Use of akkermansia massiliensis lta21f2 in the preparation of products for combating aging and prolonging life

Abstract

This invention discloses the application of Akkermansia massiliensis LTA21F2 in the preparation of anti-aging and life-extending products, belonging to the field of microbial technology. This strain was deposited on December 4, 2022, at the Guangdong Provincial Microbial Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 63035. The Akkermansia massiliensis LTA21F2 provided by this invention can increase the survival rate of 24-month-old naturally aging mice by 30%, and enhance immunity and maintain normal healthy vital signs by improving oxidative stress levels, inflammation levels, and liver function indicators in aging mice; it also plays a role in anti-aging and life-extending by enhancing the integrity of the colonic barrier function and regulating the intestinal flora.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to... Akkermansia massiliensis Application of LTA21F2 in the preparation of anti-aging and life-extending products. Background Technology

[0002] The human gut contains approximately 100 trillion microorganisms, which play a crucial role in maintaining the host's health and normal physiological processes. Among them, probiotics can colonize the gut and have various beneficial effects on the host. In recent years, scholars from multiple countries have discovered that Akkermansia (… Akkermansia Akkermansia myxophilus (AKK strain), as a representative of the new generation of probiotics, has become a research hotspot in the study of gut microbiome health function due to the correlation between its abundance and various human diseases. Akkermansia muciniphila Akkermansia (*Akkermansia* var. *milliflora*) is a representative species of the genus *Akkermansia*, first isolated by Derrien et al. in 2004, and constitutes 3-5% of the human gut microbiota. This bacterium has been reported to have various health benefits, including the treatment of obesity, metabolic syndrome, inflammatory bowel disease, and diabetes, as well as adjuvant therapy for tumor immunotherapy and anti-aging effects. However, it differs from *Akkermansia myxophilus* (*Akkermansia* var. *milliflora*). Akkermansia muciniphila ), Akkermansia massiliensis (This bacterium does not yet have a clear Chinese name; this article temporarily refers to it as *Ackermania marcescens* subsp. *mars*.) It is a new species of *Ackermania* discovered in December 2022 by Sokhna Ndongo et al. (DOI: 10.1038 / s41598-022-25873-0). This bacterium belongs to the phylum *Verrucomicrobiota*, class *Verrucomicrobiae*, order *Verrucomicrobiales*, family *Akkermansiaceae*, and genus *Ackermania*. Akkermansia In June 2024, Ritesh Kumar et al. reported... Akkermansia sp. DSM 33459 and the type strain A. mucinipphila ATCC 835 exhibited an average nucleotide identity of 87.5% and significant differences in fatty acid profiles and carbon source utilization (cells, DOI: 10.3390 / cells11132084), further clarifying its phenotypic and phylogenetic position. Akkermansia The next new species (i.e.) Akkermansia massiliensis It has the potential to be developed into the next generation of probiotics that are beneficial to the body's health.

[0003] Akkermansia, a strict anaerobic bacterium, has demanding requirements for nutrient utilization, grows slowly, and has a low viable count in its culture medium. On the one hand, AKK bacteria have low oxygen tolerance; Becken et al. reported that some AKK isolates had a survival rate of 60% after 24 hours of oxygen exposure, while other strains were extremely sensitive to oxygen, with a survival rate of <0.01% after 12 hours (mBio, DOI: 10.1128 / mBio.00478-21). On the other hand, cultivation is difficult; the high-density AKK culture method invented by Zhang Yixuan et al. achieved a viable count of 10-1. 10 The CFU / mL concentration (CN110079474B) represents a significant improvement over previous concentrations, but limitations remain for large-scale industrial production. Therefore, identifying strains with high oxygen tolerance and developing techniques for producing high-density AKK strains have become key technological bottlenecks and areas of exploration for the next generation of probiotic resource discovery and industrial production. To date, no reports have been found in China regarding live Akkermansia muciniphila subsp. marsupialis preparations and their applications, nor have any research reports been found on the anti-aging effects of this strain. Summary of the Invention

[0004] The purpose of this invention is to provide Akkermansia massiliensis The application of LTA21F2 in the preparation of anti-aging and life-extending products aims to solve the problems existing in the above-mentioned prior art.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] One of the technical solutions of this invention, Akkermansia massiliensis The application of LTA21F2 in the preparation of anti-aging and life-extending products: This strain was deposited on December 4, 2022 at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 63035.

[0007] The second technical solution of this invention is a product for anti-aging and life extension, comprising: Akkermansia from Marseille LTA21F2.

[0008] The third technical solution of the present invention Akkermansia massiliensis Application of LTA21F2 in the preparation of products that improve learning and memory abilities.

[0009] The fourth technical solution of this invention is a product for improving learning and memory abilities, comprising: Akkermansia from Marseille LTA21F2.

[0010] The fifth technical solution of the present invention Akkermansia massiliensisApplication of LTA21F2 in the preparation of drugs that enhance the antioxidant level of brain tissue and reduce inflammatory response.

[0011] The sixth technical solution of this invention is a drug that enhances the antioxidant level of brain tissue and reduces inflammatory response, comprising: Akkermansia massiliensis LTA21F2.

[0012] The seventh technical solution of this invention, Akkermansia massiliensis Application of LTA21F2 in the preparation of products that enhance colonic barrier integrity and regulate gut microbiota.

[0013] The eighth technical solution of the present invention is a product that enhances the integrity of the colonic barrier and regulates the intestinal flora, the product comprising: Akkermansia massiliensis LTA21F2;

[0014] The product in question is a medicine.

[0015] Based on the above technical solution, the present invention has the following technical effects:

[0016] (1) The present invention Akkermansia massiliensis LTA21F2 exhibits excellent oxygen resistance and a high viable count, maintaining a survival rate of over 90% after 12 hours of air exposure. During pilot-scale production, the viable count in the fermentation broth obtained from fermentation in a 200 L fermenter reached 10... 15 The viable cell count of the lyophilized powder obtained from the fermentation broth sample after centrifugation can reach 10 CFU / mL or higher. 16 CFU / g or higher.

[0017] (2) The screening results obtained by this invention Akkermansia massiliensis LTA21F2 has a characteristic sequence that can serve as a specific molecular recognition marker for this strain.

[0018] (3) The screening results obtained by this invention Akkermansia massiliensis LTA21F2 significantly improved the health signs of mice, extended the survival rate of 24-month-old naturally aging mice by 30%, significantly improved oxidative stress levels in aging mice, reduced systemic inflammation levels, enhanced immunity, and significantly reduced aspartate aminotransferase levels in aging mice. It also restored glucose levels in naturally aging mice to normal levels, which is beneficial for maintaining normal vital signs in mice.

