Application of isovitexin in resisting porcine circovirus disease
Isovitexin addresses the shortcomings of existing vaccines and drugs in the prevention and treatment of PCV2 infection by inhibiting PCV2 replication and Cap protein expression, achieving effective antiviral effects, reducing costs, and showing potential for widespread application.
Patent Information
- Application Number
- CN202511337298.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-18
- Publication Date
- 2025-11-04
AI Technical Summary
Existing vaccines have problems in preventing and treating porcine circovirus type 2 (PCV2) infection, including antigenic differences, rapid viral mutation, interference with vaccine efficacy due to mixed infections, and inability to clear the virus from the body. There is also a lack of effective drug treatment options.
Using isovitexin as the active ingredient, this drug is prepared to inhibit the replication and proliferation of PCV2, suppress Cap protein expression, and reduce lung damage caused by viral infection. It is administered via gavage or oral administration.
Isovitexin significantly inhibits PCV2 replication and Cap protein expression, reduces lung pathological damage, lowers drug costs, has a wide range of sources, stable performance and low toxicity, and provides an effective anti-PCV2 treatment option.
Smart Images
Figure HDA0005602777650000011 
Figure HDA0005602777650000012 
Figure HDA0005602777650000021
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of isovitexin in anti-porcine circovirus disease. BACKGROUND
[0002] Porcine circovirus (PCV) belongs to the genus Circovirus of the family Circoviridae, and is the smallest DNA virus ever discovered. The virus has significant immunosuppressive properties, causes various infectious diseases in pig populations, and is prevalent worldwide. It has been listed by the World Organization for Animal Health (OIE) as one of the important pathogens affecting the large-scale farming industry. Among them, porcine circovirus type 2 (PCV2) is the main pathogen causing porcine circovirus-associated diseases (PCVAD). Epidemiological investigations have shown that the infection rate of PCV2 in pig populations continues to rise, and it has become one of the threatening pathogens in the global pig industry.
[0003] At present, the prevention and treatment of PCV2-related diseases mainly focuses on vaccination for prevention. PCV2 Cap protein-based vaccines are the main vaccines on the market, including inactivated vaccines, subunit vaccines, PCV1-PCV2 chimeric vaccines, and baculovirus recombinant vaccines, etc. However, the existing vaccines still face many challenges in practical application: first, the high mutation rate of PCV2 genome may lead to antigenic differences between vaccine strains and epidemic strains; second, vaccine selection pressure may accelerate viral evolution; third, immune cell damage caused by PCV2 infection may affect the immune effect of the vaccine. In addition, mixed infections (such as PRRSV, PPV, etc.) can also interfere with the protective efficacy of the vaccine. More importantly, for pigs that have been infected with PCV2 and have developed the disease, the vaccine cannot eliminate the virus in the pig body. There is almost no effective anti-PCV2 treatment and drug, so it is the urgent desire of all veterinary researchers and practitioners to develop an effective anti-PCV2 drug as soon as possible.
[0004] Natural products have important value in the field of drug research and development. Many drugs on the market are directly or indirectly derived from natural active ingredients. Traditional Chinese medicine has shown unique advantages in antiviral therapy through thousands of years of practice. With the limitations of vaccine application, more and more researches are turning to screening and developing new anti-PCV2 drugs from traditional Chinese medicine and active ingredients, in order to provide more effective solutions for PCV2 prevention and control.
[0005] Isovitexin (IV), also known as isovitexin or apigenin-6-C-glucoside, is a yellow powder; molecular formula: C 21 H22 O 10 ; molecular weight: 432; belongs to the active carbon glycoside flavonoids. Isovitexin is widely distributed in the plant kingdom, mainly exists in the grass family plants (such as corn silk, leaves, rice seedlings, rice hulls, wheat leaves, etc.), legume plants (such as the flower bud, branches and leaves of sophora, acacia flower, root of astragalus, etc.), also exists in the leaves and fruits of the plant of the Verbenaceae family (such as the vitex). Isovitexin has the advantages of convenient extraction, stable performance, high bioavailability, weak or even no toxicity, etc. A large number of studies have shown that isovitexin has various pharmacological activities, including hypoglycemic, antioxidant, anti-inflammatory, anti-apoptotic, antibacterial, etc., but there is no report on the application of isovitexin in antiviral. SUMMARY
[0006] In view of the problems and deficiencies in the prior art, the purpose of the present application is to provide the application of isovitexin in the prevention, alleviation or / and treatment of porcine circovirus disease.
