Application of Nr3c1 gene / protein as target spot in preparation of medicine for preventing and / or treating BCG infection

Abstract

The invention relates to application of an Nr3c1 gene / protein as a target spot in preparation of a medicine for preventing and / or treating BCG infection, and belongs to the technical field of biological medicines. Aiming at the technical problems that the host defense defect is caused by excessive death of macrophages when a host is infected with BCG, the research on the mechanism of regulating and controlling the macrophages to resist BCG infection by host genes is not perfect and the like at present, a CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) screening technology is utilized to discover the key function of negatively regulating and controlling the survival of the macrophages in the BCG infection in a BCG infection model for the first time, so that the application of the Nr3c1 gene in the BCG infection is realized. And it is verified that the survival rate of the macrophage after BCG infection can be significantly improved through targeted inhibition of Nr3c1 gene expression, and the BCG removal capacity of the macrophage is enhanced. The discovery of the invention provides a new target for research and development of drugs for preventing and / or treating BCG infection.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the application of the Nr3c1 gene / protein as a target in the preparation of drugs for the prevention and / or treatment of BCG infection. Background Technology

[0002] Macrophages, as a core component of the innate immune system, play a crucial role in anti-infective immunity. Excessive macrophage death occurs when the host is infected with attenuated Bacillus Calmette-Guerin (BCG), leading to host defense deficiencies. Therefore, macrophage survival directly affects the host's efficiency in clearing pathogens. However, current research on the mechanisms by which host genes regulate macrophage resistance to BCG infection is incomplete, particularly lacking a systematic analysis of key genes related to cell necrosis and BCG immune escape.

[0003] Traditional research on macrophage anti-infection mechanisms has largely focused on the regulatory effects of known signaling pathways or specific molecules (Liu L, Yu Z, Ma Q, et al. LncRNA NR_003508 suppresses Mycobacterium tuberculosis-induced programmed necrosis via sponging miR-346-3p to regulate RIPK1[J]. International Journal of Molecular Sciences, 2023,24(9): 8016.)(Yan Z, Han J, Mi Z, et al. GPNMB disrupts SNARE complexassembly to maintain bacterial proliferation within macrophages. Cell MolImmunol. 2025;22(5):512-526. doi:10.1038 / s41423-025-01272-z.)(Zhang Y, Han J, Yang Q, et al. miR-1236-3p Targets Toll-Like Receptor 4 to Suppress the Anti-Mycobacterium tuberculosis Activity of Macrophage. iScience. 2025;28(6):112522. doi:10.1016 / j.isci.2025.112522.), lacking a systematic strategy for screening new targets, the application of CRISPR technology fills this gap. In recent years, the rapid development of CRISPR gene editing technology has provided an efficient tool for systematically screening functional genes, especially by knocking down or knocking out specific genes, which can accurately analyze the function of specific genes in infection models. In addition, current treatment strategies for BCG infection are mostly limited to direct bactericidal action or non-specific enhancement of immune response, while neglecting the new direction of enhancing macrophage survival by targeting host cell death pathways. Therefore, if new targets that regulate macrophage anti-BCG infection can be screened, it will provide new ideas for the treatment of BCG infection. Summary of the Invention

[0004] To address the host defense deficiencies caused by excessive macrophage death during BCG infection and the incomplete understanding of the mechanisms by which host genes regulate macrophage resistance to BCG infection, this invention utilizes CRISPR screening technology to discover for the first time in a BCG infection model the crucial role of the Nr3c1 gene in negatively regulating macrophage survival during BCG infection. Furthermore, it verifies that targeted inhibition of Nr3c1 gene expression can significantly improve macrophage survival after BCG infection and enhance macrophage's ability to clear BCG.

[0005] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution: The first objective of this invention is to provide the application of the Nr3c1 gene / protein as a target in screening drugs for the prevention and / or treatment of BCG infection, wherein the drug targets the Nr3c1 gene / protein to inhibit or silence the expression of the Nr3c1 gene / protein, the nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.2.

[0006] In one embodiment of the present invention, the drug enhances the survival rate of macrophages and strengthens their ability to resist BCG infection by inhibiting or silencing the expression of the Nr3c1 gene / protein.

[0007] A second objective of this invention is to provide the use of an expression inhibitor of the Nr3c1 gene / protein in the preparation of a medicament for the prevention and / or treatment of BCG infection, wherein the nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1 and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.2.

