Entropy-driven mediated bipedal DNA walker responsive hydrogel detection reagent

By utilizing an entropy-driven, bipedal DNA walker-based responsive hydrogel assay reagent, combined with a cascade reaction of influenza virus surface hemagglutinin (HA) and aptamers, high sensitivity and specificity for influenza virus detection are achieved. This solves the problem of insufficient detection limits in existing technologies and is suitable for rapid and convenient virus detection.

CN120870550BActive Publication Date: 2026-08-25THE FIRST AFFILIATED HOSPITAL OF ARMY MEDICAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511049646.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-07-29
Publication Date
2026-08-25
Estimated Expiration
2045-07-29

AI Technical Summary

Technical Problem

Existing influenza virus detection methods cannot simultaneously meet the requirements of high sensitivity, high specificity, short test cycle, and simple operation. In particular, entropy-driven catalytic reaction (EDC) has a detection limit that does not reach the fM level when detecting nucleic acid targets.

Method used

A responsive hydrogel detection reagent based on entropy-driven bipedal DNA walker walking is used. It utilizes DNA nanomachines for spatial integration and achieves specific recognition and high-sensitivity detection of influenza virus through entropy-driven catalytic reaction (EDC). It uses hemagglutinin (HA) on the surface of influenza virus as the detection target and achieves signal amplification by combining aptamer and glucosylase cascade reaction.

Benefits of technology

It achieves high-sensitivity detection of influenza virus with a detection limit as low as 18.9 pM, can accurately distinguish influenza A virus from other respiratory pathogens, is easy to operate, and is suitable for non-professionals to complete the test within 1 hour, and can quickly prepare the test system during the epidemic.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120870550B_ABST
    Figure CN120870550B_ABST
Patent Text Reader

Abstract

The application discloses a responsive hydrogel detection reagent based on entropy-driven mediated double-leg DNA walker walking, and relates to the field of virus detection, and discloses the following technical scheme: according to the virus surface screening corresponding aptamer sequence, according to the aptamer sequence designing corresponding DNA double-leg walker, the double-leg DNA walker includes a double-leg binding area, a leg connecting area, an aptamer binding area and an EDC starting area. Subsequently, according to the sequence of the EDC starting area, the base chain of the EDC reaction species, the waste chain 1, the waste chain 2 and the fuel chain are designed respectively; the detection reagent can rapidly prepare, stably store, easily operate and detect the influenza virus instantaneously according to the influenza mutation characteristics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of detection, and more specifically to a responsive hydrogel detection reagent based on entropy-driven mediated bipedal DNA walker walking. Background Technology

[0002] The spread of seasonal influenza viruses declined during the COVID-19 pandemic, but has been increasing in recent years. The main causes of influenza epidemics are: (1) influenza virus evolution, which mainly evades human humoral immunity by replacing, inserting or deleting amino acids encoding hemagglutinin and neuraminidase epitopes, enabling the virus to escape key antibodies induced by previous infections, vaccines or both. This evolutionary process is called "antigen drift"; (2) during co-infection with different influenza A viruses, interspecies transmission in animals can lead to gene recombination of viral RNA fragments, which is the core of the emergence of new influenza viruses. The emergence of new viruses can lead to the spread of influenza viruses between species, and thus a pandemic. During a pandemic, people with lower immunity and more underlying diseases, including children and the elderly, usually have a higher proportion of laboratory-confirmed cases, which brings a certain disease burden to society. The limitations of influenza detection methods, the small proportion of patients who are tested, and the large proportion of asymptomatic infections will directly affect the prevalence of influenza viruses. Therefore, the development of convenient, rapid and efficient instant detection technology for influenza viruses will help curb the outbreak and pandemic of influenza, thereby reducing the hospitalization rate, mortality rate and social burden.

[0003] Currently, commonly used clinical methods for influenza virus detection include rapid antigen detection methods, such as test strip analysis and fluorescence immunoassay, which are time-efficient, highly specific, and easy to use, but their sensitivity is generally low (40%-80%). RNA molecular assays, such as polymerase chain reaction (PCR), require nucleic acid extraction, amplification, and analysis, and have high sensitivity (>95%), but must be performed by qualified personnel in a certified laboratory and require expensive testing equipment. In summary, while the above methods have their advantages in different scenarios, they cannot simultaneously meet the requirements of high sensitivity, high specificity, short testing cycle, and ease of operation. There is an urgent need to develop a point-of-care influenza virus detection method that is cost-effective, easy to operate, and has superior performance.