[0007] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:
[0008] The present application provides the application of isovitexin in the preparation of a medicine for preventing, alleviating or / and treating porcine circovirus infection.
[0009] According to the above-mentioned application, preferably, the porcine circovirus is porcine circovirus type 2 (PCV2).
[0010] The present application provides the application of isovitexin in the preparation of a medicine for inhibiting the replication or / and proliferation of porcine circovirus.
[0011] According to the above-mentioned application, preferably, the porcine circovirus is porcine circovirus type 2 (PCV2).
[0012] The present application provides the application of isovitexin in the preparation of a medicine for inhibiting the expression of porcine circovirus Cap protein.
[0013] According to the above-mentioned application, preferably, the porcine circovirus is porcine circovirus type 2 (PCV2).
[0014] The present application provides a medicine, which comprises an effective component, the effective component being isovitexin; the medicine is used for preventing, alleviating or / and treating porcine circovirus infection, or / and inhibiting the replication or / and proliferation of porcine circovirus, or / and inhibiting the expression of porcine circovirus Cap protein.
[0015] According to the above-mentioned medicine, preferably, the medicine further contains a pharmaceutically acceptable adjuvant.
[0016] According to the above-mentioned medicine, preferably, the medicine is administered by the method of intragastric administration or oral administration.
[0017] Compared with the prior art, the positive beneficial effects achieved by the present application are as follows:
[0018] The present application first discovers that isovitexin has the effect of resisting porcine circovirus (especially PCV2) through in vitro and in vivo experiments, can significantly inhibit the proliferation and replication of PCV2, can also inhibit the expression of PCV2 Cap protein, and can reduce the pathological damage of the lung caused by porcine circovirus infection. This discovery not only expands the medicinal value of isovitexin, but also lays an important foundation for developing an efficient and low-toxicity anti-PCV2 drug. In addition, isovitexin has the advantages of wide source, convenient extraction, stable performance, high bioavailability, weak or even no toxicity, etc. The use of isovitexin for preventing, alleviating or / and treating porcine circovirus infection can effectively reduce the cost of medication, is economically feasible, and has potential application prospects. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 is the detection result of the toxicity of isovitexin on PK-15 cells;
[0020] Figure 2 is the detection result of the toxicity of ribavirin on PK-15 cells;
[0021] Figure 3 is the q-PCR detection result of the inhibitory effect of isovitexin at different concentrations on PCV2 on PK-15 cells; wherein, MOCK represents a normal control group (i.e. PK-15 cells are not infected with 1.0 MOI PCV2); and PCV2 represents a PCV2 group (i.e. PK-15 cells are infected with 1.0 MOI PCV2, but are not treated with isovitexin);
[0022] Figure 4 is a result graph of the Western blot detection of the influence of isovitexin on the expression of PCV2 Cap protein; wherein, control represents a normal control group (i.e. PK-15 cells are not infected with PCV2); IV represents isovitexin; H represents an isovitexin treatment concentration of 100 μg / mL; M represents an isovitexin treatment concentration of 50 μg / mL; and L represents an isovitexin treatment concentration of 25 μg / mL;
[0023] Figure 5 is an experimental scheme of the treatment of PCV2 infected mice with isovitexin;
[0024] Figure 6 is a detection result of the influence of isovitexin on the viral load of PCV2 infected mice by q-PCR detection;
[0025] Figure 7 is a detection result of the influence of isovitexin on the lung tissue pathology of PCV2 infected mice;
[0026] Figure 8 This is an experimental protocol for the treatment of PCV2-infected piglets with isovitexin;
[0027] Figure 9 The results of q-PCR detection of the effect of isovitexin on the viral load of PCV2 virus-infected piglets;
[0028] Figure 10 The results show the effects of isovitexin on the pathological characteristics of lung tissue in piglets infected with PCV2 virus. Detailed Implementation
[0029] The following detailed description is exemplary and intended to provide further illustration of the invention. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0030] Unless otherwise specified, the experimental methods in the following examples all employ conventional techniques in this technical field or follow the conditions recommended by the manufacturer; reagents or instruments whose manufacturers are not specified are all commercially available products.