[0019] (4) The screening results obtained by this invention Akkermansia massiliensisLTA21F2 can improve anxiety levels and learning and memory abilities in aging mice, prevent hippocampal damage in aging mice, and enhance the antioxidant level and reduce inflammatory response of brain tissue. It can also regulate the histopathological characteristics of colon tissue in aging mice, colonize in naturally aging mice and make their gut microbiota pattern tend to be younger, thus having a certain regulatory and improving effect on the gut microbiota of naturally aging mice. Attached Figure Description

[0020] Figure 1 Gram staining diagram of AKK-LTA21F2.

[0021] Figure 2 This is a colony morphology diagram of AKK-LTA21F2.

[0022] Figure 3 Phylogenetic tree of AKK-LTA21F2.

[0023] Figure 4 The complete genome map of AKK-LTA21F2 is shown.

[0024] Figure 5 This is a molecular marker specific to AKK-LTA21F2. A represents the gel electrophoresis results of PCR amplification using AKK genus-specific primers (corresponding to uppercase letters) and AKK-LTA21F2 strain characteristic sequence primers (corresponding to lowercase letters), respectively. B represents the gel electrophoresis results of PCR amplification products from various strains using AKK-LTA21F2 characteristic sequence primers.

[0025] Figure 6 The tolerance of AKK-LTA21F2 to oxygen exposure and its adaptability to hydrogen peroxide stress are shown in Figure A. Figure A represents the colony growth of the same gradient counting plate after 12 h of exposure to air, and Figure B represents the colony growth of AKK-LTA21F2 after 2 h of growth in liquid medium containing 1.5 M H2O2.

[0026] Figure 7 The carbon source utilization characteristics of AKK-LTA21F2.

[0027] Figure 8 Results of viable cell count in the expanded culture fermentation broth of AKK-LTA21F2.

[0028] Figure 9 Results of viable cell count for AKK-LTA21F2 culture to produce freeze-dried bacterial powder.

[0029] Figure 10 The effect of AKK-LTA21F2 intervention on the survival rate of aging mice.

[0030] Figure 11The effect of AKK-LTA21F2 intervention on aging-related biomarkers in aging mice was investigated. A represents serum oxidative stress markers, B represents serum inflammatory factors, and C represents serum biochemical markers.

[0031] Figure 12 The image shows the effect of AKK-LTA21F2 intervention on the improvement of anxiety levels in aging mice. In the image, A represents the mouse's walking trajectory in the open field experiment, B represents the number of times the mouse entered the center, C represents the total distance the mouse traveled, and D represents the number of times the mouse stood upright on its hind limbs.

[0032] Figure 13 The effect of AKK-LTA21F2 intervention on the learning and memory abilities of aging mice is shown. A represents the trajectory of mice in the water maze experiment; B represents the escape latency of mice in the water maze experiment over 5 consecutive days; C represents the time mice spent in the target quadrant; and D represents the number of times mice crossed the platform.

[0033] Figure 14 The effects of AKK-LTA21F2 intervention on oxidative stress and inflammatory factors in the brain tissue of aging mice were investigated. In this study, A represents an indicator of oxidative stress in mouse brain tissue, and B represents an indicator of inflammatory factors in mouse brain tissue.

[0034] Figure 15 The effect of AKK-LTA21F2 intervention on the histopathology of colon tissue in aging mice. A represents an indicator of oxidative stress in mouse brain tissue, and B represents an indicator of inflammatory factors in mouse brain tissue.

[0035] Figure 16 The effect of AKK-LTA21F2 intervention on the gut microbiota of mice is shown. Among them, A represents the phylum level composition of the gut microbiota of the three groups of mice, B represents the family level composition of the gut microbiota of the three groups of mice, and C represents the genus level composition of the gut microbiota of the three groups of mice. Detailed Implementation

[0036] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the field, and the reagents or raw materials used are all purchased from commercial channels or are publicly available unless otherwise specified.

[0037] This invention provides a plant Akkermansia massiliensis LTA21F2 strain was deposited on December 4, 2022, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 63035.

[0038] This invention also provides a microbial inoculant, comprising the aforementioned... Akkermansia from Marseille LTA21F2.

[0039] This invention also provides a method for preparing the microbial inoculant, comprising the following steps: [The text abruptly ends here, likely due to an incomplete sentence or missing information.] Akkermansia from Marseille The LTA21F2 fermentation broth was centrifuged to obtain bacterial sludge; the freeze-dried product protectant was mixed with the bacterial sludge at a mass ratio of 20:1 and then freeze-dried to obtain the freeze-dried microbial agent powder.

[0040] In some specific implementations, the freeze-dried product protectant includes skim milk powder, sucrose, and trehalose; the mass ratio of the milk powder, sucrose, and trehalose is 6:1:1; and the mass ratio of the freeze-dried product protectant to the bacterial sludge is 20:1.

[0041] The embodiments of the present invention also provide Akkermansia massiliensis Application of LTA21F2 or the aforementioned microbial agent in the preparation of anti-aging and life-extending products.

[0042] In some specific implementation schemes, the Akkermansia massiliensis LTA21F2 enhances immunity and maintains normal healthy vital signs by improving oxidative stress levels, inflammation levels, and liver function indicators; it also plays a role in anti-aging and prolonging life by enhancing the integrity of the colonic barrier and regulating the gut microbiota.

[0043] This invention also provides an anti-aging and life-extending product, including the aforementioned... Akkermansia from Marseille LTA21F2 or the aforementioned microbial agent.

[0044] The embodiments of the present invention also provide the above. Akkermansia massiliensis The use of LTA21F2 or the aforementioned microbial agent in the preparation of drugs for the prevention and treatment of anxiety.

[0045] This invention also provides a drug for preventing and treating anxiety, comprising the aforementioned... Akkermansia from Marseille LTA21F2 or the aforementioned microbial agent

[0046] The embodiments of the present invention also provide the above. Akkermansia massiliensis Application of LTA21F2 or the aforementioned microbial agent in the preparation of products that improve learning and memory abilities.

[0047] This invention also provides a product for improving learning and memory abilities, including the aforementioned... Akkermansia massiliensis LTA21F2 or the aforementioned microbial agent.

[0048] The embodiments of the present invention also provide the above. Akkermansia massiliensis The use of LTA21F2 or the aforementioned microbial agent in the preparation of drugs that enhance the antioxidant level of brain tissue and reduce inflammatory response.