[0004] Nucleic acid aptamers, with their advantages of low immunogenicity, strict recognition ability, and high affinity, can effectively solve the problem of influenza virus recognition. Through the effective binding of nucleic acid aptamers and target molecules, target molecule recognition events can be converted into nucleic acid signals. Furthermore, by leveraging the base complementarity pairing principle of nucleic acids and nucleic acid amplification technology, the specificity of target recognition and the sensitivity of detection can be further guaranteed and improved. Entropy-driven catalyst (EDC) is a novel, energy-dynamically controlled programmed nucleic acid self-assembly process. The driving force of the entire reaction originates from the free energy released by the entropy change of the system during DNA hybridization. When triggering downstream reactions, the base complementarity pairing principle is strictly followed; even a single-base mutation cannot drive the reaction, thus ensuring the specificity of the reaction. Moreover, this feedforward cascade with quadratic kinetics and the positive feedback reaction with exponential growth kinetics can achieve "infinite" cycles under specific conditions, ensuring the efficiency of this type of enzyme-free nucleic acid amplification reaction. However, previous studies have found that the EDC method alone can achieve a detection limit in the pM range when detecting nucleic acid targets, which is still somewhat different from the fM level detection limit of the gold standard PCR.

[0005] Therefore, there is an urgent need for a highly sensitive EDC detection method that can achieve an fM-level detection limit. Summary of the Invention

[0006] In view of this, one of the objectives of the present invention is to provide a responsive hydrogel detection reagent for entropy-driven bipedal DNA walker walking.

[0007] To achieve the above objectives, the present invention provides the following technical solution: A responsive hydrogel detection reagent based on entropy-driven mediated bipedal DNA walker walking, the hydrogel detection reagent comprising EDC hydrogel, DNA bipedal walker and aptamer; The DNA bipedal walker consists of two single strands, W1 and W2, with the 3' end of W1 and the 5' end of W2 being complementary. The 5' end of W1 and the 3' end of W2 form the EDC promoter region. An aptamer binding region and a leg connection region are provided between the EDC promoter region and the complementary binding region. The aptamers and the aptamer binding region complement each other to form a closed bipedal walker, which can specifically recognize and bind to viruses. The EDC hydrogel includes a base chain, waste chain 1, waste chain 2, fuel chain, and glucosylase. The fuel chain can bind to the EDC initiation region and release waste chain 1. The fuel chain binds to the base chain and releases waste chain 2 and glucosylase.

[0008] Preferably, the nucleic acid sequence of the aptamer is shown in SEQ ID NO.1; the nucleic acid sequence of W1 is shown in SEQ ID NO.2; the nucleic acid sequence of W2 is shown in SEQ ID NO.3; the nucleic acid sequence of the base strand is shown in SEQ ID NO.4; the nucleic acid sequence of waste strand 1 is shown in SEQ ID NO.5; and the nucleic acid sequence of waste strand 2 is shown in SEQ ID NO.6.

[0009] In a preferred embodiment of the present invention, the EDC hydrogel is prepared as follows: a base chain, waste chain 1, waste chain 2 and fuel chain are added to 4 portions of acrylamide SH-PGM buffer, respectively. Then an initiator and an accelerator are added. After polymerization, the 4 portions of solution are mixed and a glucose amylase aqueous solution is added. After incubation, the mixture is uniformly mixed and cooled to obtain the EDC hydrogel.

[0010] Preferably, the detection reagent further includes a linear starch solution.

[0011] Preferably, the method of using the detection reagent is to mix the target substance with amylose and place it on EDC hydrogel, add the double-leg EDC walker and aptamer, and then react fully. After the reaction, the supernatant is taken and the glucose content is determined by PGM.

[0012] Preferably, the reaction is carried out at a reaction temperature of 37°C and a magnesium ion concentration of 5.0 mM for 1 hour.

