Inhibitor for regulating formation of extracellular trap of neutrophil based on ALPK1 and application of inhibitor in treatment of ovarian cancer metastasis

Abstract

The invention relates to the technical field of biological medicine, discloses an ovarian cancer treatment strategy based on ALPK1 protein detection and regulation, and particularly discloses an inhibitor for regulating neutrophil extracellular trap formation based on ALPK1 and application of the inhibitor in treatment of ovarian disease metastasis. The invention provides a method for evaluating the ovarian cancer metastasis risk by detecting the expression level of ALPK1 protein or the infiltration degree of related immune cells thereof, and a pharmaceutical composition containing an ALPK1 inhibiting function. In addition, the invention also relates to a treatment means for inhibiting the formation of neutrophil traps (NETs) by targeting ALPK1 or a downstream signaling pathway thereof, and the treatment means are used for improving the prognosis of ovarian cancer patients and inhibiting tumor metastasis.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of medicine, in particular to an inhibitor for regulating neutrophil extracellular trap formation based on ALPK1 and its application in treating ovarian cancer metastasis. BACKGROUND

[0002] Ovarian cancer is one of the gynecological malignancies with the highest mortality rate, and its metastatic property leads to a five-year survival rate of less than 30%. Existing treatment methods such as surgery combined with platinum chemotherapy have limited effect on advanced patients, and lack effective targets for immune regulation in the tumor microenvironment. The formation of neutrophil traps (NETs) has been confirmed to be closely related to ovarian cancer peritoneal metastasis, but the specific molecular mechanism of NETs formation has not been clearly defined, especially lacking a clinically transformable intervention strategy.

[0003] Currently, biomarker research for ovarian cancer has focused on tumor cell gene mutations (such as BRCA1 / 2), but there has been insufficient attention to the role of immune cells in tumor progression. Although some studies have shown that neutrophil infiltration is associated with poor prognosis, the key regulatory factors and clinical application potential still need to be explored. ALPK1, as a kinase related to inflammatory response, its function in solid tumors is not clear, and whether it is involved in the generation of NETs and tumor metastasis in ovarian cancer has not been systematically studied. SUMMARY

[0004] In view of the problems in the prior art, the present application aims to provide an inhibitor for regulating neutrophil extracellular trap formation based on ALPK1 and its application in treating ovarian cancer metastasis.

[0005] In order to achieve the above-mentioned application purpose, the present application provides the following technical solutions.

[0006] The application discloses an application of an ALPK1 inhibitor in the preparation of a drug for preventing ovarian cancer.

[0007] The application also discloses an application of the ALPK1 inhibitor in the preparation of a drug for preventing ovarian cancer peritoneal metastasis.

[0008] The application also discloses an application of the ALPK1 inhibitor in the preparation of a reagent for inhibiting neutrophil extracellular trap formation.

[0009] Further, the ALPK1 inhibitor in the application described in any one of the above applications includes a small molecule compound, an antibody or a fragment thereof with reduced ALPK1 expression level, or gene editing by directly acting on the ALPK1 gene itself or its expression process.

[0010] Further, the inhibitor of ALPK1 comprises sgRNA specifically targeting ALPK1 gene, and the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 2.

[0011] The application further discloses a kit for evaluating the metastasis risk of ovarian cancer, characterized in that the kit comprises reagents for detecting the expression level of ALPK1 protein or the degree of neutrophil infiltration related thereto.

[0012] Further, the kit further comprises reagents for detecting NETs markers in peritoneal fluid or blood.

[0013] The application further discloses application of ALPK1 protein as a target point for preventing ovarian cancer.

[0014] The application further discloses application of ALPK1 protein as a target point for preventing peritoneal metastasis of ovarian cancer.

[0015] Further, the target point in the application of any one of the above is a drug target point.

[0016] Compared with the prior art, the application has the following beneficial effects.

[0017] The application provides a biomarker based on the expression level of ALPK1 or the degree of neutrophil infiltration, which is used for accurately evaluating the metastasis risk and prognosis of ovarian cancer. By inhibiting the function of ALPK1, the formation of NETs is significantly reduced, thereby blocking the colonization and diffusion of tumor cells in the peritoneal microenvironment.

[0018] Small molecule inhibitors or antibody drugs targeting ALPK1 are developed, which can be used alone or in combination with chemotherapeutic drugs to enhance the anti-tumor effect. By regulating the downstream signaling pathway of ALPK1, the recruitment and activation of tumor-associated neutrophils are reduced, and the immunosuppressive microenvironment is improved. A new molecular indicator is provided for non-invasive detection of the metastatic potential of ovarian cancer, and the selection of clinical treatment programs is optimized. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 . The number of neutrophils expressing ALPK1 in the peripheral blood of ovarian cancer (OC) patients is increased. (A) The reported neutrophil-to-lymphocyte ratio (NLR) values of ovarian cancer patients. (B) A total of 178 samples were collected, including 83 normal subjects and 95 ovarian cancer patients. (C) The optimal cutoff value of NLR was determined to be 2.255 by using standard receiver operating characteristic (ROC) analysis. (D) Flow cytometry analysis of peripheral blood granulocytes and monocytes of 12 high-NLR (>2.255) and 17 low-NLR (≤2.255) ovarian cancer patients. (E) The expression of ALPK1 in each cell subpopulation in the peripheral blood of high-NLR or low-NLR ovarian cancer patients+ Percentages of cells (Student's t test).

