours to obtain the genetically engineered bacterial suspension. Before transformation, the engineered bacterial suspension was adjusted to OD using starter medium. 600 The pH was 0.3-0.6. YEP medium was based on enrichment YEP medium, with appropriate antibiotics added according to the plasmid vector resistance, such as Kan 50 mg / L, and 200-300 μmol / L acetosyringone added, pH 7.0. Solid YEP medium was supplemented with 15 g / L agar. The starter medium was 1 / 10 B5 liquid basal medium with 30 g / L sucrose and 30 g / L glucose added, and 200-300 μmol / L acetosyringone added, pH 5.2. Agrobacterium was cultured in the dark at 28℃.

[0039] 3. Transformation of embryogenic callus with Agrobacterium-mediated bacterial culture: Collect sugarcane embryogenic callus to be transformed into 90 mm culture dishes lined with absorbent sterile filter paper, 3-4 g of embryogenic callus per dish. Air-dry in a laminar flow hood until the surface of the embryogenic callus shrinks slightly. Transfer the air-dried embryogenic callus to Erlenmeyer flasks, pour in the prepared Agrobacterium-mediated transformation solution, and incubate at 100 rpm / min with low-speed shaking in the dark at 28°C for 10 min. Transfer to a 150W ultrasonic cleaner and sonicate at maximum power for 2 min. Replace with fresh Agrobacterium-mediated transformation solution and vacuum treat in a vacuum chamber at 0.1 MPa for 5 min, then incubate at 100 rpm / min with low-speed shaking in the dark at 28°C for 10 min. Decant the embryogenic callus, aspirate the Agrobacterium-mediated transformation solution, and transfer to co-culture medium for incubation at 21°C in the dark for 2-3 days. The co-culture medium was 1 / 10 B5 liquid basal medium supplemented with 30 g / L sucrose, 2.0 mg / L 2,4-D, 200 μmol / L acetylsyringone, 9 g / L Phytoblend, and pH 5.8.

[0040] 4. Screening of resistant plants: The screening procedure for resistant plants is as follows: After co-culture, embryogenic callus tissue was transferred to recovery medium and cultured in the dark at 28°C for 7 days; then transferred to embryogenic callus screening medium and cultured in the dark at 28°C for 30 days; after screening, the embryogenic callus tissue was transferred to differentiation screening medium for 40 days (1500-2100 lux 14h / d, 30-35°C during the day and 28-30°C at night), with the differentiation screening medium changed once during this period. When changing the differentiation medium, only the best-growing shoots from each callus cluster were selected; the differentiated shoots were transferred to rooting screening medium for 40 days (culture conditions same as differentiation culture), with the rooting medium changed once during this period. When changing the rooting medium, only the strongest plants from the center of the cluster were selected for rooting culture. Finally, lateral shoots were removed to form single-plant culture, thus completing the resistant plant screening culture.

[0041] The recovery medium was B5 medium supplemented with 20 g / L sucrose, 300 mg / L ticarcillin (Timentin), 2 mg / L 2,4-D, 1 mg / L 6-BA, 9 g / L plant gel, and pH 5.8. The embryogenic callus screening medium was B5 medium supplemented with 20 g / L sucrose, 300 mg / L ticarcillin, 2 mg / L 2,4-D, 1 mg / L 6-BA, and 9 g / L plant gel, with an additional 1.0-3.0 mg / L glufosinate for Bar marker gene screening. The differentiation screening medium was B5 medium supplemented with 20 g / L sucrose, 300 mg / L ticarcillin, 2 mg / L 6-BA, and 6 g / L plant gel. The method of adding resistance screening agents was the same as that of differentiation screening medium. The rooting selection medium was B5 medium supplemented with 20 g / L sucrose, 300 mg / L ticarcillin, 2 mg / L NAA, and 6 g / L plant gel.

[0042] 5. Rapid identification of resistant plants: Each rooted resistant plant was numbered, and approximately 20 mg of leaf tissue was extracted and placed in a 1.5 ml centrifuge tube. The leaf juice was extracted using the conical plastic grinder provided in the Bar gene protein test strip rapid detection kit, and extraction buffer was added. The centrifuge tube was inverted to mix, and the test strip was inserted. The test results were observed after 1 minute. Plants testing positive were identified as transgenic plants. After screening and identification, a successfully transformed resistant sugarcane line was obtained and named ZR5. Subsequent glyphosate herbicide tolerance experiments were conducted.