[0031] To enable those skilled in the art to better understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below with reference to specific embodiments.
[0032] Example 1: Investigation of the cytotoxicity of isovitexin
[0033] The cytotoxicity of isovitexin was detected using a CCK-8 assay. The specific procedure is as follows:
[0034] With 2.0×10 4 PK-15 cells were seeded into 96-well plates at a rate of 100 cells / well. After cell adhesion, the culture medium was aspirated, and 100 μL of medium containing different concentrations of vitexin (0, 6.25, 12.5, 25, 50, 100, 200 μg / mL) was added to each well. The plates were then incubated at 37°C for 24 h. After 24 h of incubation, 10 μL of CCK-8 solution was added to each well, and the plates were incubated at 37°C in the dark for 1 h. The absorbance at 450 nm was measured using a microplate reader, and cell viability was calculated. Results are shown below. Figure 1 As shown.
[0035] Depend on Figure 1 It is known that the maximum safe concentration of isovitexin for PK-15 cells is 100 μg / mL. This indicates that isovitexin exhibits low cytotoxicity and high safety within this concentration range.
[0036] Example 2: Investigation of the cytotoxicity of isovitexin
[0037] The cytotoxicity of ribavirin was detected using the CCK-8 assay. The specific procedure is as follows:
[0038] With 2.0×10 4 PK-15 cells were seeded into 96-well plates at a rate of 100 cells / well. After cell adhesion, the culture medium was aspirated, and 100 μL of medium containing different concentrations of ribavirin (0, 0.25, 0.5, 1, 2, 4 mg / mL) was added to each well. The plates were then incubated at 37°C for 24 h. After 24 h of incubation, 10 μL of CCK-8 solution was added to each well, and the plates were incubated at 37°C in the dark for 1 h. The absorbance at 450 nm was measured using a microplate reader, and cell viability was calculated. Results are shown below. Figure 2 As shown.
[0039] Depend on Figure 2 It is known that the maximum safe concentration of ribavirin against PK-15 is 0.5 mg / mL.
[0040] Example 3: Study on the in vitro anti-porcine circovirus type 2 (PCV2) effect of isovitexin
[0041] 1. q-PCR detection of the inhibitory effect of vitexin on PCV2 activity
[0042] (1) Experimental method:
[0043] PK-15 cells were seeded in 6-well plates. When the cells reached 70%-80% confluence, they were infected with 1.0 MOI IPCV2 for 2 hours. The medium was then replaced with fresh culture medium containing different concentrations of vitexin (0, 6.25, 12.5, 25, 50, and 100 μg / mL) and incubated at 37°C for 24 hours. After incubation, the cell supernatant was collected, and the cells were subjected to three freeze-thaw cycles to extract viral DNA for q-PCR detection. The primers used for q-PCR are shown in Table 1, and the q-PCR reaction system is shown in Table 2. The thermal cycling conditions for q-PCR were as follows: denaturation at 95°C for 3 min, followed by 5 s at 95°C and 30 s at 60°C, for a total of 40 cycles; followed by melting curve analysis at 55°C for 30 s. Each reaction was performed in triplicate, and the experiment was repeated at least three times.
[0044] Ribavirin was used as a control in this experiment. The ribavirin control group was treated as follows: PK-15 cells were seeded in 6-well plates. When the cells reached 70%-80% confluence, they were infected with 1.0 MOI IPCV2 for 2 hours, then the medium was replaced with fresh medium containing 0.5 mg / mL ribavirin and cultured at 37°C for 24 hours. After culture, the cell supernatant was collected, and the cells were subjected to three freeze-thaw cycles to extract viral DNA for q-PCR detection.