[0049] This invention also provides a drug that enhances the antioxidant level of brain tissue and reduces inflammatory responses, comprising the aforementioned... Akkermansia massiliensis LTA21F2 or the aforementioned microbial agent.

[0050] The embodiments of the present invention also provide Akkermansia massiliensis Application of LTA21F2 in the preparation of products that enhance colonic barrier integrity and regulate gut microbiota.

[0051] This invention also provides a product for enhancing colonic barrier integrity and regulating gut microbiota, the product comprising... Akkermansia massiliensis LTA21F2;

[0052] The product in question is a medicine.

[0053] The embodiments of the present invention also provide the above. Akkermansia massiliensis Application of LTA21F2 or the aforementioned microbial agent in the preparation of products that enhance the body's immunity.

[0054] This invention also provides a product for enhancing the body's immunity, the product comprising the aforementioned... Akkermansia massiliensis LTA21F2 or the aforementioned microbial agent;

[0055] The product in question is a medicine.

[0056] The present invention provides Akkermansia massiliensis LTA21F2 can increase the survival rate of 24-month-old naturally aging mice by 30%, and enhance immunity and maintain normal healthy vital signs by improving oxidative stress, inflammation and liver function in aging mice. It can also play an anti-aging and life-extending role by enhancing the integrity of colonic barrier function and regulating intestinal flora, providing a theoretical basis for its product preparation and application in the field of anti-aging.

[0057] In the specific embodiments of this invention, all experimental results are expressed as mean ± standard deviation (Means ± SD). Statistical analysis was performed using one-way analysis of variance (One-way ANOVA), etc.

[0058] Example 1

[0059] Isolation, screening and identification of Akkerman strains

[0060] 1. Isolation and morphological identification of Akkermansia.

[0061] Weigh 1.0 g of frozen fecal sample collected from healthy long-lived elderly individuals (100-109 years old) in the core longevity area of ​​Guangxi Zhuang Autonomous Region, add it to a test tube containing 9.0 mL of sterile PBS buffer, and perform a 10-fold serial dilution to obtain an appropriate dilution gradient. Pour plates onto modified BHI solid medium (containing vancomycin), spread 100 µL of the sample dilution onto the modified BHI solid medium plates, and incubate anaerobically at 37 ℃ for 56 h or more. Select small, isolated colonies that are free of surrounding bacteria, have a smooth surface, are clearly round, and have well-defined edges. Gram stain the selected colonies and observe them under a regular optical microscope. Select Gram-negative samples (showing safranin color) that are short strips or ovals as suspected strains. Figure 1 ).

[0062] 2. Identification of specific primers

[0063] The selected suspected strains were streaked, purified, and preserved in glycerol, and then sequenced for identification using AKK-specific primers. Single colonies of the suspected strains were selected as templates, and colony PCR amplification was performed using Akkermansia genus-specific primers. The PCR products were then subjected to gel electrophoresis. Observing the electrophoresis results, if a single, bright band appeared at 327 bp, the colony could be preliminarily identified as a suspected AKK strain.

[0064] Single colonies of the preliminarily identified AKK bacteria were inoculated into modified BHI liquid medium and cultured at 37°C in an anaerobic workstation. The bacterial culture was then stored and numbered LTA21F2.

[0065] 3. 16S rDNA sequencing

[0066] Genomic DNA was extracted from LTA21F2 and used as a template for polymerase chain reaction (PCR) amplification. Universal 16S rDNA primers were used for amplification: forward primer 27F (5'-AGAGTTGATCCTGGCTCAG-3') and reverse primer 1492R (5'-GGCTACCTTGTTACGACTT-3'). After the amplification reaction, a bright band at 1500 bp was observed in the amplified product by agarose gel electrophoresis, indicating successful PCR amplification. The purified PCR product was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing to obtain the 16S rDNA sequence of LTA21F2. The sequence was aligned using BLAST on NCBI, confirming the strain as a 16S rDNA. Akkermansia massiliensis .

[0067] The 16S rDNA sequence of strain AKK-LTA21F2 is as follows:

[0068]

[0069] The AKK-LTA21F2 strain was deposited on December 4, 2022, at the Guangdong Provincial Center for Microbial Culture Collection, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, with accession number GDMCC No: 63035.

[0070] Example 2

[0071] AKK-LTA21F2 whole genome sequencing

[0072] 1. Basic characteristics

[0073] Genomic DNA was extracted from strain LTA21F2 and its whole genome was sequenced. Figure 4 A complete genome loop map of LTA21F2 was presented, revealing that the LTA21F2 genome is a circular chromosome with a size of 3,024,590 bp and an average GC content of 58.16%. The genome was predicted to contain 2,720 protein-coding regions, accounting for 87.60% of the total gene length. It does not contain plasmids, but includes 8 non-coding RNAs, 53 tRNAs, and 3 5S, 16S, and 23S rRNA genes.

[0074] 2. Phylogenetic tree

[0075] This invention used KNSP to classify the genomes of 29 species belonging to the Akkermansiaceae family and constructed a phylogenetic tree using NJ. For example... Figure 3 As shown, the sequenced Ackermann strains can be divided into three major branches. Among them, strain LTA21F2 and Marseille-P9185 GCF are located in the same branch, and their evolutionary relationship is the most recent. Roseibacillus persicicus and Prosthecobacter fluviatilis It is the most distantly related to the evolutionary order.

[0076] and Akkermansia massiliensis There are 18 strains of LTA21F2 in the same cluster, which include strains of the same level. Akkermansia massiliensis Strains, also at the species level Akkermansia muciniphila The presence of strains indicates a close evolutionary relationship among them. Furthermore, excluding non-AKK strains of *Verrucae* and strain LTA21F2, only 15 strains were included, along with their collection dates, country of origin, and source information. These 15 strains were all of human origin and exhibited a wide geographical distribution, covering a total of 5 countries (9 strains from the United States, 2 from China, 2 from France, 1 from Japan, and 1 from South Korea). These results suggest that *Akkermansia* exhibits diverse evolutionary pathways and mechanisms.

[0077] 3. Gene function

[0078] 3.1 COG functional gene annotation

[0079] Genes predicted from the sequenced *AKK* strain were compared with the COG functional database using eggNOG-mapper to determine the COG categories of different genes. A COG functional annotation map was then generated using R. *AKK* has 2720 CDSs, of which 1610 genes were annotated to the COG functional database. Excluding genes annotated as having unknown functions, the cell wall / membrane / envelope biogenesis branch had the most genes (204, 10.78%). 174 genes were involved in amino acid transport and metabolism (9.19%), 153 genes were involved in translation, ribosomal structure, and biogenesis (8.08%), and 141 genes were involved in carbohydrate transport and metabolism (7.45%). However, some functions involve fewer genes; for example, only 18 genes are involved in cell motility, and 2 genes are involved in the cytoskeleton. A considerable number of genes are annotated for the transport or metabolism of amino acids or carbohydrates, laying the genetic foundation for the metabolic synthesis capabilities of this strain.