[0043] Example 3

[0044] Herbicide tolerance test of genetically modified sugarcane 1. Experimental sugarcane varieties: The transgenic sugarcane used in this experiment were two herbicide-tolerant transformants, ZR5-1 and ZR5-5, which were infused with the OsEPSPS-M and Bar genes, respectively. The control was the non-transgenic parental material ROC22 (New Taiwan Sugar 22).

[0045] Approximately 40 days after planting each sugarcane seedling, leaf tissues of the genetically modified sugarcane parent were collected during the seedling stage. Total RNA was extracted using the B518631 Plant RNA Rapid Extraction Kit from Sangon Biotech (Shanghai) Co., Ltd., and cDNA templates were obtained by reverse transcription using the B300545 RevertAid RT Reverse Transcription Kit from Sangon Biotech (Shanghai) Co., Ltd., following the instructions.

[0046] Primers for real-time PCR were designed targeting OsEPSPS-M and the standard qSuGAPDH gene in sugarcane. The sequences are as follows: qOsEPSPS-F3:ATGCTTGAGGCCCTGAAAGGC qOsEPSPS-R3:CGACAACCAAGTCACCAATCG qSuGAPDH-F:CACGGGCCACTGGAAGCA qSuGAPDH-R:TCCTCAGGGTTCCTGATGCC The quantitative PCR amplification system was prepared using the NovoStart Taq SYBR® Green qPCR Premix antibody-based real-time PCR kit. The reaction system is as follows: Taq SYBR® Green qPCR Premix 10 μL Pre-primer (10 μM) 0.4 μL Post-primer (10 μM) 0.4 μL cDNA template 1 μL Nuclease-Free Water 8.2 μL total 20 μL The reaction procedure is as follows: 95℃ 30 min 95℃ 10 s 58℃ 10 s 72℃ 30 s Go to step 2 for 40 cycles 95℃ 15 s 60℃ 1 min 95℃ 30 s 60℃ 15 s The test results showed that the relative expression level of the OsEPSPS-M gene in the ZR5-1 line was 2672.0, and the relative expression level of the OsEPSPS-M gene in the ZR5-5 line was 16165.3. These transgenic sugarcane lines can efficiently express the OsEPSPS-M gene.

[0047] 2. Glyphosate herbicide tolerance test in genetically modified sugarcane: Genetically modified sugarcane and non-genetically modified parent sugarcane were sprayed directly onto the leaves during the elongation stage (approximately 4 months after planting) with 200 ml / mu (1x medium dose), 400 ml / mu (2x medium dose), and 800 ml / mu (4x medium dose) of a 41% glyphosate isopropylamine salt aqueous solution (Roundup). ®(Monsanto product), after 7 days, the growth and development of sugarcane plants, as well as the damage and mortality of the herbicide, were recorded, and the glyphosate tolerance of the transgenic sugarcane was determined. The results are shown in Table 1.

[0048] Table 1. Phytotoxicity of different sugarcane samples after 7 days of application of different glyphosate doses.

[0049] The results showed that the two sugarcane transformants, ZR5-1 and ZR5-5, transformed with the OsEPSPS-M and Bar gene vectors, exhibited strong tolerance to glyphosate herbicide. They showed good tolerance even when subjected to 800 ml / mu (4 times the medium dose) of 41% glyphosate isopropylamine salt aqueous solution (Roundup). ® In the case of Monsanto products, no significant phytotoxic effects were observed.

[0050] 3. Tests on tolerance of transgenic sugarcane to glufosinate-ammonium herbicide: Genetically modified sugarcane and non-genetically modified parent sugarcane were sprayed directly onto the leaves during the elongation stage (approximately 4 months after planting) with 250 ml / mu (1x medium dose), 500 ml / mu (2x medium dose), and 1000 ml / mu (4x medium dose) of 18% glufosinate-ammonia soluble concentrate (Baoshida). ® (Bayer product), and after 10 days, the growth and development of sugarcane plants, as well as the damage and mortality of the herbicide, were recorded. The glufosinate tolerance of the transgenic sugarcane was determined, and the results are shown in Table 2.

[0051] Table 2. Phytotoxicity of different sugarcane samples 10 days after application of different glyphosate doses.