[0008] In one embodiment of the present invention, the drug enhances the survival rate of macrophages and strengthens their ability to resist BCG infection by inhibiting or silencing the expression of the Nr3c1 gene / protein.

[0009] In one embodiment of the present invention, the expression inhibitor targets the Nr3c1 gene / protein to inhibit or silence the expression of the Nr3c1 gene / protein.

[0010] In one embodiment of the present invention, the expression inhibitor is an RNA fragment that interferes with the expression of the Nr3c1 gene / protein, an shRNA that targets the Nr3c1 gene, or a small molecule compound that downregulates the expression of the Nr3c1 gene.

[0011] In one embodiment of the present invention, the nucleotide sequence of the shRNA targeting the Nr3c1 gene is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0012] A third objective of this invention is to provide an shRNA that specifically targets the Nr3c1 gene, the nucleotide sequence of which is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0013] A fourth objective of this invention is to provide the use of the above-mentioned shRNA in the preparation of medicaments for the prevention and / or treatment of BCG infection.

[0014] In one embodiment of the present invention, the drug enhances the survival rate of macrophages and strengthens their ability to resist BCG infection by inhibiting or silencing the expression of the Nr3c1 gene / protein.

[0015] The fifth objective of this invention is to provide an expression enhancer for the Nr3c1 gene / protein in the preparation of reagents for BCG infection research, the construction of BCG infection models, or the study of BCG immune escape mechanisms. The nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.2.

[0016] In one embodiment of the present invention, the expression enhancer targets the Nr3c1 gene / protein to promote the expression of the Nr3c1 gene / protein.

[0017] The beneficial effects of this invention are: This invention utilizes CRISPR screening technology to discover for the first time in a BCG infection model the crucial role of the Nr3c1 gene in negatively regulating macrophage survival during BCG infection. A standardized infection-clearance-survival counting assay was used to verify that targeted inhibition of Nr3c1 gene expression significantly improves macrophage survival after BCG infection, enhances macrophage clearance of BCG, and consequently strengthens the host's anti-BCG immune response. Compared to traditional methods, this invention combines high-throughput screening with functional validation, offering cost-effectiveness and scalability. It overcomes the limitations of existing research confined to specific signaling pathways, providing a novel perspective for studying anti-BCG infection mechanisms and screening targets for anti-BCG therapy. Furthermore, the experimental design of this invention, such as the direct correlation between post-infection cell survival counts and functional phenotypes, avoids the limitations of relying solely on molecular marker detection, significantly enhancing the biological significance of the results. Attached Figure Description

[0018] Figure 1 This is a graph showing the Cas9 expression detection results of the RAW264.7-Cas9 cell line in Example 1; Figure 2The figure shows the results of detecting the relative expression levels of Nr3c1 mRNA in RAW264.7 cell lines with Nr3c1 gene knockdown and wild-type RAW264.7 cell lines; where shNC is the wild-type RAW264.7 cell line and shNr3c1 is the RAW264.7 cell line with Nr3c1 gene knockdown. Figure 3 The graph shows the fold change in the number of surviving cells after BCG infection in RAW264.7 cell lines with Nr3c1 gene knockdown and wild-type RAW264.7 cell lines; where Ctrl represents the wild-type RAW264.7 cell line and shNr3c1 represents the RAW264.7 cell line with Nr3c1 gene knockdown. Detailed Implementation

[0019] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. In the art, any embodiments obtained by those skilled in the art without creative effort are protected by this invention.

[0020] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. The materials, reagents, culture media, and instruments used are all conventional materials, reagents, culture media, and instruments in the art, and can be obtained commercially by those skilled in the art. Unless otherwise specified, the molecular biology experimental procedures involved in this invention are conventional experimental procedures in the art or can be performed according to the product instructions of the corresponding reagents.

[0021] Example 1: Construction of a RAW264.7 cell line stably expressing Cas9 (1) Preparation and validation of Cas9 stable cell lines RAW264.7 cell lines were infected with lentivirus containing a Cas9 plasmid resistant to Hygromycin at a virus-to-cell ratio of 50:1, i.e., a virus titer of 1 × 10⁻⁶ cells / cells. 8 Infection with 2×10 Cas9 lentiviruses at TU / mL 6 The RAW264.7 cell line was constructed; after 48 h, the antibiotic Hygromycin was added for drug screening at a concentration of 600 μg / mL to construct a stable Cas9-expressing RAW264.7 cell line, which was named RAW264.7-Cas9.