[0080] 3.2 KEGG functional gene annotation

[0081] KEGG annotations broadly categorize gene functions into seven classes: Human Diseases, Metabolism, Organismal Systems, Brite Hierarchies, Cellular Processes, Environmental Information Processing, and Genetic Information Processing. Among the gene annotations collected by KEGG and detectable fragments from the AKK-LTA21F2 strain, the majority of annotations focus on Cellular Processes, followed by Brite Hierarchies. Among these, Human Diseases annotations are relatively few, with a total of 91 genes annotated, accounting for 4.10% of the total annotations. These include Drug resistance: antimicrobial, ancer: overview, Infectious disease: bacterial, Endocrine and metabolic disease, Drug resistance: antineoplastic, Cancer: specific types, Neurodegenerative disease, Infectious disease: viral, and Cardiovascular disease. Except for Drug resistance: antimicrobial, which has a relatively high annotation volume, the annotation volumes of the others are quite similar. In addition, the largest number of genes are classified as encoding metabolism, with 1059 genes. These mainly include carbohydrate metabolism, amino acid metabolism, glycan biosynthesis and metabolism, and vitamin and cofactor metabolism. The large number of genes involved in the strain's metabolism also gives the strain good probiotic properties, allowing it to influence the immune system and exert immunomodulatory functions through metabolites.

[0082] Example 3

[0083] AKK-LTA21F2 strain simulated gastrointestinal tolerance experiment

[0084] For probiotics to colonize the gut, they must first be able to tolerate the low pH and the aggressive digestive environment of the gastrointestinal tract. Therefore, acid resistance and pepsin resistance are important indicators for probiotic screening. Measuring these indicators can determine the survival ability of the selected strains after gastrointestinal digestion. 10 mL of pre-test AKK bacterial solution was aspirated, centrifuged (4 ℃, 10000 r / min, 8 min) to collect bacterial sludge. The sludge was washed twice with sterile PBS and resuspended in an equal volume of artificial gastric fluid (pH 2.5, 0.2% NaCl, 0.35% pepsin, pH=2.5, filtered through a 0.22 μm sterile filter membrane). The mixture was anaerobically cultured at 37 ℃ for 3 h, shaking every 30 min. The mixed bacterial solution was collected at 0 h and 3 h and serially diluted to 10⁻⁶. -7 10 -6 10 -5 100 μL of each sample was plated and viable counts were calculated, with three replicates per group. The samples were then centrifuged again (4 ℃, 10000 r / min, 8 min) to collect the bacterial sludge. The collected sludge was resuspended in an equal volume of artificial intestinal fluid (pH=8.0, 0.68% KH2PO4, 1% trypsin, 0.3% bile salts, pH=8.0, filtered through a 0.22 μm sterile filter membrane) and anaerobically cultured at 37 ℃ for 4 h, shaking every 30 min. The mixed bacterial suspension was collected at 0 h and 4 h and serially diluted to 10⁻⁶. -4 10 -5 10 -6 100 μL of sample was aspirated and spread onto a plate to count the viable bacteria. Three replicates were performed for each group. The viable bacteria count of the samples before and after treatment was measured, and the results are shown in Table 1.

[0085] Table 1 Results of the AKK-LTA21F2 simulated gastrointestinal fluid tolerance test

[0086]

[0087] Example 4

[0088] Characteristic sequences of AKK-LTA21F2

[0089] The whole genome sequence of AKK-LTA21F2 was compared with 29 strains downloaded from NCBI using the nucmer software. A. massiliensis The whole genome sequence was compared to extract the sequence that was not matched by nucmer, and then the uniqueness of the sequence was verified by BLASTn.

[0090] Figure 5Image A shows the gel electrophoresis results of PCR amplification using AKK genus-specific primers (corresponding to uppercase letters) and AKK-LTA21F2 strain characteristic sequence primers (corresponding to lowercase letters), respectively. A and a represent AKK-LTA21F2 strain, and B and b represent... A. massiliensis And, C, c and D, d are A. muciniphila strains.

[0091] The results showed that only AKK-LTA21F2 exhibited a single bright band at 170 bp in lane A and 194 bp in lane a. Other strains only showed amplification of the AKK genus-specific band (170 bp), failing to amplify the AKK-LTA21F2 strain-specific band (194 bp). Furthermore, Figure 5 Figure B shows the gel electrophoresis results of PCR amplification products of various strains using primers with the characteristic sequence of AKK-LTA21F2. 1 represents strain AKK-LTA21F2, and 2-5 represent other AKK strains (two strains each). A. massiliensis and two plants A. muciniphila ), 6-9 were non-target Bacteroides strains, 10-13 were non-target Lactobacillus strains, and 14-16 were non-target Bifidobacterium strains. The template for the negative control group was ddH2O without a genome. From Figure 5 As shown in section -B, only the AKK-LTA21F2 strain exhibited a specific amplification band at 194 bp in the detection results of the primer set; other strains showed no specific bands. These results indicate that sequences 2497190-2497457 are specific molecular targets of the AKK-LTA21F2 strain.

[0092] The characteristic sequence of AKK-LTA21F2 is as follows:

[0093] SEQ ID NO.2: GAATAGACCTGTAGTAGCTGAACAATCCCGTTCTCCTGTTATCTCCGAGGTGCATCAGAACAATCCAGAACAATCCCCTGTAGCGGCGCAGCGGCCATCTATAAAGGCAACTGACATCAAAGAGACGAAAA TCCCGTTTACTTCATTGGTAGTAGAAGCTTTTTCTATATGTGGAAGGCTCATTATCATTCTTGCCATTGTCTTTGCCGCTATCTTTTTCTTTGCTGGTATTATGAGTAAGGATACATTTTCCTTCTCAATGTCCTT.

