Method for expressing exogenous gene in Dunaliella viridis

By using the HMEJ-CRISPR method to directionally insert exogenous genes into the NR gene locus of *Dunaliella greenis*, the problems of site-specific integration and active peptide secretion in existing technologies have been solved. This has enabled precise integration and efficient expression of exogenous genes, simplified the collection process of active peptides, and promoted the industrial application of *Dunaliella greenis*.

CN120866397APending Publication Date: 2025-10-31OCEAN UNIV OF CHINA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511214412.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-28
Publication Date
2025-10-31

AI Technical Summary

Technical Problem

Existing transgenic technology for *Dunaliella salina* suffers from random insertion sites for exogenous genes, making it difficult to achieve targeted integration and resulting in poor expression stability. Furthermore, the lack of effective secretion mechanisms and purification methods for bioactive peptides after expression within cells increases the difficulty of product collection and restricts its industrial application as a "cell factory" for producing bioactive peptides.

Method used

Using the HMEJ-CRISPR method, a foreign gene was directionally inserted into the NR gene locus of *Dunaliella salina* by knockout vector and donor vector. HMEJ repair was initiated by CRISPR-Cas9-mediated double-strand breaks, and homologous recombination was combined to achieve precise integration and independent expression of the foreign gene. The extracellular secretion and purification of the Pt5-1c gene were ensured by using P2A, FSRS and enterokinase restriction sites.

Benefits of technology

This study achieved precise integration and efficient expression of exogenous genes in *Dunaliella salina*, simplified the collection process of bioactive peptides, improved expression stability and secretion efficiency, and promoted the industrial application of *Dunaliella salina* as a "cell factory" for producing bioactive peptides.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120866397A_ABST
    Figure CN120866397A_ABST
Patent Text Reader

Abstract

The invention provides a method for expressing an exogenous gene in Dunaliella viridis, an expression system constructed by using an HMEJ-CRISPR method is used, and the expression system comprises a knockout vector and a donor vector. The knockout vector constructed by the invention can accurately recognize a target NR gene locus in a Dunaliella viridis genome, and HMEJ repair is started through CRISPR-Cas9 mediated double-strand breakage. According to the donor vector, an NR gene homologous arm and a functional fragment containing an exogenous gene are connected through homologous recombination to construct the donor vector, and directional insertion of the exogenous gene is achieved. The donor vector provided by the invention also carries exogenous target genes such as P2A, FSRS, enterokinase enzyme cutting sites and the like. According to the invention, a donor vector and a knockout vector are introduced into Dunaliella viridis cells through electric shock transformation, CRISPR-Cas9 is used for mediating double-chain breakage of NR gene loci, and an HMEJ repair mechanism is started to realize site-specific integration of exogenous genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, specifically relating to a method for expressing exogenous genes in Dunaliella salina. Background Technology

[0002] Green Dunaliella ( Dunaliella viridis As a eukaryotic microalga with significant application potential, *Dunaliella salina* is an ideal host for exogenous gene expression due to its unique physiological characteristics (such as strong stress resistance and low culture cost). However, existing transgenic technology for *Dunaliella salina* has many limitations in the application of exogenous genes such as bioactive peptides: on the one hand, the insertion site of exogenous genes is random, making it difficult to achieve site-specific integration, resulting in poor expression stability; on the other hand, after bioactive peptides are expressed in cells, there is a lack of effective secretion mechanisms and separation and purification methods, increasing the difficulty of product collection.

[0003] While CRISPR-Cas9-mediated gene editing technology enables site-specific insertion, traditional repair methods (such as NHEJ and HDR) are inefficient in *Dunaliella salina*. Furthermore, the synergistic achievement of independent expression and extracellular secretion of bioactive peptides remains a technical challenge, hindering the industrial application of *Dunaliella salina* as a "cell factory" for bioactive peptide production. Therefore, there is an urgent need to construct a transgenic system capable of site-specific integration and independent expression of exogenous genes, and facilitating the collection of bioactive peptides. Summary of the Invention

[0004] This invention aims to provide a method for expressing exogenous genes in *Dunaliella salina*, specifically a method based on the HMEJ (Homology-Mediated End Joining)-CRISPR method, which involves the targeted insertion of exogenous genes into the *Nitrate Reductase* (NR) gene locus of *Dunaliella salina*. This method achieves precise integration, independent expression, and efficient extracellular collection of exogenous genes in *Dunaliella salina*, thereby overcoming the shortcomings of existing technologies.