[0022] This embodiment describes the detection of Cas9 expression in the RAW264.7-Cas9 cell line obtained above. Figure 1 As shown, the RAW264.7 cell line with stable Cas9 expression was successfully constructed.

[0023] (2) Cas9 cleavage activity verification sgRNA (such as sgIL-1RN, sgmPten) was introduced into the constructed stable Cas9 transgenic strain RAW264.7-Cas9. The genome was then extracted, the target fragment was amplified by PCR, the PCR product was purified, and then first-generation sequencing was performed to detect whether there was a single base deletion, in order to determine the Cas9 cleavage activity.

[0024] The sequence of the sgRNA is shown below: Human sgIL-1RN (SEQ ID NO.5): TGTACTCTCTGAGGTGCTC; Mouse sgmPten (SEQ ID NO.6): AGATCGTTAGCAGAAACAAA.

[0025] The validation results indicate that the RAW264.7-Cas9 cell line has good Cas9 cleavage activity and can be used for subsequent experiments.

[0026] Example 2: Construction of a mutant cell library from a Cas9-stable RAW264.7 cell line (1) Packaging of library lentiviruses and detection of viral titers Lentiviral packaging of the library plasmid was performed using Lipo3000 reagent. The mass ratio of the library plasmid (gRNA pooled library in lentiCRISPRv2): packaging plasmid PAX2: envelope plasmid VSVG was 13:5:2. Viral titers were determined using a serial dilution method. The specific method was as follows: The packaged virus was concentrated and centrifuged at 18,000 rpm, 4°C for 2 h. After removing the supernatant, the virus was resuspended in 1 mL of DMEM medium. RAW264.7-Cas9 cells were seeded in 12-well plates. 100 μL of the concentrated virus solution was added to 900 μL of cell supernatant and mixed thoroughly. 100 μL of the supernatant was then added to the next well for further dilution. Fresh culture medium was added 24 h after infection. 5 μg / mL puromycin was added for selection after 48 h. Cell viability was observed after 72 h to determine the viral titer.

[0027] (2) Detection of library coverage Cultivate 9×10 7RAW264.7-Cas9 cells were infected with a determined viral titer (MOI=0.3). The medium was changed after 24 h, and puromycin was added after 48 h to remove uninfected cells. Cells were collected after 72 h, and whole genome extraction and sequencing were performed to detect the coverage of gRNAs in the library.

[0028] (3) CRISPR screening library Mycobacterium tuberculosis infection The library cells were infected with the determined optimal MOI, and surviving cells were collected after 72 h for culture and deep sequencing. Based on the sequencing data, gRNA abundance information of 19,672 genes was obtained. According to the statistical significance of gene enrichment (screening threshold: Log2Fold Change > 1 and P < 0.05), significantly differentially expressed genes that simultaneously met the above criteria were functionally validated to confirm their biological mechanisms of regulating Mycobacterium tuberculosis infection.

[0029] Example 3: Screening of genes regulating macrophages' resistance to BCG infection (1) Cultivation and concentration determination of BCG BCG was cultured and passaged in 7H9 liquid medium (with 20 μg / mL kanamycin added). Concentration was determined as follows: the bacterial suspension was thoroughly mixed by pipetting and diluted; an appropriate amount of suspension was taken and the absorbance was measured at 600 nm. A 0.3 OD value corresponds to 5 × 10⁻⁶ cells / mL. 7 BCG.

[0030] (2) Determination of the optimal multiplicity of infection of Mycobacterium tuberculosis on host cells RAW264.7 cell lines were infected with BCG strain, and different multiples of infection (MOIs), such as 3 MOI, 10 MOI, and 50 MOI, were added for infection to determine the optimal MOI. This ensured that the cells died significantly after infection, thus guaranteeing a sufficiently strong selection pressure. The specific method is as follows: ① Add the bacterial solution to the cells for infection. After 24 h, wash the BCG-infected host cells with PBS. After washing twice, resuspend the cells in complete culture medium and add 100 mg / mL of gentamicin to the complete culture medium to kill excess bacteria. ② Remove the culture medium, wash the cells with PBS, and then perform a second infection using the same method. The infection was performed a total of three times, with each infection lasting 24 hours. ③ After the third infection, the excess bacteria are removed to determine the optimal multiplicity of infection.