[0094] Example 5

[0095] Analysis of the adaptability and genetic characteristics of AKK-LTA21F2 under oxygen stress

[0096] The activated AKK bacterial culture was serially diluted and spread onto modified BHI plates. One plate remained in the anaerobic workstation, while the other plates were exposed to ambient oxygen at 37 °C for 12 h before being returned to the anaerobic workstation for further cultivation. The oxygen tolerance of the strains was determined by measuring the oxygen exposure time and the ratio of CFUs without oxygen exposure. Fresh AKK bacterial culture was transferred at a 2% inoculum to modified BHI medium containing 1.5 mmol / L H2O2 and anaerobically cultured for 2 h. The viable cell counts of each strain were counted at 0 h and 2 h of culture, and the H2O2 tolerance of the strains was compared.

[0097] Based on the functional annotations generated by eggNOG-mapper, we searched for the corresponding bacteria and enzymes related to oxidative stress, such as catalase, superoxide dismutase, thioredoxin, and pyridine nucleotide-disulfide oxidoreductase, and analyzed the probability of their presence.

[0098] 1. Air exposure and H2O2 stress test

[0099] Anaerobic bacteria, especially probiotic strains, often experience oxygen stress during cultivation due to exposure to oxygen-containing environments. Identifying the strains' adaptability to oxygen stress is crucial. Therefore, oxygen exposure and H2O2 stress experiments were conducted. Results showed that AKK-LTA21F2 bacterial suspensions in the logarithmic growth phase, after being exposed to natural oxygen-containing air for 48 hours, still exhibited normal growth after being streaked onto plates. In plate dilution and counting, the survival rate of the strains on plates with the same counting gradient exposed to oxygen for 12 hours was 90.88%. Figure 6 (A). Furthermore, after AKK-LTA21F2 was kept in liquid medium containing 1.5 M H2O2 for 2 h, the viable count not only did not decrease compared to the control, but actually increased by 25.26% ( ). Figure 6 (B). The above results indicate that AKK-LTA21F2 exhibits excellent adaptability to environmental oxygen stress.

[0100] 2. Analysis of antioxidant activity genes in AKK-LTA21F2

[0101] Through whole-genome information analysis, AKK-LTA21F2 has 13 antioxidant active gene codes (Table 2). The gene clusters related to oxidoreductases are labeled, mainly including katA and katE: catalase family (EC: 1.11.1.6, ko00630: glyoxylate and dicarboxylate metabolism); SOD2: iron / manganese superoxide dismutase, α-hairpin domain (EC: 1.15.1.1, ko04013: MAPK signaling pathway); cysJ: hydroxylamine reductase activity (EC: 1.8.1.2); TXN, trxA: thioredoxin-like domain (ko04621: NOD-like receptor signaling pathway); nuoE: thioredoxin-like [2Fe-2S] ferroredoxin (EC: 1.6.5.3, ko00190: oxidative phosphorylation); trxB, TRR: pyridine nucleotide disulfide oxidoreductase (EC: 1.8.1.9, selenium compound metabolism); DLD, lpd, pdhD: pyridine disulfide oxidoreductase, dimerizing domain (EC: 1.8.1.4, glycolysis / glucose production). These results indicate that the AKK-LTA21F2 strain possesses abundant oxidoreductase-related genes in vivo.

[0102] Table 2 Antioxidant activity gene system of AKK-LTA21F2

[0103]

[0104] Example 6

[0105] AKK-LTA21F2 carbon source utilization and glycosyl hydrolases related to mucin degradation

[0106] The utilization of 95 carbon sources by Akkermansia (AKK-LTA21F2) was determined using Biolog GEN III Microstation 96-well plates under strictly aseptic conditions. After centrifugation (8000 rpm, 10 min, 4 °C) of the bacterial culture at the end of the logarithmic growth phase, the culture was washed 2–3 times with sterile water to remove residual culture medium. The turbidity was then adjusted to 75 ± 3%, and a bacterial suspension was prepared using Biolog inoculum C. This suspension was inoculated into microplates and incubated in an anaerobic workstation at 37 °C for 48 h. After incubation, the OD of each well was measured using Biolog MicroStation. 590 value.

[0107] Based on the annotations in the CAZy database generated by eggNOG-mapper, the presence of enzymes related to the degradation of AKK-LTA21F2 mucin, including α-fucosease (GH29, most GH95 family members), α-sialidase (GH33), galactosidase (GH27, GH35, GH110, some GH2 and GH95 family members), β-acetylhexosaminease (GH20), β-acetylgalactosaminease (GH123), and α-N-acetylglucosaminease (GH84, GH89), was annotated and compared.

[0108] 1. Carbon source utilization characteristics of AKK-LTA21F2

[0109] Analysis of the carbon source utilization potential of strain AKK-LTA21F2 showed that this bacterium had a strong ability to utilize L-trehalose, L-rhamnose, D-galacturonic acid, α-butanone, α-ketovalerate, and 3-methyl-D-glucose. It was also found that this bacterium could utilize D-fructose, 6-OD-glucopyranoyl-D-fructose furanose, D-galactose, pyruvic acid, and D-mannose. Figure 7 ).

[0110] 2. AKK-LTA21F2 mucin-degrading enzyme

[0111] The main monosaccharide components of mucin include galactose, sialic acid, fucose, N-acetylgalactosamine, and N-acetylglucosamine. The glycosyl hydrolases associated with mucin degradation include: α-fucosease (GH29, most members of the GH95 family), α-sialylase (GH33), galactosidase (GH27, GH35, GH110, some members of the GH2 and GH95 families), β-acetylhexosaminease (GH20), β-acetylgalactosaminease (GH123), and α-N-acetylglucosaminease (GH84, GH89). AKK-LTA21F2 contains four copies of GH29; two copies of GH95; two copies of GH33; eight copies of GH20; and one copy of GH84.

[0112] Example 7

[0113] Application of AKK-LTA21F2 in pilot production

[0114] AKK-LTA21F2 has been proven to be directly used in pilot-scale fermentation production to obtain live bacterial preparations, or it can be added to pharmaceuticals in lyophilized powder form to regulate the intestinal flora of humans or animals and enhance immunity. AKK-LTA21F2 bacterial preparations can also be used in a non-live form.

[0115] 1. Pilot-scale fermentation production

[0116] One preferred method is to use Akkermansia myxophilus subsp. martensii LTA21F2 for pilot-scale production. The pilot-scale production method of Akkermansia myxophilus subsp. martensii LTA21F2 is as follows: First, according to the existing formula, 150 L of liquid culture medium was prepared and poured into a 200 L pilot-scale fermenter. Sterilization, cooling, and temperature control were then performed. Subsequently, 3 L of seed culture was inoculated into the 150 L liquid culture medium at a 2% (v:v) inoculation rate. The fermentation was carried out using a continuous flow of mixed anaerobic gas (90% N2, 5% H2, and 5% CO2) at a temperature of 37 ℃. The OD value, pH value, and viable cell count were monitored during the fermentation process. Since the pH value dropped to 5.50 at 18 h (close to the final value of approximately 5.30), it was considered that the pH value was decreasing rapidly. Therefore, fermentation was stopped at 41 h, and viable cell counts and cell harvesting were performed.