[0005] This invention first provides an expression system constructed using the HMEJ-CRISPR method, which includes a knockout vector and a donor vector; the knockout vector is an exon with the sequence SEQ ID NO:1 used to knock out the NR gene of Dunaliella salina. The knockout vector described therein carries an sgRNA with the sequence SEQ ID NO:3, wherein the crRNA has the sequence SEQ ID NO:2; Furthermore, the knockout vector is used to knock out the exon with the sequence SEQ ID NO:4 in the NR gene; wherein it carries an sgRNA with the sequence SEQ ID NO:6; and the crRNA has the sequence SEQ ID NO:5; The donor vector, wherein the sequence of the left homologous arm is SEQ ID NO:9 and the sequence of the right homologous arm is SEQ ID NO:10; Furthermore, the donor vector contains an EGFP sequence with the sequence SEQ ID NO:11; The present invention also provides another donor carrier, wherein the sequence of the left homologous arm is SEQ ID NO:17 and the sequence of the right homologous arm is SEQ ID NO:18; A cloning fragment encoding the Pt5-1c gene with the sequence SEQ ID NO:15 was inserted into the donor vector described above; Furthermore, the cloned fragment contains P2A (SEQ ID NO:12), FSRS (SEQ ID NO:13), enterokinase site (SEQ ID NO:14), and Pt5-1c (SEQ ID NO:15), one specific sequence of which is SEQ ID NO:16.

[0006] The present invention also provides a method for expressing exogenous genes in Dunaliella salina, which uses the above-described expression system to integrate exogenous genes into the genome of Dunaliella salina for expression.

[0007] The knockout vector constructed in this invention can accurately identify the target NR gene site in the *Dunaliella greenis* genome and initiate HMEJ repair via CRISPR-Cas9-mediated double-strand breaks. The donor vector of this invention connects the homologous arm of the NR gene and a functional fragment containing the exogenous gene through homologous recombination to construct the donor vector, achieving targeted insertion of the exogenous gene into the NR gene site. The donor vector provided by this invention also carries exogenous target genes such as P2A, FSRS (ferrooxidase signal recognition sequence), and an enterokinase site. P2A ensures independent expression of Pt5-1c, FSRS guides its secretion into the extracellular space, and the enterokinase site facilitates subsequent purification. The long homologous arm guides the targeted integration of the exogenous gene into the target NR gene site. In this invention, the donor vector and knockout vector are introduced into *Dunaliella greenis* cells via electroporation transformation, utilizing CRISPR-Cas9-mediated double-strand breaks at the NR gene site to initiate the HMEJ repair mechanism and achieve targeted integration of the exogenous gene. In this invention, after transforming *Dunaliella salina* into a vector, the exogenous gene was successfully inserted and expressed by screening in a urea medium containing chlorate (NR gene knockout strains can survive in a chlorate environment), combined with PCR identification and sequencing verification. Attached Figure Description

[0008] Figure 1This is a schematic diagram showing the gRNA hanging from 5' TCGA and AAAC in the pKs vector; Figure 2 Map of the NR gene knockout vector pKs_diaCas9_sgRNA-NRKO; Figure 3 This is a comparison diagram of the sequencing results of the construction of pKs_diaCas9_sgRNA-NRKO; Figure 4 The images show the successful transformation of *Dunaliella salina* using sodium chlorate plates. In the images, A is a sodium chlorate screening plate coated with the electroporated algal solution, and B is a screening plate coated with the wild-type algal solution. Figure 5 The image shows the sequence alignment results of algal colonies after PCR with the NR gene knocked out compared to the wild type. Figure 6 Map showing the target region of the NR gene knock-in vector gRNA; Figure 7 A sequence comparison diagram of pKs_diaCas9_sgRNA_NRKI1 and pKs_diaCas9_sgRNA; Figure 8 Schematic diagram of the construction process of the donor vector EGFP_donor_NRKI1; Figure 9 A represents the insertion site of the target gene into the NR gene; Figure 9 B represents the fusion protein produced by the EGFP and NR genes, with blue representing the fusion protein and yellow representing EGFP. Figure 10 Sequencing results at different suture sites of the donor vector EGFP_donor_NRKI1; Figure 11 Schematic diagram of the construction process of the donor vector Pt5-1c_donor_NRKI1; Figure 12 The structure diagram of a segment containing Pt5-1c; Figure 13 The pKs_diaCas9_sgRNA_NRKI1 map; Figure 14 The EGFP_donor_NRKI1 spectrum; Figure 15 The graph is for Pt5-1c_donor_NRKI1. Detailed Implementation

[0009] The present invention will now be described in detail with reference to the embodiments and accompanying drawings.

[0010] Example 1: Constructing a Green Dunaliella Knockout Algae Dunaliella viridis middle NRGene knockout vector 1.1 Design and screening of sgRNAs The *Dunaliella greenis* NR gene consists of 20 exons, with the second exon being 168 bp in length and translating into 56 amino acids. This exon is of moderate length and relatively conserved. A knockout site was selected in this region to induce frame shift or premature generation of the stop codon, thereby knocking out the NR gene. The target sequence of the second exon (NR-exon-2, SEQ ID NO:1) was identified as a Cas9 target site with low or no homology to other gene sites (such as N20-NGG). A 24-nucleotide oligonucleotide containing 20 complementary nucleotides was synthesized, and TCGA and AAAC extension sequences were added to the 5' end to construct a target for… NR Genetic adapters (such as) Figure 1 (as shown) NR-exon-2 SEQ ID NO:1 5'-ATTCCCCGCGACCCGCGCATCCTGCGCCTGACGGGCCGCCACCCCCTGAACTGCGAGCCCCCCCATGCACGACCTCATGGCAGCAGGCTTCATCACGCCCCCCTCCATCCACTACGTGCGCAACCACGGTCCTGCGCCCAAGATCCGCTGGGACCAGCACCGCCTAGAG-3' A recognition sequence crRNA1 obtained through screening was designed. It is formed by chemically synthesizing NRKO-F and NRKO-R oligonucleotide chains, annealing and ligating them to form a double-stranded DNA aptamer with sticky ends, which is used to synthesize crRNA in the knockout vector. The specific primers are NRKO-F and NRKO-R, and the sequence information is as follows: NRKO-F: 5'-TCGAGTCCTGCGCCCAAGATCCGCTGG-3'; NRKO-R: 5'-AAACCCAGCGGATCTTGGGCGCAGGAC-3'.