[0031] Example 4: Functional validation of Nr3c1 gene knockdown in improving macrophage survival after BCG infection (1) Preparation of RAW264.7 cell line with Nr3c1 gene knockdown The nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.2.

[0032] In this embodiment, an Nr3c1 gene shRNA plasmid was constructed. The shRNA targeting the Nr3c1 gene used to construct the plasmid consists of Nr3c1-shRNA-F and Nr3c1-shRNA-R. The nucleotide sequences of Nr3c1-shRNA-F and Nr3c1-shRNA-R are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. The plasmid containing Nr3c1 shRNA was packaged into lentiviruses in 293T cells. The mass ratio of Nr3c1 shRNA plasmid: packaging plasmid PAX2: envelope plasmid VSVG was 13:5:2. The transfection reagent Lipo3000 (L3000015, Thermofisher) was mixed with the plasmid at a volume-to-mass ratio of 3:1. The mixture was added to 293T cells, and after 6 h, the medium was replaced with complete medium. The cells were cultured for another 72 h, and the supernatant containing lentivirus particles was collected. 1 mL of the supernatant containing lentivirus particles was used to infect RAW264.7 cells. After 12 h, the medium was replaced with normal medium. After 48 h, 5 μg / mL puromycin was added to screen for cells infected with lentivirus. The selected cells are the RAW264.7 cell lines with Nr3c1 gene knockdown.

[0033] SEQ ID NO.1: SEQ ID NO.2: MDSKESLAPPGRDEVPSSLLGRGRGSVMDLYKTLRGGATVKVSASSPSVAAASQADSKQQRILLDFSKGSASNAQQQQQQQQQQQQQQQQQPQPDLSKAVSLSMGLYMGETETKVMGNDLGYPQQGQLGLSSGETDFRLLEESIANLNRSTSRPENPKSSTPAAGCATPTEKEFPQTHSDPSSEQQNRKSQPGTNGGSVKLYTTDQSTFDILQDLEFSAGSPGKETNESPWRSDLLIDENLLSPLAGEDDPFLLEGDVNEDCKPLILPDTKPKIQDTGDTILSSPSSVALPQVKTEKDDFIELCTPGVIKQEKLGPVYCQASFSGTNIIGNKMSAISVHGVSTSGGQMYHYDMNTASLSQQQDQKPVFNVIPPIPVGSENWNRCQGSGEDNLTSLGAMNFAGRSVFSNGYSSPGMRPDVSSPPSSSSTATGPPPKLCLVCSDEASGCHYGVLTCGSCKVFFKRAVEGQHNYLCAGRNDCIIDKIRRKNCPACRYRKCLQAGMNLEARKTKKKIKGIQQATAGVSQDTSENANKTIVPAALPQLTPTLVSLLEVIEPEVLYAGYDSSVPDSAWRIMTTLNMLGGRQVIAAVKWAKAIPGFRNLHLDDQMTLLQYSWMFLMAFALGWRSYRQASGNLLCFAPDLIINEQRMTLPCMYDQCKHMLFISTELQRLQVSYEEYLCMKTLLLLSSVPKEGLKSQELFDEIRMTYIKELGKAIVKREGNSSQNWQRFYQLTKLLDSMHDVVENLLSYCFQTFLDKSMSIEFPEMLAEIITNQIPKYSNGNIKKLLFHQK; SEQ ID NO.3: TGAGATTCGAATGACTTATAT; SEQ ID NO.4: ATATAAGTCATTCGAATCTCA.