[0045] Table 1 shows the sequences of the target gene primers used for q-PCR detection.
[0046] Gene Sequences Size(bp) PCV2-F ATAACCCAGCCCTTCTCCTACC 22 PCV2-R GGCCTACGTGGTCTACATTTCC 22
[0047] Table 2 is the reaction system of q-PCR
[0048] Component Volume PCV2-F 0.5uL PCV2-R 0.5uL SYBR Premix Ex Taq 10.0uL Template 2.0uL DEPC H20 7.0uL Total 20.0uL
[0049] (2) Experimental results:
[0050] The q-PCR detection results are shown in Figure 3 It can be seen from Figure 3 that the DNA copy number of PCV2 in the isofraxidilin treatment group is significantly lower than that of the PCV2 infected control group, and shows a dose-dependent manner.
[0051] 2, Western blot detection of the effect of isofraxidilin on PCV2 Cap protein expression
[0052] (1) Experimental method:
[0053] PK-15 cells were plated in a 6-well plate, and when the cells grew to 70%-80%, the PK-15 cells were infected with 1.0 MOI PCV2 for 2h, and then replaced with fresh medium containing different concentrations of isofraxidilin (25, 50, 100 μg / mL), and cultured at 37°C for 24h. After the culture ended, the cells were collected, treated with RIPA lysis buffer, and total protein was extracted. The protein concentration was determined by BCA protein quantitative determination kit, and the expression of PCV2 Cap protein was detected by Western blot.
[0054] (2) Experimental results:
[0055] The Western blot detection results are shown in Figure 4 Compared with the PCV2 group, the expression of PCV2 Cap protein was reduced after isofraxidilin treated PCV2 infected cells for 24h, and the inhibitory effect increased with the increase of isofraxidilin concentration.
[0056] Example 4: Study on the therapeutic effect of isofraxidilin on PCV2 infected mice
[0057] 1. Experimental method:
[0058] 18 healthy C57BL / 6 (18±2g) male mice were taken, and after adaptive feeding for 3 days, they were randomly divided into 3 groups according to body weight, namely Mock group (normal control group), PCV2 group (model control group) and PCV2+IV group. Except for the Mock group, the PCV2 group and the PCV2+IV group of mice were injected intraperitoneally with 0.5 mL of PCV2 (10 5.5 TCID 50mL) suspension to establish the infection model; 7 days after the infection, the PCV2+IV group of mice were given the isofraxidin solution (the preparation method of the isofraxidin solution was as follows: isofraxidin was prepared into a storage stock solution of 100 mg / mL using DMSO as a solvent, and then the storage stock solution was diluted with normal saline to obtain the isofraxidin solution) by gavage, once a day, and the gavage dose was 5 mg / kg of body weight, and the gavage was continuously performed for 28 days (see Figure 5 ); the PCV2 group was given 2% DMSO and normal saline by gavage, once a day, and the gavage was continuously performed for 28 days; the Mock group was given normal saline by gavage, once a day, and the gavage was continuously performed for 28 days. During the experiment, the state, morbidity and death of the mice in each group were monitored and recorded. At the end of the experiment, the mice were eye bled to collect serum, and then the mice were sacrificed to take lung tissues; the collected serum samples were subjected to q-PCR detection (the q-PCR detection method was the same as that in Example 3), and the lung tissues of the mice were fixed with 4% paraformaldehyde and subjected to HE staining for pathological examination.
[0059] 2, Experimental results:
[0060] During the experiment, the morbidity and death of the mice in each group were counted and the results are shown in Table 3.
[0061] Dose(mg / kg) Number of animals Number of death Survival rate(%) PCV2+IV group 6 0 100 Mock group 6 0 100 PCV2 group 6 0 100
[0062] As shown in Table 3, the mice in each group were in good condition, and no death occurred, indicating that isofraxidin had no obvious toxicity to the mice at the experimental dose.