[0011] The sequence of crRNA1 is as follows: GTCCTGCGCCCAAGATCCGCTGG (SEQ ID NO:2), This sequence, together with the gRNA scaffold sequence in pKs_diaCas9_sgRNA, constitutes the complete sgRNA1 template, the sequence of which is SEQ ID NO:3.

[0012] 5'-GTCCTGCGCCCAAGATCCGCTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO: 3) Successful editing of the target sequence by sgRNA1 will cause Cas9 to disrupt this target site. The sgRNA1 gene can be designed to specifically target Dunaliella salina (green algae). D. viridis ) NR Genes, reference Figure 2 A.

[0013] Formed by insertion into the gene editing vector pKs_diaCas9_sgRNA NR Gene knockout vector pKs_diaCas9_sgRNA-NRKO, refer to Figure 2 B; however, other knockout vectors commonly used in HMEJ-CRISPR systems can also be used.

[0014] 1.2 Construction NR Gene knockout vector pKs_diaCas9_sgRNA-NRKO The pKs diaCas9-sgRNA vector containing two BsaI recognition sites was digested with BsaI restriction endonuclease to obtain a linearized vector. Subsequently, chemically synthesized NRKO-F and NRKO-R oligonucleotide chains were annealed and ligated to form double-stranded DNA aptamers with sticky ends. The annealed product was ligated to the linearized vector using T4 DNA ligase at 4 °C for 12 hours. Finally, the ligation product was transformed into DH5α competent cells and plated on LB agar plates containing ampicillin for positive clone selection.

[0015] Single-clone bacterial colonies were selected as templates, and PCR was performed using pre-designed specific primers pKs-KO-F and pKs-KO-R. The PCR products were then subjected to agarose gel electrophoresis to confirm successful vector construction. The primer sequences are as follows: pKs-KO-F: 5'-TTCAATCCTTAGCGCTTTTA-3' pKs-KO-R: 5'-TGAAGTTATCGCAAACGCAT -3' Sequencing results alignment indicates successful vector construction, such as Figure 3 As shown.

[0016] 1.3 Electrical shock conversion 1.3.1 Preparation of *Dunaliella salina* Collect 40 mL of Dunaliella salina by centrifugation ( D. viridisAlgal solution, 1700 × g, 3 min. Wash three times with 2 mL of 2×HEPES electroporation buffer (specific formulation shown in Table 1). In a 1.5 mL EP tube, add the following substances and place on ice for 20 min: ① 400 µl algal solution (adjust algal cell concentration to 10⁻⁶ with electroporation buffer). 6 ② The final concentration is 10 µg / mL plasmid DNA, ③ Salmon sperm DNA 20 µl.

[0017] Table 1: Formulation of 2×HEPES Electroshock Buffer Reagent Concentration mol / L HEPES 0.04 NaCl 1 KCl 0.01 <![CDATA[CaCl2]]> 0.01 D-Mannitol 0.4 Sorbitol D-Glucitol 0.4 1.3.2 Electric shock 400 μL of algal suspension was dispensed into an electroporation cup and electroporation was performed using an Eppendorf Eporator at a set voltage of 1500 V, an actual operating voltage of 100 V, and a pulse duration of 654 ms.

[0018] 1.3.3 Post-electric shock culture After electrolyzing the algal solution, incubate it on ice for 5 min, then incubate at 1700 ×g for 3 min, add 1 mL of culture medium, place it in a centrifuge tube, and incubate in the dark for 24 h. Then, transfer it to 20 mL of urea-containing culture medium (50 mL Erlenmeyer flask) for further culture.

[0019] 1.4 Sodium chlorate plate screening of algal strains successfully knocked out by electroporation Green Dunaliella salina that failed to transform after electroporation D. viridis The algal strain could not grow on sodium chlorate screening plates, while NR Algal strains that have successfully knocked out genes can grow colonies on sodium chlorate screening plates because they are resistant to sodium chlorate toxicity. Figure 4 The results showed that green algal colonies grew on the sodium chlorate screening plates, proving that this portion of the algal colony had... NR The phenotype of successfully knocked-out genes was used to count the algal colonies that grew. The electroporation conversion efficiency was calculated to be 86 CFU / μg DNA.