[0052] The results showed that the two sugarcane transformant lines ZR5-1 and ZR5-5, transformed by the OsEPSPS-M and Bar gene vectors, had strong tolerance to glufosinate-ammonium herbicide. They did not show significant phytotoxic effects when treated with 1000 ml / acre of 4 times the medium dose of 18% glufosinate-ammonium soluble concentrate (Promethazine®, Bayer product).

[0053] In sugarcane cultivation, commercially available herbicide-tolerant materials are generally required to withstand four times the recommended dose. Therefore, the transgenic sugarcane described in this invention, simultaneously incorporating the OsEPSPS-M and Bar genes, showed no significant phytotoxicity even at four times the recommended dose of glufosinate and glyphosate. This meets the requirements for herbicide-tolerant varieties in sugarcane cultivation and provides subsequent materials for the breeding of herbicide-tolerant sugarcane varieties.

[0054] Example 4

[0055] Comparison of resistance to glyphosate and glufosinate in different genetically modified sugarcane samples Experimental sugarcane strains: The transgenic sugarcane strains used in this experiment were the transformant strains introduced with OsEPSPS-M, the transformant strains introduced with wild-type rice OsEPSPS gene, the transformant strains introduced with OsEPSPS-M and Bar genes (ZR5-1), the transformant strains introduced with OsEPSPS gene, and the transformant strains introduced with Bar gene.

[0056] The sugarcane materials were planted for about 4 months, during the elongation period, and glyphosate and glufosinate resistance were tested according to the method in Example 2. The results are shown in Tables 3-4.

[0057] Table 3. Phytotoxicity of different sugarcane samples after 7 days of application of different glyphosate doses.

[0058] Table 4. Phytotoxicity of different sugarcane samples 10 days after application of different glufosinate doses.

[0059] In Tables 3 and 4, the introduction of the wild-type OsEPSPS gene resulted in mild phytotoxicity in sugarcane at a glyphosate dosage of 400 ml / mu, and moderate phytotoxicity at a dosage of 800 ml / mu. Simultaneous introduction of OsEPSPS-M and Bar resulted in sugarcane tolerance to glyphosate similar to that of either the wild-type OsEPSPS gene or OsEPSPS-M alone. This indicates that the OsEPSPS-M gene in this invention can enhance the tolerance of transgenic sugarcane to glyphosate, with a significantly improved effect compared to the wild-type OsEPSPS gene. Furthermore, the simultaneous introduction of OsEPSPS-M and Bar into sugarcane improved tolerance to both glyphosate and glufosinate, endowing sugarcane with tolerance to two target herbicides, enabling the use of compound herbicides for weed control during sugarcane cultivation.

[0060] Example 5

[0061] Comparison of the effects of different genetically modified sugarcane samples on sugarcane growth Experimental sugarcane lines: The transgenic sugarcane lines used in this experiment were: a transgenic line incorporating OsEPSPS-M, a transgenic line incorporating the wild-type rice OsEPSPS gene, a transgenic line incorporating both OsEPSPS-M and Bar genes (ZR5-1), a transgenic line incorporating the OsEPSPS gene, and a transgenic line incorporating the Bar gene. The recipient for all of the above materials was ROC22 (New Taiwan Sugar 22).

[0062] Ten sugarcane plants were selected from each of the above materials. The chlorophyll content of the leaves was measured during the elongation period, and the plant height, dry weight per plant, biomass and slenderness were measured during the maturity period.

[0063] The chlorophyll content was measured using a spectrophotometer. Specifically, approximately 1 g of sugarcane leaf tissue was collected, weighed, and then homogenized with an equal weight of pure water. 0.5 g of the homogenate was weighed and mixed with 10 mL of the extraction solvent (1:1 ethanol-acetone solution). The mixture was allowed to stand at room temperature in the dark for 5 h before filtration. The absorbance was measured at wavelengths of 645 nm and 663 nm, using the extraction solvent as a blank zero point.

[0064] The total chlorophyll content of the sample is: ω = (8.05 × A 1 +20.29× A 2 )× ν / (1000× m ) in ω —Total chlorophyll content, in mg / g; A 1 —The absorbance of the test solution at 663 nm; A 2 —The absorbance of the test solution at 663 nm; ν —The volume of the test solution, in mL; m —Sample volume, in grams.