[0034] (2) Verification of the RAW264.7 cell line with Nr3c1 gene knockdown The knockdown efficiency of Nr3c1 was verified using qPCR. The specific method is as follows: In this example, RNA was extracted from wild-type RAW264.7 cells (shNC control group) and Nr3c1 knockdown cells (shNr3c1) according to the instructions of the RNA extraction kit (purchased from Yeasen, catalog number 19211ES60). The RNA was reverse transcribed into cDNA using a reverse transcription kit (purchased from Beijing TransGen Biotech Co., Ltd., catalog number AU341-02). The reverse transcription program was: 55℃-5min, 85℃-2min, 4℃-∞. After reverse transcription, the reaction tubes were placed on ice, and a quantitative qPCR reaction system was prepared and qPCR was performed. The quantitative qPCR reaction system consisted of: 5 μL SYBR (SYBR enzyme, purchased from Beijing TransGen Biotech Co., Ltd., catalog number AQ601-01-V2), 0.3 μL upstream primer (10 μM), and 0.3 μL downstream primer (10 μM). The DEPC water was added to 10 μL. The quantitative qPCR reaction program was as follows: 95℃-2min, 95℃-5s, 57℃-30s, 72℃-30s, 95℃-30s, 65℃-5s, 95℃-15s, for a total of 40 cycles. The primers used for Nr3c1 gene expression detection were Nr3c1-qPCR-F (SEQ ID NO.7) and Nr3c1-qPCR-R (SEQ ID NO.8), and the primers used for GAPDH reference gene expression detection were Mus Gapdh- (SEQ ID NO.9) and Mus Gapdh-R (SEQ ID NO.10).

[0035] SEQ ID NO.7: AATGGGCAAAGGCGATACCA; SEQ ID NO.8:GATCTCCAACCCAGGGCAAA; SEQ ID NO.9: AGGTCGGTGTGAACGGATTTG; SEQ ID NO. 10: TGTAGACCATGTAGTTGAGGTCA.

[0036] The results are as follows Figure 2 As shown, compared to the control group, the Nr3c1 mRNA expression level in the RAW264.7 cell line with Nr3c1 gene knockdown was significantly decreased ( P <0.0001), proving that the RAW264.7 cell line with Nr3c1 gene knockdown was successfully prepared.

[0037] (3) Assessment of the survival of RAW264.7 cell lines with Nr3c1 gene knockdown after BCG infection Control group cell lines (wild-type RAW264.7 cells) and RAW264.7 cell lines with Nr3c1 gene knockdown (shNr3c1) were infected with BCG at an MOI of 20 for 72 hours. After infection, BCG was removed, and surviving cells were cultured for another 14 days before cell counting. Results are as follows: Figure 3 As shown, compared to the control cell line, the number of surviving RAW264.7 cells with Nr3c1 gene knockout was significantly increased after BCG infection. P <0.0001). This indicates that knocking down the Nr3c1 gene can improve the survival of macrophages after BCG infection.

[0038] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. The application of the Nr3c1 gene / protein as a target in screening drugs for the prevention and / or treatment of BCG infection, characterized in that, The drug targets the Nr3c1 gene / protein to inhibit or silence its expression. The nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.

2.

2. The application of Nr3c1 gene / protein expression inhibitors in the preparation of drugs for the prevention and / or treatment of BCG infection, characterized in that, The nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.

2.

3. The application according to claim 2, characterized in that, The expression inhibitor targets the Nr3c1 gene / protein to inhibit or silence its expression.

4. The application according to claim 3, characterized in that, The expression inhibitor is an RNA fragment that interferes with the expression of the Nr3c1 gene / protein, an shRNA that targets the Nr3c1 gene, or a small molecule compound that downregulates the expression of the Nr3c1 gene.

5. The application according to claim 4, characterized in that, The nucleotide sequence of the shRNA targeting the Nr3c1 gene is shown in SEQ ID NO.3 and SEQ ID NO.

4.

6. A shRNA that specifically targets the Nr3c1 gene, characterized in that, The nucleotide sequence of the shRNA is shown in SEQ ID NO.3 and SEQ ID NO.

4.

7. The use of the shRNA of claim 6 in the preparation of a medicament for the prevention and / or treatment of BCG infection.

8. The application according to claim 1, claim 2, or claim 7, characterized in that, The drug enhances macrophage survival and strengthens macrophage resistance to BCG infection by inhibiting or silencing the expression of the Nr3c1 gene / protein.

9. The application of Nr3c1 gene / protein expression enhancers in the preparation of reagents for BCG infection research, the construction of BCG infection models, or the study of BCG immune escape mechanisms, characterized in that... The nucleotide sequence of the Nr3c1 gene is shown in SEQ ID NO.1, and the amino acid sequence of the Nr3c1 protein is shown in SEQ ID NO.

2.

10. The application according to claim 9, characterized in that, The expression enhancer targets the Nr3c1 gene / protein and promotes its expression.

Images