[0020] A portion of the algal colony was selected and placed in a 96-well plate for liquid culture. Colony PCR and sequencing were performed on this algal culture. The sequence before the target site was identical to the wild type, but numerous mutations and deletions were observed in the region following the target site. Figure 5 This stems from random mutations caused by NHEJ repair, a typical characteristic of frameshift mutations.

[0021] In conclusion, the transformed algal strains can grow on plates screened with sodium chlorate, and mutations and deletions occurred at the target sites, which is sufficient to prove... NR The gene was successfully knocked out.

[0022] Example 2: Directional knock-in of EGFP into the NR gene locus of Dunaliella salina Insert EGFP directly NR In the genes, chlorate can be used for screening, and Dunaliella salina can be used. NR To reduce the production of fusion proteins, the target site for the gene promoter is selected in the first exon of the NR gene (NR-exon-1 SEQ ID NO:4). The target region of the gRNA is as follows: Figure 6 As shown.

[0023] 5'-ATGCCCGCACTCGCCAAACACAGCGGAGCCCTCCAGCTCTCCAGGCGAGATGATGCTGTCTAAGCTGAAGGCTAACGGCAGCAGCGGCGGGGACAGCGCGAATGGTGTGCCTCAGCAGAACGGCAAGGTGG TGGTGGAGAGCTTCGTGCACAAGCACCTGGGCGCACCCTATGAGCCTCCCCTCTCCCCTGAAGACCCAGACTGGGCACTACATGTCCCTGCTTCCACCGTGAATGACAAGGACAAGGGCACCGCGGACGCATGG-3' (NR-exon-1 SEQ ID NO:4).

[0024] 2.1 gRNA Design Use the CRISPOR website (https: / / crispor.gi.ucsc.edu / crispor.py) to... NR The first exon of a gene is selected to choose a suitable target site. The sequence of crRNA2 is: TTAGACAGCATCATCTCGCCTGG (SEQ ID NO:5), this sequence together with the gRNA scaffold sequence in pKs_diaCas9_sgRNA constitutes the complete sgRNA2 template (SEQ ID NO:6).

[0025] 5'-TTAGACAGCATCATCTCGCCTGGGTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC-3' (SEQ ID NO: 6).

[0026] 2.2 NRConstruction of gene knockout vector pKs_diaCas9_sgRNA_NRKI1 2.2.1 pKs_diaCas9_sgRNA plasmid digestion The pKs_diaCas9_sgRNA plasmid was digested with BamHI and NcoI, and the specific digestion system is shown in Table 2. After incubation at 37°C for 4 hours, electrophoresis was performed to confirm successful digestion. The digested fragments were then recovered from the gel and their concentrations were measured.

[0027] Table 2: Linearized pKs_diaCas9_sgRNA double digestion system reagents volume pKs_diaCas9_sgRNA 8.98 μL (5 μg) BamHⅠ 2.5μL NcoⅠ 2.5μL 10×K 5μL DEPC water 31.02μL 2.2.2 Cloning of the pKs_diaCas9_sgRNA fragment Primers were designed and synthesized based on the sequence of pKs_diaCas9_sgRNA. pKs-F: 5'-ccaggcaaaaaagaaaaagtaatc-3' gRNA-R: 5'-AAACCCAGGCGAGATGATGCTGTCTAAtcgactttgaaggtgtttttt-3' gRNA-F: 5'-TCGATTAGACAGCATCATCTCGCCTGGgttttagagctagaaatagcaagtt-3' pKs-R: 5'-aagcttgcagaaaagttcg-3'.

[0028] Using pKs_diaCas9_sgRNA plasmid as a template, a 560bp fragment of L-gRNA (SEQ ID NO:7) was amplified using primers pKs-F and gRNA-R, respectively; the amplification product of primers gRNA-F and pKs-R was a 447bp fragment of gRNA-R (SEQ ID NO:8). The PCR procedure is shown in Table 3.

[0029] Table 3: PCR Reaction Procedure

[0030] L-gRNA SEQ ID NO:7 5'--3' gRNA-R SEQ ID NO:8 5'-TCGATTAGACAGCATCATCTCGCCTGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTTAGAACCGCTCACCCATGCTATCGTATGTCATTTACATTGACAAACTGCTATGAATGCGTTTGCGATAACTTCAGCTCGCTGAAGCCCTAGACATTTCGTTTGACTAAATTGT TTTCCGGTGCTTACTACCGACCGGTCTGCGGGTAGCATGTCTTGGCTTTTGCGAGTTCGAGAGAATTTATGGACAAGTGCGTTTACAGTTTGGAACACGAGTGTGAGTGAGCGGAATTGGCTATCTATAACATTCTTATTTCAGGAGGCTGGTGATTAGCAGAATTTTCAAAGATCTCGAATCTAAAATCGCCATGGGCTCGACGAACTTTTCTGCAAGCTT-3' 2.2.3 Construction of the knockout vector pKs_diaCas9_sgRNA_NRKI1 Based on the aforementioned L-gRNA and gRNA-R fragments, and using the pKs_diaCas9_sgRNA plasmid as the starting vector, the donor vector pKs_diaCas9_sgRNA_NRKI1 was constructed via homologous recombination. The homologous recombination system is shown in Table 4. The reaction conditions were 50℃ for 50 minutes.