[0117] The fermentation broth was serially diluted with PW diluent, and viable cell counts were performed using the pour-over method. Results are as follows: Figure 8 As shown, 41 h after fermentation was stopped, the PW dilution pouring method was used to dilute 10 -12 The viable cell count under the gradient was 1.53 × 10⁻⁶. 15 CFU / mL or higher. Furthermore, the yield of bacterial sludge after centrifugation of the culture medium using a tubular centrifuge was 0.10%.

[0118] Because the pH value dropped rapidly during the first 150 L fermentation, the fermentation broth entered a highly acidic environment early on, resulting in little change in the OD value in the later stages of fermentation, and consequently a low yield of sludge. Therefore, a pH control strategy was introduced for the second fermentation to optimize the process, allowing AKK bacteria to grow at a suitable pH and improving cell yield. As shown in Table 3, after adding alkali at 24 h to raise the pH value from 5.50 to 5.90, the OD value of the second 150 L pilot production increased by 28.57%, and the sludge yield was 2.5 times higher than before, an increase of 150%. This indicates that the alkali addition strategy can effectively improve the cell yield of AKK bacteria in pilot production. Regarding viable cell count, the fermentation broth diluted with PW at 10... -11 10 -12 and 10 -13 All the poured plates (1 mL) were covered with colonies (more than 1000), making accurate counting impossible. Therefore, the viable count in the samples was determined to be less than 10. 16 CFU / mL or higher.

[0119] Table 3 Comparison of AKK-LTA21F2 strain data from two 150 L pilot-scale production runs

[0120]

[0121] 2. Counting of freeze-dried powder

[0122] Lyophilized powder was prepared using *Ackermannii malathione* subsp. *marginata* LTA21F2. The fermentation broth of LTA21F2 cultured to the logarithmic growth phase was transferred to a tubular centrifuge and centrifuged at 50 Hz. After centrifugation of 150 L of broth, bacterial sludge was scraped from the filter membrane to obtain *Ackermannii malathione* bacterial sludge. A freeze-drying product protectant (12 g skim milk powder, 2 g sucrose, and 2 g trehalose were weighed and added to 100 mL of distilled water to prepare a mixed protectant with a weight fraction of 12% skim milk powder, 2% sucrose, and 2% trehalose) was mixed with the bacterial sludge at a mass ratio of 20:1. The mixture was then frozen at -80 ℃ for 4 h, and finally freeze-dried to obtain AKK-LTA21F2 lyophilized bacterial powder.

[0123] Weigh 1 g of each of the two lyophilized powders and add them to a 50 mL centrifuge tube containing 9 mL of PW diluent. After dissolving, simply vortex to mix, then leave at room temperature for at least 10 minutes to allow for complete dissolution. After vortexing again, record this tube as 10. -1 Gradient, successively diluted downwards to 10 -15 gradient.

[0124] like Figure 9 As shown, freeze-dried powder No. ① (first pilot production) was produced at 10... -13 10 -14 and 10 -15 Pour-over culture counting was performed at three PW dilution gradients, with the final count at 10⁻⁶. -15 The growth under these conditions yielded suitable colony counts (32 and 24), and the viable count of freeze-dried powder No. 1 was 2.8 × 10⁻⁶. 16 CFU / g.

[0125] Freeze-dried powder No. 2 (second pilot production) was produced at 10... -13 10 -14 and 10 -15 Pour-pouring culture and counting were performed at three PW dilution gradients. Each gradient eventually became confluent (over 1000 colonies), making accurate counting impossible. The estimated viable count for freeze-dried powder #2 was 10-1. 18 CFU / g or higher.

[0126] In summary, the viable count of the freeze-dried powder of this strain after vacuum freeze-drying was 10. 16 CFU / g ~10 18 The CFU / g level was between or above, and compared with relevant reports at home and abroad, the live bacterial count of the freeze-dried Akkermansia muciniphila subsp. martensii reached the highest value reported to date.

[0127] Example 8

[0128] AKK-LTA21F2 increases mouse survival and modulates aging markers.

[0129] Experimental Methods: 18-month-old naturally aging male C57BL / 6J mice were randomly divided into two groups after one week of acclimatization: an aging model control group (Old, n=20) and an AKK-LTA21F2 bacterial intervention group (Akk, n=20). Two-month-old male mice were assigned to a young control group (YC, n=10). One week prior to intervention, aging mice were treated with a triple antibiotic regimen consisting of 10 g / L metronidazole, 5 g / L vancomycin, and 5 g / L neomycin, at a dose of 0.1 mL / 10 g body weight. After antibiotic treatment, each mouse in the Akk group was administered 200 μL of AKK-LTA21F2 live bacterial resuspension (with a viable count of approximately 5 × 10⁻⁶) by gavage. 9 The concentration of CFU / mL was maintained for 6 months. The Old and YC groups were fed a standard diet without other interventions. Blood samples were collected from mice using sterile EP tubes and incubated at room temperature for 2 hours. The blood samples were then centrifuged (4 °C, 5000 r / min, 10 min) to obtain serum. Serum samples were used to determine oxidative stress markers, inflammatory factor markers, and blood biochemical parameters.

[0130] Experimental Results: Starting from month 18, this invention continuously recorded the mortality of 20 mice until the end of the experiment to calculate the survival rate. In the Old group, only 11 aging mice survived by the end of the experiment at 24 months, while in the Akk group, 17 mice were still alive from the initial 20 mice at 24 months.

[0131] Figure 10 The study showed that AKK-LTA21F2 supplementation significantly prolonged the lifespan of mice, with the survival rate in the AKK intervention group reaching 85%, while the survival rate in the control group was only 55%, a difference of 30%, demonstrating a very significant effect. p <0.05).