[0013] The beneficial effects of this invention are as follows: This invention is based on an entropy-driven responsive hydrogel detection reagent for bipedal DNA walkers. This invention utilizes DNA nanomachines to spatially integrate multiple EDC systems and uses the "spatial proximity effect" to "dynamically accelerate" the EDCs, establishing a bipedal DNA walker (EDC walker) for the specific recognition and high-sensitivity detection of influenza viruses. Specifically, using hemagglutinin (HA) on the surface of the influenza virus as the detection target, the HA aptamer blocks the binding site of the bipedal walker. When the influenza virus is present, the aptamer binds to the HA on the virus surface and releases the bipedal DNA walker. The bipedal DNA walker can then initiate a series of cascade chain displacement reactions between the substrate complex and the fuel chain, and promote the cyclic use of the bipedal DNA walker target in the hybridization-chain substitution-dissociation-rehybridization process, which can realize the recovery of the output signal and enzyme-free cascade amplification.

[0014] This method has the following advantages: 1) Excellent detection performance: It can achieve a detection limit of HA as low as 18.9pM, and can accurately distinguish H1N1 virus from other common respiratory pathogens.

[0015] 2) Easy to operate: The only items required for operation are entropy-driven hydrogel and blood glucose meter. Non-professionals can complete the result interpretation in about 1 hour after operation.

[0016] 3) High versatility: During viral outbreaks, as the HA on the surface of the virus mutates, corresponding entropy-driven hydrogel POCT detection systems can be rapidly and massively prepared based on specific HA types. Attached Figure Description

[0017] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the following figures are provided for illustration: Figure 1 A schematic diagram of a bipedal DNA walker based on entropy-driven catalytic reactions; Figure 2 A schematic diagram illustrating the principle of entropy-driven, bipedal DNA walker-mediated responsive hydrogel for the instantaneous detection of influenza virus. Figure 3 Characterization of EDC hydrogels (A: SEM results; B: rheological coefficient results); Figure 4 The ability of hydrogels to coat glucoamylase; Figure 5 Feasibility verification for detecting HA using EDC hydrogels (A: Lane 1: W1; Lane 2: W2; Lane 3: W1+W2; Lane 4: W1+W2+aptamer; Lane 5: W1+W2+aptamer+HA; B: The process of EDC triggering by the released bi-legged EDC walker; C: Lane 1: Waste chain 1; Lane 2: Waste chain 2; Lane 3: Basal chain; Lane 4: Basal chain + Waste chain 2; Lane 5: Basal chain + Waste chain 1 + Waste chain 2; Lane 6: Bi-legged EDC walker; Lane 7: Fuel chain; Lane 8: Basal chain + Waste chain 1 + Waste chain 2 + Bi-legged EDC walker; Lane 9: Basal chain + Waste chain 1 + Waste chain 2 + Bi-legged EDC walker + Fuel chain lane; Lane 10: Basal chain + Waste chain 1 + Waste chain 2 + Bi-legged EDC) Walker + fuel chain + aptamer; Lane 11: basal chain + waste chain 1 + waste chain 2 + dual-leg EDC walker + fuel chain + aptamer + fuel chain).

[0018] Figure 6 To optimize experimental conditions (A: different magnesium ion concentrations; B: different sodium ion concentrations; C: different reaction times; D: different reaction temperatures). Figure 7 For the study of reaction sensitivity and specificity (A: detection results at concentrations of 100pM-1000pM; B: linear fitting equation; C: specificity detection results; D: stability detection results). Detailed Implementation

[0019] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0020] To address the relatively insufficient sensitivity of EDC (Electronic Data Disposal) detection, this study utilizes DNA nanomachines to spatially integrate multiple EDC systems and leverages the "spatial proximity effect" to "dynamically accelerate" the EDCs, creating an EDC-based bipedal DNA walker for specific recognition and highly sensitive detection of influenza viruses. Figure 1 This method utilizes influenza virus surface hemagglutinin (HA) as the detection target. HA aptamers block the binding sites of a bipedal walker. When the influenza virus is present, the aptamers bind to HA on the virus surface and release a bipedal DNA walker. The bipedal DNA walker then initiates a series of cascade chain displacement reactions between the substrate complex and the fuel chain, promoting the cyclical use of the bipedal DNA walker target in the hybridization-chain substitution-dissociation-rehybridization process. This enables signal recovery and enzyme-free cascade amplification. The improved detection sensitivity of this method is mainly attributed to: ① Unlike DNAzyme-based DNA walkers, the bipedal walker mediated by EDC is not consumed during its "walking" process; ② Compared to single-leg walkers, the detection efficiency of the bipedal walker is further improved.