[0031] Table 4: Homologous recombination system of the knockout vector pKs_diaCas9_sgRNA_NRKI1 reagents Fragment size molar amount concentration quality volume Linearization of pKs_diaCas9_sgRNA 7658bp 0.03 pmol 25.2 ng / μL 153.16ng 6.08μL L-gRNA 560bp 0.03 pmol 11.4 ng / μL 11.2ng 0.98μL gRNA-R 447bp 0.03 pmol 12ng / μL 8.94ng 0.75μL 2X MultiF Seamless Assembly Mix 10μL DEPC 2.19μL After ligation and transformation plating; several single clones were picked for colony PCR and sequencing. The sequencing results ( Figure 7 This proves that the pKs_diaCas9_sgRNA_NRKI1 plasmid was successfully constructed, and the position adjacent to the original gRNA scaffold was replaced with the crRNA2 sequence constructed in this embodiment.

[0032] 2.3. Construction of the donor vector EGFP_donor_NRKI1 plasmid The construction process of the donor vector EGFP_donor_NRKI1 is as follows: Figure 8 The specific steps are as follows.

[0033] 2.3.1 pEASY-T3 plasmid digestion pEASY-T3 was subjected to a double digestion system using SphⅠ and SalⅠ, as shown in Table 5. After incubation at 37℃ for 4 hours, electrophoresis confirmed successful digestion, and the digested fragments were recovered by gel extraction.

[0034] Table 5: Linearized EGFP_donor_NRKI1 double digestion system reagents volume pEASY-T3 7.94 μL (5 μg) SphⅠ 2.5μL SalⅠ 2.5μL 10×H 5μL DEPC water 32.06μL 2.3.2 Cloning of the endogenous fragment of the NR gene from *Dunaliella viridis* Based on the selection of target sites and the structure and function of pKs_diaCas9_sgRNA_NRKI1, and to prevent frameshifts, NR genes such as... Figure 9 Insert the target fragment at point A, where the 16 amino acids of the NR gene will fuse with the target protein. Select approximately 800 bp long homologous arms to the left and right of this site. Figure 9 Figure B shows the superposition of the three-dimensional structure of the fusion protein and the three-dimensional structure of GFP, indicating that the original 16 amino acids of the NR gene have little effect on the structure and function of GFP.

[0035] According to Dunaliella salina NR Gene sequence, design and synthesize the following primers: L1-F: 5'-attgggcccgacgtcgcatgcGTTGAAGGGCGCCCCATC-3' L1-R: 5'-ACAGCTCCTCGCCCTTGCTCACCATgcctggagagctggagggct-3' R1-F: 5'-CGGCATGGACGAGCTGTACAAGTGAgagatgatgctgtctaagctgaaggc-3' R1-R: 5'-gagctctcccatatggtcgacATGTGTGCATGCGCACGTG-3' The amplification products of primers L1-F and L1-R are the endogenous left-end homologous arm of the NR gene, NR-HAL (SEQ ID NO:9); the amplification products of primers R1-F and R1-R are the endogenous right-end homologous arm of the NR gene, NR-HAR (SEQ ID NO:10).