[0063] The serum q-PCR detection results of the mice in each group are shown in Table 4. Figure 6 As shown in Table 4, compared with the PCV2 group of mice, the PCV2 DNA copy number in the serum of the mice in the isofraxidin gavage group was significantly reduced, and the difference was statistically significant. Figure 6
[0064] The HE staining results of the lung tissues of the mice in each group are shown in Table 5. Figure 7 As shown in Table 5, the mice in the PCV2 group had severe lung lesions characterized by interstitial pneumonia, and the lung injury of the mice in the PCV2+IV group was significantly reduced after treatment with isofraxidin. This result shows that isofraxidin can significantly reduce lung injury caused by PCV2 infection. Figure 7 Example 5: Study on the treatment effect of isofraxidin on PCV2 infected pigs
[0065] 1, Experimental method:
[0066]
[0067] Six healthy 4-week-old piglets were randomly divided into two groups after a 3-day acclimatization period: a PCV2 group (PCV2 infection group) and a PCV2+IV group (drug treatment group). Piglets in both the PCV2 and PCV2+IV groups were inoculated with PCV2 (10 mg / L) via eye drop or nasal drop. 6 TCID 50 An infection model was established by administering a suspension of 1 mg / kg isovitexin (1 mg / kg, added to every 1 kg of piglet feed and dried into shape) to the PCV2+IV group 7 days post-infection. The PCV2 group was fed normal piglet feed. The administration was once daily for 28 consecutive days (see [link to relevant documentation]). Figure 8 During the experiment, the incidence and mortality of piglets in each group were monitored and recorded. At the end of the experiment, the piglets were euthanized, serum was collected, and lung tissue was taken. The collected serum samples were subjected to q-PCR detection (the q-PCR detection method was the same as in Example 3), and the lung tissue was fixed with 4% paraformaldehyde and then subjected to HE staining for pathological examination.
[0068] 2. Experimental Results:
[0069] The statistical results of morbidity and mortality of piglets in each group during the experiment are shown in Table 4.
[0070] Dose(mg / kg) Number of animals Number of death Survival rate(%) PCV2+IV group 3 0 100 PCV2 group 3 0 100
[0071] As shown in Table 4, all piglets in each group were in good condition and none died, indicating that isovitexin has no obvious toxicity to piglets at the experimental dose.
[0072] Serum q-PCR test results of each group of piglets are as follows: Figure 9 As shown. By Figure 9 It can be seen that, compared with the PCV2 group piglets, the PCV2+IV group piglets had significantly lower serum PCV2 DNA copy number, and the difference was statistically significant.
[0073] HE staining results of lung tissue from each group of piglets are as follows: Figure 10 As shown. By Figure 10 The results showed that piglets in the PCV2 group developed severe lung lesions characterized by interstitial pneumonia, while piglets in the PCV2+IV group experienced a significant reduction in lung damage after treatment with isovitexin. These results indicate that isovitexin can significantly alleviate lung damage in piglets caused by PCV2 infection.
[0074] The above description illustrates the embodiments of the present invention. By describing the disclosed embodiments, those skilled in the art are able to implement or use the present invention, and it is not intended to limit the present invention. The various aspects of the present invention cannot be fully embodied in the above embodiments. Any equivalent changes or modifications made by those skilled in the art without departing from the spirit or scope of the present invention fall within the protection and disclosure scope of the present invention.
Claims
1. Application of isovitexin in the preparation of drugs for the prevention, relief and / or treatment of porcine circovirus infection.
2. Application of isovitexin in the preparation of drugs that inhibit the replication and / or proliferation of porcine circovirus.
3. Application of isovitexin in the preparation of drugs that inhibit the expression of porcine circovirus Cap protein.
4. The application according to any one of claims 1-3, characterized in that, The porcine circovirus in question is porcine circovirus type 2.
5. A drug, characterized in that, The drug contains an active ingredient, which is vitexin, and the drug is used to prevent, alleviate, and / or treat porcine circovirus infection.
6. The drug according to claim 5, characterized in that, The drug also contains pharmaceutically acceptable excipients.
7. The drug according to claim 5, characterized in that, The drug is administered by gavage or oral administration.