[0132] Furthermore, this invention evaluated aging biomarkers such as oxidative stress, inflammatory response, and lipopolysaccharide in mouse samples. Serum oxidative stress levels showed that, compared to YC mice, Old mice had significantly reduced serum SOD and T-AOC by 35.98% and 37.82%, respectively, while MDA levels were significantly increased by 55.10%. Compared to Old mice, AKK-LTA21F2 intervention significantly increased SOD (43.17%) and T-AOC (49.78%) activities in aged mice and significantly reduced MDA levels by 27.92%. Figure 11(A). This indicates that the oxidative stress level in aging mice was significantly improved after intervention with AKK-LTA21F2. Furthermore, compared with YC, the serum concentrations of LPS, TNF-α, and IL-1β in aging mice were significantly increased, indicating a significantly higher level of inflammation and weakened immunity in aging mice. However, after AKK-LTA21F2 supplementation, the serum concentrations of LPS, TNF-α, and IL-1β in aging mice significantly decreased by 45.87%, 33.42%, and 32.02%, respectively, indicating a reduction in systemic inflammation and enhanced immunity in the mice. Figure 11 (B)

[0133] From the perspective of blood biochemical indicators, the AKK-LTA21F2 strain significantly reduced aspartate aminotransferase levels in aging mice. Furthermore, AKK-LTA21F2 intervention significantly increased serum total protein levels in aging mice by 14.79%, comparable to the YC group. Figure 11 (C). From the perspective of serum blood glucose levels, the naturally aging mouse group showed symptoms of hypoglycemia and a significant trend of reduced food intake. This may be due to the decline of gastrointestinal function caused by aging, and it also indicates that their body's metabolism is unable to maintain healthy vital signs. In contrast, the Akk group restored the glucose content of the naturally aging mice to normal levels, which shows that AKK-LTA21F2 intervention is beneficial to maintaining normal healthy vital signs in mice.

[0134] Example 9

[0135] AKK-LTA21F2 improves anxiety levels in aging mice.

[0136] Experimental Methods: The open field experiment was conducted using a square black test box connected to a computer and a camera, placed in a well-lit and soundproofed room. The camera was aimed at the open field area, and the computer divided the open field area into nine equal-area square regions. Mice were placed into the open field from the edge and allowed to explore freely for 5 minutes. SuperMaze software was used to record the total distance traveled by the mice, the number of times they stood upright on their hind legs, the distance they traveled in the central area, the number of times they crossed the central area, and the time spent in the central area.

[0137] The open field test can reflect the motor ability and anxiety levels of mice. The mouse open field movement trajectory is shown below. Figure 12 As shown, mice in the Akk and YC groups were more likely to enter the central area of ​​the open field and move back and forth between different grids than mice in the Old group, while mice in the Old group only moved along the edge of the open field and rarely entered the central area. Figure 12 (A and B). Compared with the Old group, the Akk group and YC mice traveled significantly farther in open areas. Figure 12(C) Compared with the aging group, the Akk group showed an increase of 58.28% in the number of times they entered the center and an increase of 192.31% in the total walking distance. p <0.05), indicating that aging mice treated with AKK-LTA21F2 not only became bolder (able to reach the central area) and stronger (walked more), but also showed a greater desire to explore (darting back and forth). The number of times mice stood upright on their hind limbs was negatively correlated with their anxiety levels. Compared to the Old group, the Akk group and YC group saw increases of 210.06% and 246.15% in the number of times they stood upright on their hind limbs, respectively. p <0.05)( Figure 12 (D), which indicates that the anxiety level of aging mice was significantly improved after intervention with AKK-LTA21F2.

[0138] Example 10

[0139] AKK-LTA21F2 improves learning and memory abilities in aging mice.

[0140] Experimental Methods: The water maze was used to measure hippocampal spatial memory and learning abilities. The water maze consisted of a circular pool with a diameter of 1.2 meters, filled with tap water and kept at approximately 26°C. Titanium dioxide (a non-toxic white dye) was added to the water to create a white background. A clearly visible, circular escape platform was placed 1-2 cm below the water surface. To survive in the water, mice had to find the hidden escape platform. Each experiment began with the mice facing the pool wall, testing in quadrants one, two, three, and four. Each mouse entered from a different quadrant and was given 60 seconds to search for the escape platform; the time it took to find the hidden platform was the escape latency. If the mouse did not find the platform, it was guided to it and allowed 60 seconds of training to familiarize itself with the visual cues. If the mouse found the platform, it remained on it for 20 seconds. After four days of training, a spatial exploration experiment was conducted on the fifth day to test the mice's memory and learning abilities. On day 6, the escape platform was removed, and a mouse was randomly placed in a quadrant to swim for 60 seconds. A camera above the pool was used to capture the mouse's swimming trajectory. SuperMaze software was used to record the mouse's path length, swimming speed, time spent in each quadrant, and number of times it crossed the platform.

[0141] The water maze test can reflect the cognitive learning and memory abilities of mice. The experimental results are as follows: Figure 13 As shown. After four consecutive days of adaptive training in navigation, analysis of the mice's trajectories in the water maze experiment on day 5 revealed that the Old group had difficulty finding platforms in the water maze, while the Akk group mice were able to reach the platforms quickly. These trajectories were comparable to those of the young control group. Figure 13(A). After continuous water maze navigation training, all mice showed a reduction in escape latency. Notably, compared to Old, the Akk and YC groups showed a significant reduction in escape latency of 76.32% and 74.82% on day 5, respectively. Figure 13 (B) In the water maze exploration experiment with the platform removed, compared with the Old group, the Akk group mice showed a significant increase of 56.65% in the time spent in the target quadrant and 150.00% in the number of times they crossed the platform. Figure 13 (C and D). In particular, the Akk group showed more regular overall pathways and clearer objectives, trends comparable to the YC group. Aged mice supplemented with AKK bacteria exhibited significantly goal-oriented behavior; all mice entered the target platform quadrant, indicating that this group could remember the location of the target platform. Water maze test results showed that intervention with AKK-LTA21F2 bacteria effectively improved cognitive and memory decline in aged mice.

[0142] Example 11

[0143] Effects of AKK-LTA21F2 intervention on oxidative stress and inflammatory factors in the brain tissue of aging mice

[0144] Experimental Methods: Brain tissue was flash-frozen in liquid nitrogen immediately after dissection and stored at -80 °C. On the day of measurement, brain tissue was removed, accurately weighed, and four times its weight in physiological saline was added. The resulting homogenate was prepared using a tissue homogenizer in an ice-water bath. The activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and malondialdehyde (MDA) content in the brain tissue were determined using a kit from the Nanjing Jiancheng Biotechnology Institute, Jiangsu, China. The levels of tumor necrosis factor (TNF-α), interleukin-1β (IL-1β), and C-reactive protein (CRP) in the brain tissue were determined using an enzyme-linked immunosorbent assay (ELISA) kit from Shanghai Jianglai Biotechnology Co., Ltd., China.