[0021] To achieve real-time detection of influenza virus, a relevant vector needs to be added to the entropy-driven mediated bipedal DNA walker. This vector must meet the following conditions: ① high biocompatibility, capable of carrying the functional components of the EDC walker without interfering with EDC-related reactions; ② certain stability, requiring proper storage during influenza epidemics without loss of function of the EDC components; ③ ability to be rapidly and massively synthesized during influenza epidemics. Hydrogels are cross-linked hydrophilic polymers. Due to their hydrophilicity, high biocompatibility, and programmability, they have been widely used in bioanalysis and biomedicine in recent years. Incorporating DNA into polymers to form DNA hydrogels not only retains the advantages of hydrogels but also endows them with programmable nucleic acid sequences, spatial structure containment, and controllable chemical modifications. Currently, DNA-responsive hydrogels based on chain substitution and hybridization chain reactions have been successfully used for the detection of various biomarkers.

[0022] The use of EDC walker-mediated DNA-responsive hydrogels for highly sensitive and specific point-of-care detection of influenza virus (POV) Figure 2The functional components of the EDC (including the substrate complex and the fuel chain) are all linked to a linear polyacrylamide polymer. The triple-chain cross-linked structure of the substrate complex itself encapsulates glucosylase and self-assembles to form a DNA-responsive hydrogel with the assistance of acrylamide monomers. Real-time detection can be divided into the following three steps: ① Influenza virus recognition: After the HA aptamer recognizes and binds to the target H1N1 virus, it releases a two-legged DNA walker; ② EDC-mediated walking and circulation of the two-legged DNA walker: The released two-legged DNA walker contains a trigger sequence that can initiate the EDC circulation on the DNA hydrogel backbone and walk along the backbone. With the assistance of the fuel chain, the hydrogel decomposes and releases glucosylase and waste chains; ③ Blood glucose meter measurement: The glucosylase released by the DNA hydrogel catalyzes the hydrolysis of amylose outside the gel, producing a large amount of glucose, which can be immediately quantified using a portable blood glucose meter. When the influenza virus is not present, the trigger sequence of the bipedal DNA walker is blocked by the HA aptamer, and the EDC cannot be activated. Therefore, the glucoamylase is stably encapsulated in the DNA hydrogel and physically separated from the amylose in the solution outside the gel.

[0023] Example 1 First, based on the HA (hypoallergenic alpha) on the surface of the influenza A virus, corresponding aptamer sequences were screened. Based on these aptamer sequences, corresponding DNA double-leg walkers were designed. The W1 and W2 strands of the double-leg DNA walker distinguish the double-leg binding region (red), the leg connection region (blue), the aptamer binding region (yellow), and the EDC (Electronic Data Collection) promoter region (green). The sequences in the double-leg binding region are complementary, forming a double-stranded structure. The aptamer binding region can specifically recognize the aptamer sequence. Subsequently, based on the sequence of the EDC promoter region, the base strand, waste strand 1, waste strand 2, and fuel strand of the EDC reaction species were designed, as shown in Table 1.

[0024] Table 1. Aptamer Sequences DNA walker W1 aacgtgatacaaaatcgatcgtgctgtggctttacggtttaaagttcgggaatcgactagctag (SEQ ID NO.2) W2 tttcaagcccttagctgatcgatcccgtaagtacaccttgagggctagctaaaacatagtgcaa (SEQ ID NO.3) hydrogel skeleton Base chain Acrydite-tttttggggaccatccgattaacacatcgttgatcgattttgtatcacgtt (SEQ ID NO.4) Waste chain 1 caaaatcgatcaacgttttt-Acrydite (SEQ ID NO.5) Waste chain 2 cccctggtaggctaattgtgta (SEQ ID NO.6) fuel chain caaaatcgatcaacgatgtgttaatcggatggtcccc-acrydite (SEQ ID NO.7) Preparation of EDC hydrogels: Base chain, waste chain 1, waste chain 2, and fuel chain (1 µM) were added to four centrifuge tubes containing 4% acrylamide in SH-PGM buffer (72.9 mM Na2HPO4, 27.1 mM NaH2PO4, 50 mM NaCl, 5 mM MgCl2, pH=7.3). The tubes were placed in a vacuum desiccator for 10 min to remove air. Then, 1.4% (v / v) of freshly prepared initiator (0.05 g APS dissolved in 0.5 mL ultrapure water) and accelerator (25 µL TEMED dissolved in 0.5 mL ultrapure water) were added. The centrifuge tubes were again placed in a vacuum desiccator to allow the polymerization reaction to proceed under vacuum at 25°C. The four solutions were then mixed in a 1:1:1:1 molar ratio, and a final concentration of 0.5 µg / µL of glucoamylase aqueous solution was added. Before incubating the mixture in a 50°C drying bath for 5 minutes, it needs to be shaken vigorously to ensure that the solution is homogeneous. Then, it is slowly cooled to 25°C to prepare an EDC hydrogel containing glucosylase.