[0036] Left homologous arm NR-HAL 5’-ATTGGGCCCGACGTCGCATGCGTTGAAGGGCGCCCCATCATCGGGCATCAATCTTTGCATGCGCGCAGAACTGTTCATGCTGAAGTAGATCAGGTACGCCACCAGCTCATGAGCTGGATGGATGAACCTGGCTGTAGCTCCATATTTTGGTGGCTCACCACCAGCAACCCATAAAACTTAAAACAGAGCGCTGCATGTGCCATAATGGCCCCGTAGACATGAGGCATGGAATCTGCGTGCCACTGTGTGCCTTGCAACGCCAGCGGGCTTGTTCGCAATCTGTTGCAATGCCATCTACCATACGCAAGGAGGGAGGGCATGGAATAAGGACACTCAGAATTCTTTGTTGCGCTGCCAGTGCCCACATGCACATGCAGGACACCTGCCAGCAGCTGGAGCACTGCAGGAGGCAGGGGTGGAGCAGGGAGCGAGGGATCGTAGCTGGCCCCTGCATGCAAGGAGCACTTTGCGCATGCTTGCTTGCGATGGTGCTGGGAAAGTCCTCGGGAAAGGGTGGTGGCCCATTGGCCTATCGCATTGACACAGTGTCCTTATCGTCGCACGTGTTGACTGATTACAGCACCCCCAAGAGCCCACCCCCCTTTCCGGGCAGCCCACCCCCAAGAGCGCCCCCTGCTCAAAACCACTTAAACTCTGCTTTGCACACCGTGCCTCACGCTGCCACGCTTGGGGGAGGCACGCACGCGCGGCAGAGTGTGAGCAGCTCGTCTACTCTTGCTGGCTGTTAAACACAGCCTGTCCGCAGCAGCAGAATGCCCGCACTCGCCAACAACACAGCGGAGCCCTCCAGCTCTCCAGGCATGGTGAGCAAGGGCGAGGAGCTGT-3’ (SEQ ID NO:9); Right homologous arm NR-HAR 5’-CGGCATGGACGAGCTGTACAAGTGAGAGATGATGCTGTCTAAGCTGAAGGCTAACGGCAGCAGCGGCGGGGACAGCGCGAATGGTGTGCCTCAGCAGAACGGCAAGGTGGTGGTGGAGAGCTTCGTGCACAAGCACCTGGGCGCACCCTATGAGCCTCCCCTCTCCCCTGAAGACCCAGACTGGGCACTACATGTCCCTGCTTCCACCGTGAATGACAAGGACAAGGGCACCGCGGACGCATGGTGAGGCGCGTGTTCGTGTGTACATGTGCTTGCGTACATATGCACGCTGAGAGCGCAAGTGTGCGCTGTGTGTCAATGTGTGGCGCATTCGTGTGTGTGTTGTGTGCGTGTGCGCGTATGTTGGGCGCTTCATGTTGTCTCCCAGTCTGGCAGCGCCCAGGTGGCAGGTGTACAGGGTCACGCAGAGCTTGCTCTCTGTCTTTCTGCTCATTGCATGTGTGTGCATCTCATGGATTAGCTTGGTCTTTGCTTATTCATTGCTGTTGTGTGTAAGGGTCCCTTCACGCGATGTTTAACGAGAGTGCCCCAACCCTTGCCCATGTGTCCACCTGGCGGACACCCACACCCTCTTCACAGGCTGCCTCAAGAATTTGTCTGTTTAAGCCTGTGTGCTTGTGCCTCACAAACACAATGCCAGCACGGAGCTCCGTGCTCTAGCATTTCACAATTCCACGCACCGTGCATTTGCGTTTAAAAAGCCTCATGGTGGCTATGTGCTTAAATGCAAACACACGCATGTGTGCAAACACGCACGCAAACACGCGCATGCGCCTGCGCGCACACACGTGCGCATGCACACATGTCGACCATATGGGAGAGCTC-3’ (SEQ ID NO:10) Using the total DNA of Dunaliella viridis genome as a template, two fragments of about 850 bp were amplified by PCR with primers L1-F, L1-R and R1-F, R1-R. The PCR procedure was referred to Table 3.

[0037] After agarose gel electrophoresis, the fragments were purified using a gel recovery kit (Novizan kit) for later use.

[0038] 2.3.3 Cloning of EGFP fragments Design the following primers: GFP-F: 5'-ATGGTGAGCAAGGGCGAGGA-3' GFP-R: 5'-CTTGTACAGCTCGTCCATGCCGA-3' Using pcDNA3.1 plasmid as a template, PCR amplification was performed using primers GFP-F and GFP-R, following the same PCR procedure as above. The PCR amplification product was an EGFP fragment (SEQ ID NO:11), 717 bp in size. The fragment was purified by agarose gel electrophoresis and then ready for use.

[0039] 5'--3' (SEQ ID NO:11) 2.3.4 Construction of the donor vector EGFP_donor_NRKI1 plasmid Based on the HAL, HAR, and GFP fragments mentioned above, and using pEASY-T3 plasmid as the starting vector, the donor vector EGFP_donor_NRKI1 was constructed via homologous recombination. The homologous recombination system is shown in Table 6. The reaction conditions were 50℃ for 50 minutes.

[0040] Table 6: Homologous recombination system of donor vector EGFP_donor_NRKI1 reagents Fragment size molar amount concentration quality volume Linearization pEASY-T3 2962bp 0.03 pmol 34.6 ng / μL 59.24ng 1.71μL NR-HAL 846bp 0.03 pmol 31.8 ng / μL 17ng 0.53μL NR-HAR 846bp 0.03 pmol 35.6 ng / μL 17ng 0.48μL GFP 717bp 0.03 pmol 29.4 ng / μL 14.34ng 0.49μL 2X MultiF Seamless Assembly Mix 10μL DEPC 6.79μL Thaw competent cells (DH5α Competent E. coli Strain) for cloning on ice; add 5 μL of assembly product to 50 μL of competent cells; incubate on ice for 30 min; heat shock at 42°C for 45 s, then immediately cool on ice for 3 min; add 700 μL of antibiotic-free LB medium and incubate at 37°C for 2 h; spread 50 μL of turbid bacterial culture on an Amp-resistant plate and incubate overnight at 37°C; pick several single clones for colony PCR and sequencing. Sequencing results at different suture sites of the donor vector confirmed the successful construction of the EGFP_donor_NRKI1 plasmid. Figure 10 As shown.