[0145] Results of antioxidant and inflammatory factor markers in mouse brain tissue samples are as follows: Figure 14 As shown. Compared with the YC group, the levels of two positive indicators, SOD and GSH-Px, in the brain tissue of Old group mice decreased by 35.74% and 34.02%, respectively, while the level of the negative indicator MDA increased by 70.06%. Compared with the Old group, the levels of positive indicators SOD and GSH-Px in the brain tissue of Akk group mice increased by 42.37% and 25.26%, respectively, while MDA decreased by 37.49%, indicating that AKK-LTA21F2 can alleviate oxidative stress by increasing the level of antioxidant enzymes. Figure 14(A). Analysis of inflammatory factors in mouse samples showed that, compared with the Old group, AKK intervention significantly reduced the levels of inflammatory cytokines TNF-α (52.77%), IL-1β (51.46%), and CRP (32.62%) in brain tissue, and the concentrations of these three inflammatory cytokines in the Akk group were similar to those in the YC group. Figure 14 (Middle B). These results indicate that AKK-LTA21F2 can prevent hippocampal damage in aging mice and enhance the antioxidant levels and inflammatory response of brain tissue.

[0146] Example 12

[0147] Colonic histopathology in aging mice regulated by AKK-LTA21F2

[0148] Experimental Methods: Mouse colon tissue was fixed in 4% paraformaldehyde for 24 h, embedded in paraffin, and stained with hematoxylin and eosin (H&E). AB-PAS staining was performed using the AB-PAS solution group (Servicebio, Wuhan, China) according to the instructions. Specifically, small intestinal sections were stained sequentially with AB-PAS C, AB-PAS B, and AB-PAS A, then dehydrated and sealed with neutral glue before microscopic observation.

[0149] Aging typically affects the morphology and structure of major tissue cells. Histopathological observation of the colon of experimental mice using H&E staining and AB-PAS staining revealed significant changes in aging mice. Figure 15 (A and B in the middle). Compared with the Old group, HE staining (black arrows) revealed a significant reduction in goblet cells and inflammatory infiltration in the Old group samples, with damage at the base of the crypts. These histological changes were improved in the Akk group mouse samples, showing more neatly arranged and more intact goblet cells. In addition, AB-PAS staining of sections showed that the Akk group colon contained a large number of mucus-filled crypts (blue staining); however, this blue mucus material was significantly lighter in color, less abundant, and more dispersed in the Old group (red arrows).

[0150] Example 13

[0151] AKK-LTA21F2 modulates gut microbiota in aging mice

[0152] Gut microbiota assay: Fecal samples were collected immediately after the probiotic intervention, rapidly frozen in liquid nitrogen, and then stored at -80 °C. Total DNA was extracted from the feces using the Tiangen S96 magnetic fecal DNA kit manufactured by Tiangen Biotech (Beijing) Co., Ltd. 1.8% agarose gel electrophoresis was used to determine the quality and quantity of the isolated DNA. The concentration and purity of the DNA were determined using a NanoDrop2000 UV-Vis spectrophotometer (Thermo Scientific, Wilmington, USA). The V3-V4 region of the 16S rRNA gene was amplified by polymerase chain reaction on an Illumina Novaseq 6000 platform (2 × 250 bp) using universal primers 338F:5′-ATCCTACGGGGGAGGCAGCA-3′ and 806R:5′-GCACACHVGGGTWTCTAAT-3′. The amplified products were quantified using Qsep-400.

[0153] Experimental results are as follows Figure 16 As shown in the figure, this diagram illustrates the impact of AKK-LTA21F2 intervention on the microbial composition of naturally aging mice at the phylum, family, and genus levels. At the phylum level, the most abundant enterobacteria in each group were Bacteroidota, Firmicutes, and Proteobacteria. Figure 16 (A) Compared with the Old group, the F / B ratio in the AKK bacteria intervention group was significantly increased, while the relative abundance of Bacteroidetes was significantly reduced by 36.41%, and the abundance of Verrucous Microbes was significantly increased. At the family level, Enterobacteriaceae Muribaculaceae, Lachnospiraceae, Lactobacillaceae, Bacteroidaceae, and Prevotellaceae were identified as the dominant bacterial groups in each group. AKK bacteria effectively alleviated the age-related increase in the relative abundance of Bacteroidaceae and Prevotellaceae. Figure 16 (B). Furthermore, at the genus level, the proportion of the top 10 dominant bacterial genera was the lowest in the Old group samples, but the distribution pattern of enterobacteria after treatment in the AKK bacteria intervention group was similar to that in the YC group ( Figure 16 (C). In particular, after AKK-LTA21F2 intervention, unclassified-Muribaculaceae and Akkermansia The relative abundance of beneficial bacteria increased. These results demonstrate that the AKK-LTA21F2 cultured in this invention can colonize naturally aging mice and rejuvenate their gut microbiota composition, thus exhibiting a certain regulatory effect on the gut microbiota of naturally aging mice.

[0154] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively describe all embodiments here. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included within the scope of protection of the claims of the present invention.

Claims

1. Akermansia masei ( Akkermansia massiliensis The application of LTA21F2 in the preparation of anti-aging and life-extending products is characterized by, The preservation number of the *Ackermania marcescens* LTA21F2 is GDMCC No: 63035.

2. Use according to claim 1, characterized in that, The Massey Akkermansia LTA21F2 strain enhances immunity and maintains normal healthy vital signs by improving oxidative stress levels, inflammation levels, and liver function indicators; it also plays a role in anti-aging and prolonging life by enhancing the integrity of the colonic barrier and regulating the intestinal flora.

3. An anti-aging and longevity-extending product, characterized by, Includes the Massey Akkermansia LTA21F2 as described in claim 1.

4. The use of the Massey Akkermansia LTA21F2 strain as described in claim 1 in the preparation of products that improve learning and memory abilities.

5. A product for improving learning ability and memory ability, characterized by, Includes the Massey Akkermansia LTA21F2 as described in claim 1.

6. The use of the *Akermansia masei* LTA21F2 as described in claim 1 in the preparation of a medicament for enhancing the antioxidant level of brain tissue and reducing inflammatory response.

7. A medicament for enhancing the antioxidant level and reducing inflammation in brain tissue, characterized by, Includes the Massey Akkermansia LTA21F2 as described in claim 1.

8. The use of the Massey Akkermansia LTA21F2 as described in claim 1 in the preparation of products that enhance colonic barrier integrity and regulate gut microbiota.

9. A product that enhances colonic barrier integrity and regulates intestinal flora, characterized in that, The product includes the Massey Akkermansia LTA21F2 as described in claim 1; The product is a medicine.

Images