[0025] Example 2 The EDC hydrogel was characterized by SEM, and the results are as follows: Figure 3 As shown in Figure A. The results of the rheological coefficient study are as follows: Figure 3 As shown in Figure B. The results show that both SEM results and rheological coefficient results confirm the successful preparation of the hydrogel and its good gelation properties.

[0026] Feasibility verification of EDC hydrogel detection of HA: The feasibility of this method can be verified by 12% polyacrylamide gel electrophoresis (PAGE) at 120 V for 45 min.

[0027] Assay for the ability of hydrogels to coat glucoamylase: The ability of EDC hydrogels to coat different concentrations of glucoamylase (0 μg / μL, 0.25 μg / μL, 0.5 μg / μL, 1 μg / μL, and 2 μg / μL) was compared. The degradation of amylose (0.625 µg / µL) was monitored using KI / I2 solution, and the results are as follows: Figure 4 As shown in the figure. The results showed that when the hydrogel could not coat too much glucoamylase, the amylase was released into the liquid outside the hydrogel, thereby degrading amylose and making the color of the surrounding liquid lighter. In order to coat as much glucoamylase as possible without leakage, 0.5 μg / μL was selected as the optimal enzyme concentration.

[0028] Feasibility verification of EDC hydrogel detection of HA: The following experiments were all performed in the SH-PGM buffer mentioned above, and the nucleic acid concentration in each lane was 1 µM. Figure 5Lane 1: W1, Lane 2: W2, Lane 3: W1+W2, Lane 4: W1+W2+aptor, Lane 5: W1+W2+aptor+HA; Figure 5 The process of EDC being triggered by the released legs of B in the middle; Figure 5 Lane C: Lane 1: Waste chain 1, Lane 2: Waste chain 2, Lane 3: Basal chain, Lane 4: Basal chain + Waste chain 2, Lane 5: Basal chain + Waste chain 1 + Waste chain 2, Lane 6: Two-legged EDC walker, Lane 7: Fuel chain, Lane 8: Basal chain + Waste chain 1 + Waste chain 2 + Two-legged EDC walker, Lane 9: Basal chain + Waste chain 1 + Waste chain 2 + Two-legged EDC walker + Fuel chain, Lane 10: Basal chain + Waste chain 1 + Waste chain 2 + Two-legged EDC walker + Fuel chain + Aptamer, Lane 11: Basal chain + Waste chain 1 + Waste chain 2 + Two-legged EDC walker + Fuel chain + Aptamer + Fuel chain. The results are as follows... Figure 5 As shown in the experiment, in the absence of the target H1N1 virus surface HA, the bipedal EDC walker was firmly bound to the HA aptamer; in the presence of HA, the bipedal EDC walker was successfully released. Figure 5 A). The EDC process will only be successfully triggered if the released EDCwalker and all EDC components are present. Figure 5 (B and C).

[0029] Example 3 The procedure for detecting HA using EDC hydrogel is as follows: The prepared EDC hydrogel was washed three times with SH-PGM buffer. Residual buffer was removed after washing for long-term storage. During testing, the target compound was mixed with amylose and placed on the gel in a centrifuge tube. SH-PGM buffer containing a double-legged EDC walker and aptamer (1 µM) was added. The mixture was then incubated at 25 °C, gently agitated to promote complete reaction. Afterward, 0.6 µL of the supernatant was taken and the glucose content was determined using PGM, and the data was recorded. To obtain optimal reaction conditions, the reaction temperature, reaction time, Na ion concentration, and K ion concentration were optimized. The specific steps are as follows: The reaction was conducted at magnesium ion concentrations of 1.0–6.0 mM, reaction times of 0.5 h, 0.75 h, 1 h, 1.5 h, and 2 h, and reaction temperatures of 15 °C, 20 °C, 25 °C, 30 °C, 37 °C, and 42 °C. The results are as follows: Figure 6 As shown in the figure. The results indicate that 5.0 mM was selected as the optimal magnesium ion concentration, 1 h as the optimal reaction time, and 37 °C as the optimal reaction temperature.