[0041] 2.4 Electric Shock Conversion The electro-electric conversion system is shown in Table 7.

[0042] Table 7: NR Gene knockout and EGFP knock-in electroporation system table reagents Fragment size concentration quality volume pKs_diaCas9_sgRNA_NRKI1 8578bp 704.9 ng / μL 10μg 5.67μL EGFP_donor_NRKI1 5273bp 485.4 ng / μL 6.13μg 5.05μL salmon essence 20 μL Electric shock buffer 400μL Three groups were set up: an electroporation group (containing the donor vector EGFP_donor_NRKI1 and the knockout vector pKs_diaCas9_sgRNA-NRKI1), an electroshock group (electroshocked but without vector), and a blank control group (no electroshock and without vector). Each group had three replicates, and the electroporation steps were the same as described above.

[0043] 2.5. Screening and identification of transformed green Dunaliella salina After electroporation, the algae were cultured in urea medium and then transferred to chlorate-containing plates. Algal strains with successfully knocked-out NR genes could survive on sodium chlorate plates, while algal strains with knocked-in EGFP showed green fluorescence.

[0044] Total genomic DNA was extracted from transgenic *Dunaliella salina* for molecular identification. First, PCR was used to determine plasmid integration. The upstream primer used in PCR was GFP-F, the downstream primer was GFP-R, and the product was the EGFP gene. The reaction procedure was as described previously. If transformation was successful, this fragment could be amplified in the genome of resistant *Dunaliella salina*, but not in untransformed *Dunaliella salina*. Sequencing of the PCR product showed a sequence identical to the GFP sequence, indicating that the exogenous gene had been inserted into the *Dunaliella salina* genome.

[0045] Example 3: Directed insertion of the active peptide Pt5-1c into the NR gene locus of Dunaliella salina. 3.1 Construction of the donor vector Pt5-1c_donor_NRKI1 Based on the use of pKs_diaCas9_sgRNA plasmid NRThe feasibility of gene knockout and the successful construction of the knock-in donor vector EGFP_donor_NRKI1 were used to design Pt5-1c_donor_NRKI1, referencing... Figure 11 .

[0046] 3.1.1 Green Dunaliella Dunaliella viridis NR Cloning of endogenous gene fragments According to Dunaliella salina NR Gene sequence, design and synthesize the following primers: L1-F: 5' -attgggcccgacgtcgcatgcGTTGAAGGGCGCCCCATC-3' LP-R: 5'-gcctggagagctggaggg-3' RP-F: 5'-gagatgatgctgtctaagctgaaggc-3' R1-R: 5' -gagctctcccatatggtcgacATGTGTGCATGCGCACGTG-3' The amplification product of primers L1-F and LP-R is NR-HAL-P; the amplification product of primers RP-F and R1-R is NR-HAR-P.

[0047] Using total DNA from the genome of Dunaliella salina as a template, PCR amplification was performed using primers L1-F, LP-R and RP-F, R1-R, with the same PCR procedure as above.

[0048] The PCR amplification product was Dunaliella salina green. NR The two gene fragments, each approximately 820 bp in size, were purified by agarose gel electrophoresis (using the Novizan kit) for later use.

[0049] 3.1.2 Cloning containing the Pt5-1c fragment Design the following primers: PF: 5' - agcggagccctccagctctccaggcATGGGGTCCGGGGCGACC-3' PR: 5' - ccttcagcttagacagcatcatctcTCACTTGGTCGCCGAGTGATGA-3' Using the artificially synthesized plasmid VB240716-1297azp containing Pt5-1c as a template, PCR amplification was performed using primers PF and PR, following the same PCR procedure as above. The PCR amplification product contained fragments of P2A (SEQ ID NO:12), FSRS (SEQ ID NO:13), enterokinase site (SEQ ID NO:14), and Pt5-1c (SEQ ID NO:15). The prepared clone containing the Pt5-1c fragment was 302 bp (SEQ ID NO:16). Figure 12 As shown. The fragments were purified by agarose gel electrophoresis and then recycled for later use.

[0050] P2A SEQ ID NO:12 5'-GCGACCAACTTCAGCCTGCTGAAGCAGGCGGGCGATGTGGAGGAGAACCCTGGCCCG-3' FSRS SEQ ID NO:13 5'-ATGCACTCGAAAAATTTGCTGCTCGCAGCACAGCTGCTGTTGCTACTCATTGGGACAGGCGTGTTTGCAGCG-3' Sequence name: enterokinase site SEQ ID NO:14 5'-GACGACGATGATAAG-3' Sequence name: Pt5-1c SEQ ID NO:15 5'-AGCCGGATGAAGAAGTGGGCGAAGATCATCGAGAAGTGGCGCAAGTGGCACAAGAAGCGCTGGCTCGCTCATCACTCGGCGACCAAG-3' The clone containing the Pt5-1c fragment is 302 bp (SEQ ID NO:16). 5'-AGCGGAGCCCTCCAGCTCTCCAGGCATGGGGTCCGGGGCGACCAACTTCAGCCTGCTGAAGCAGGCGGGCGATGTGGAGGAGAACCCTGGCCCGGGCGCCATGCACTCGAAAAATTTGCTGCTCGCAGCACAGCTGCTGTTGCTACTCATT GGGACAGGCGTGTTTGCAGCGGACGACGATGATAAGAGCCGGATGAAGAAGTGGGCGAAGATCATCGAGAAGTGGCGCAAGTGGCACAAGAAGCGCTGGCTCGCTCATCACTCGGCGACCAAGTGAGAGATGATGCTGTCTAAGCTGAAGG-3' 3.1.3 Construction of the donor vector Pt5-1c_donor_NRKI1 plasmid Based on the above-mentioned HAL-P, HAR-P, and Pt5-1c-containing fragments, and using pEASY-T3 plasmid as the starting vector, the donor vector Pt5-1c_donor_NRKI1 Pt5-1c was constructed through homologous recombination to achieve the directed insertion, independent expression, and extracellular secretion of Pt5-1c.