[0065] Table 5. Effects of different transgenic sugarcane samples on sugarcane growth

[0066] Sugarcane varieties Transgenic OsEPSPS-M Genetically modified OsEPSPS Genetically modified OsEPSPS-M+Bar Genetically modified OsEPSPS+Bar Genetically modified Bar Plant height (m) 333±32 a 320±31 a 330±29 a 326±22 a 315±27 a Biomass (kg) 2.17±0.11 a 2.17±0.13 a 2.11±0.21 a 2.15±0.16 a 2.07±0.12 a Hammer strength (%) 19.95±1.07 a 19.61±0.99 a 19.48±0.72 a 19.91±0.83 a 19.21±0.84 a Chlorophyll content 2.17±0.35 a 2.06±0.49 a 2.01±0.42 a 2.04±0.37 a 2.03±0.36 a Note: Error is standard deviation (SD), and 'a' represents the Duncan test for homogeneous subsets.

[0067] The results showed that transgenic OsEPSPS-M, transgenic OsEPSPS, transgenic OsEPSPS-M+Bar, transgenic OsEPSPS+Bar, and transgenic Bar genes did not have a significant impact on the main agronomic traits of sugarcane.

[0068] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A novel, highly efficient herbicide-resistant mutant gene, OsEPSPS-M, characterized in that, Its nucleotide sequence is shown in SEQ ID NO:

1.

2. A protein encoded by a novel, highly efficient herbicide-resistant mutant gene, OsEPSPS-M, characterized in that, Its amino acid sequence is shown in SEQ ID NO:

2.

3. A vector, host bacterium, or kit containing the mutant gene OsEPSPS-M as described in claim 1.

4. The application of the mutant gene OsEPSPS-M as described in claim 1, or the protein as described in claim 2, or the vector, host bacteria, or kit as described in claim 3 in cultivating glyphosate-resistant sugarcane and / or improving the glyphosate resistance of sugarcane.

5. The application of the mutant gene OsEPSPS-M as described in claim 1, or the protein as described in claim 2, or the vector, host bacteria, or kit as described in claim 3 in cultivating glyphosate-resistant sugarcane and / or improving the glyphosate resistance of sugarcane, without affecting the chlorophyll content, plant height, single plant dry weight, biomass, and / or calorie content of sugarcane.

6. A vector for efficiently expressing the mutant gene OsEPSPS-M of claim 1 in sugarcane, characterized in that, The vector backbone is pBWA(V)BU, and also includes the maize ubiquitin promoter Ubiquitin required for OsEPSPS-M expression, the Agrobacterium carmine synthase terminator nos, the screening marker phosphoramidase Bar gene, the cauliflower mosaic virus 35S promoter CaMV 35S required for Bar gene expression, and the cauliflower mosaic virus mRNA 3' tailing signal CaMV poly(A) signal; the Ubiquitin promoter sequence is shown in SEQ ID NO:4; the nos terminator sequence is shown in SEQ ID NO:5; the Bar gene sequence is shown in SEQ ID NO:3; the CaMV 35S promoter sequence is shown in SEQ ID NO:6; and the CaMV poly(A) signal sequence is shown in SEQ ID NO:

7.

7. The application of the carrier as described in claim 6 in cultivating herbicide-tolerant sugarcane and / or improving the herbicide tolerance of sugarcane.

8. The application of the carrier as described in claim 6 in cultivating herbicide-tolerant sugarcane and / or improving the herbicide tolerance of sugarcane, without affecting the chlorophyll content, plant height, dry weight per plant, biomass and / or calorie content of sugarcane.

9. The application as described in claim 7 or 8, wherein the herbicide is glyphosate and / or glufosinate.

10. The use of the mutant gene OsEPSPS-M as described in claim 1, or the protein as described in claim 2, or the vector, host bacterium, or kit as described in claim 3, or the vector as described in claim 6, in any of the following: (1) Application in the preparation of genetically modified sugarcane; (2) Application in the improvement of sugarcane germplasm resources.

Citation Information

Patent Citations

  • Herbicide resistance gene expression vector and application thereof

    CN112626111A

  • Efficient sugarcane transgenic method

    CN115747255A

  • Rice EPSPS enzyme mutant, expression cassette, recombinant bacterium or application thereof

    CN118879661A

  • Methods and compositions for glyphosate tolerance in plants

    TW202505026A