[0030] Based on optimized reaction conditions, HA at concentrations of 100, 200, 500, 1000, 10000, 50000, and 100000 pM were added for detection, and the detection limit was calculated using the principle of 3 times the SD of the blank control. Subsequently, based on the general detection procedure and optimal reaction conditions, the specificity of the established sensing method was tested by adding surface-specific proteins of H1N1, H5N1, H7N9, novel coronavirus, influenza B virus, and a mixture of the above proteins (100 nM). The results are as follows: Figure 7 As shown. The results show that it has a linear range under the condition of 100pM-1000pM, and the linear fitting equation is Y=0.01991X+1.113, with a fitting exponent R. 2 =0.9971, and the final detection limit was determined to be 18.9 pM based on the principle of 3 times SD. Figure 7 (A, B). Regarding specificity, the results of specific protein detection for other types of viruses showed no significant difference between the target H1N1 group and the mixed group, but a significant difference compared to the control group. This confirms that the sensing method has the ability to accurately identify the H1N1 surface HA, and can accurately identify H1N1 in mixed infection types. Figure 7 C).

[0031] Stability testing: The hydrogel was prepared and stored at 4℃. After storage, the hydrogel was taken out for the detection of different concentrations of HA, and stored for the following times: 12 hours, 24 hours, 2 days, 4 days, and 1 week. The results showed that the hydrogel still had good detection ability after 1 week of storage. Figure 7 D).

[0032] All statistical analyses were performed using SPSS Statistics 23.0 software. Graphical data are presented as mean ± standard deviation. Statistical details of the experiments are included in the legends and in the Results and Discussion sections.

[0033] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims.

Claims

1. A responsive hydrogel detection reagent for entropy-driven bipedal DNA walker walking, characterized in that: The hydrogel detection reagent includes EDC hydrogel, DNA double-legged walker, and aptamer; The DNA bipedal walker consists of two single strands, W1 and W2, with the 3' end of W1 and the 5' end of W2 being complementary. The 5' end of W1 and the 3' end of W2 form the EDC promoter region. An aptamer binding region and a leg connection region are provided between the EDC promoter region and the complementary binding region. The aptamers and the aptamer binding region complement each other to form a closed bipedal walker, which can specifically recognize and bind to viruses. The EDC hydrogel comprises a base chain, waste chain 1, waste chain 2, a fuel chain, and glucosylase. The fuel chain can bind to the EDC initiation region and release waste chain 1. The fuel chain binds to the base chain and releases waste chain 2 and glucosylase. The nucleic acid sequence of the aptamer is shown in SEQ ID NO.1; the nucleic acid sequence of W1 is shown in SEQ ID NO.2; the nucleic acid sequence of W2 is shown in SEQ ID NO.3; the nucleic acid sequence of the base chain is shown in SEQ ID NO.4; the nucleic acid sequence of waste chain 1 is shown in SEQ ID NO.5; and the nucleic acid sequence of waste chain 2 is shown in SEQ ID NO.

6. The EDC hydrogel is prepared as follows: 4 portions of acrylamide SH-PGM buffer are respectively added to the base chain, waste chain 1, waste chain 2 and fuel chain, then an initiator and an accelerator are added. After polymerization, the 4 portions of solution are mixed and a glucose amylase aqueous solution is added. After incubation, the mixture is uniformly mixed and cooled to obtain the EDC hydrogel.

2. The responsive hydrogel detection reagent for entropy-driven bipedal DNA walker walking according to claim 1, characterized in that: The test reagent also includes a linear starch solution.

3. The responsive hydrogel detection reagent for entropy-driven bipedal DNA walker walking according to claim 1, characterized in that: The method of using the detection reagent is to mix the target substance with amylose and place it on EDC hydrogel, add the double-leg EDC walker and aptamer, and then react fully. After the reaction, take the supernatant and determine the glucose content using PGM.

4. The responsive hydrogel detection reagent for entropy-driven bipedal DNA walker walking according to claim 1, characterized in that: The reaction was carried out for 1 hour at a magnesium ion concentration of 5.0 mM and a reaction temperature of 37°C.

Citation Information

Patent Citations

  • CYFRA21-1 enzyme-free cascade amplification detection method based on DNA walker and SDR and application

    CN117247996A