[0051] The sequences of the left and right homologous long arms NR-HAL-P and NR-HAR-P are SEQ ID NO:17 and SEQ ID NO:18, respectively.

[0052] 3.2 Electrical shock conversion Three groups were set up: an electroporation group (containing the donor vector Pt5-1c_donor_NRKI1 and the knockout vector pKs_diaCas9_sgRNA-NRKI1), an electroshock group (electroshocked but without plasmid), and a blank control group. Each group had three replicates, and the electroporation steps were the same as described above.

[0053] 3.3. Screening and identification of transformed green Dunaliella salina After electroporation, the algae were cultured in urea medium and then transferred to chlorate-containing plates. Algal strains with successfully knocked-out NR genes could survive on sodium chlorate-containing plates, thus achieving the purpose of screening.

[0054] Total genomic DNA was extracted from transgenic *Dunaliella salina* for molecular identification. First, PCR was used to determine plasmid integration. The upstream primer used in PCR was cPF, and the downstream primer was cPR. The primer sequences were as follows: cPF: 5'-ATGCCCGCACTCGCCAAC-3' cPR: 5'-TCACTTGGTCGCCGAGTGATGA-3' The PCR amplification product was a fusion fragment containing the first exon of the NR gene, P2A, FSRS, Pt5-1c, and enterokinasesite, with a size of 300 bp (NR-Pt5-1c). The reaction procedure is as described above. If transformation is successful, this fragment can be amplified in the genome of resistant Dunaliella salina, but not in untransformed Dunaliella salina.

[0055] Sequencing of the PCR product showed that the sequence was consistent with the expected sequence, indicating that the functional fragment containing Pt5-1c had been inserted into the first exon of the NR gene in the Dunaliella salina genome, forming a fusion fragment. The recombinant expression results demonstrated that the constructed recombinant expression vector could efficiently express the Pt5-1c peptide in Dunaliella salina.

[0056] The site-directed insertion vector constructed in this invention can be widely applied in the field of Dunaliella salina synthetic biology, for example, in the production of recombinant pharmaceutical proteins (such as interferon and vaccines) and the efficient expression of industrial enzymes (such as cellulase and lipase). Its low cost and high stability are expected to promote Dunaliella salina as a novel "green bioreactor," with significant economic and social benefits.

Claims

1. An expression system constructed using the HMEJ-CRISPR method, characterized in that, The expression system includes a knockout vector and a donor vector; the knockout vector is an exon with the sequence SEQ ID NO:1 used to knock out the NR gene of Dunaliella salina.

2. The expression system as described in claim 1, characterized in that, The knockout vector carries an sgRNA with the sequence SEQ ID NO:3, wherein the crRNA has the sequence SEQ ID NO:

2.

3. The expression system as described in claim 1, characterized in that, The knockout vector is used to knock out the exon with sequence SEQ ID NO:4 in the NR gene.

4. The expression system as described in claim 3, characterized in that, The knockout vector carries an sgRNA with the sequence SEQ ID NO:6; and the crRNA has the sequence SEQ ID NO:

5.

5. The expression system as described in claim 1, characterized in that, The donor vector has a left homologous arm sequence of SEQ ID NO:9 and a right homologous arm sequence of SEQ ID NO:

10.

6. The expression system as described in claim 1, characterized in that, The donor vector contains an EGFP-encoding gene with the sequence SEQ ID NO:

11.

7. The expression system as described in claim 1, characterized in that, The donor vector wherein the sequence of the left homologous arm is SEQ ID NO:17 and the sequence of the right homologous arm is SEQ ID NO:

18.

8. The expression system as described in claim 7, characterized in that, The donor vector contains a clone fragment that encodes the Pt5-1c gene with the sequence SEQ ID NO:

15.

9. The expression system as described in claim 8, characterized in that, The sequence of the cloned fragment is SEQ ID NO:

16.

10. A method for expressing exogenous genes in *Dunaliella salina*, characterized in that, The method involves using the expression system described in claim 1 to integrate exogenous genes into the genome of Dunaliella salina for expression.