[0020] Figure 2 ALPK1 promotes metastasis of ovarian cancer (OC) cells in vivo. (A) Schematic diagram of the experimental protocol of the intraperitoneal metastasis model. Wild-type (WT) or ALPK1 knockout (ALPK1 - / - ) C57BL / 6 mice were injected intraperitoneally with GFP-labeled ID8 cells (1 x 10 7 cells). (B) Representative images of the fluorescent signal of the mice were acquired by the live imaging system every week from the second week after ID8 cell injection to the end of the fifth week. The right panel is the quantitative analysis of the fluorescent signal (N = 6 mice per group, two-way ANOVA). At the end of the fifth week, peripheral blood was taken from anesthetized mice, bone marrow (BM) cells were obtained from the femur and tibia, and the abdominal cavity of the mice was exposed. (C) Representative anatomical images of the nodules in the abdominal cavity of the mice (left panel) and the number of nodules (right panel) (N = 6 mice per group, Student's t test). The number of nodules in the abdominal cavity of WT mice and ALPK1 - / - CD11b + Ly6G + Representative flow cytometry plots of neutrophils (N = 6 mice per group, Student's t test).

[0021] Figure 3 ALPK1 knockout suppresses ovarian cancer (OC) growth and metastasis and limits neutrophil accumulation in orthotopic tumor-bearing mice. (A) Schematic diagram of the experimental protocol of the orthotopic ovarian tumor model. GFP-labeled ID8 cells (1 x 10 6 cells) were injected into the left ovarian bursa of wild-type (WT) and ALPK1 knockout (ALPK1 - / - ) C57BL / 6 mice. (B) Representative images of the fluorescent signal of the mice were acquired by the live imaging system every week from the second week after ID8 cell injection to the end of the sixth week. The right panel is the quantitative analysis of the fluorescent signal (N = 8 mice per group, two-way ANOVA). (C) At the end of the sixth week, the bilateral ovaries of the mice were excised and observed under bright field (upper panel) and ex vivo bioluminescence imaging (lower panel). The right panel is the calculation of the tumor volume (formula: 0.5 x short diameter 2 x long diameter) (N = 8 mice per group, Student's t test). (D) Immunohistochemical staining with Ly6G was used to detect neutrophil infiltration in the orthotopic ovarian tissue (magnification = 400x, scale = 50 pm). The right panel is the quantification of the number of neutrophils in the ovarian tissue (N = 8 mice per group, Student's t test). (E) Representative flow cytometry plots of neutrophils in the peripheral blood (N = 8 mice per group, Student's t test). - / -Quantitative analysis of Ly6G-positive cells in the left ovarian tissue of mice (N=4 mice per group, Student's test). (E) Full exposure of the peritoneum and peritoneum of tumor-bearing mice to observe abdominal metastasis (left image). Dissection of the greater omentum and mesentery for observation under bright-field and in vitro bioluminescence imaging. (F) WT and ALPK1 - / - Representative flow cytometry and quantitative analysis of the proportion of ID8-GFP cells in single-cell suspensions of mouse greater omentum and mesentery tissues (N=4 mice per group, Student's test). (G) Detection of neutrophil infiltration in peritoneum and greater omentum tissues by Ly6G immunofluorescence staining (magnification=400×, scale bar=50μm), the right figure shows the quantitative results (N=4 mice per group, Student's test). (H) Western blot analysis of representative protein bands of neutrophil chemokines CXCL1 and CXCL2 in ovarian tissue (N=4 mice per group), β-actin as internal control. (I) CD11b in peripheral blood of tumor-bearing mice (N=8 mice per group, Student's test) and non-tumor controls (N=4 mice per group, Student's test). + Ly6G + Representative flow cytometry plots and quantitative analysis of neutrophil proportion.

[0022] Figure 4 In a mouse model of transplanted tumors, ALPK1 knockout inhibits NET formation. In an orthotopic ovarian tumor model, ALPK1 knockout inhibits NET formation in both wild-type (WT) and ALPK1 knockout mice. - / - Metastatic tissue was extracted from mice. Representative images of stained sections of the ovary (A), greater omentum (B), and peritoneum (C) are shown, including Ly6G (green; indicating neutrophils), Cit-histone 3 staining (CitH3; red; NETs formation marker), and DAPI (blue; indicating nuclei). The image below is a magnified view of the area within the yellow box. The right image shows Ly6G. + CitH3 + Quantitative analysis of cells (magnification = 200×, scale bar = 100μm) (N = 4 per group, Student's test).

[0023] Figure 5(A) Experimental scheme for the co-culture of human neutrophils with PMA or ascites. Peripheral blood neutrophils were isolated from normal subjects and stimulated with PMA or ascites samples collected from high NLR value ovarian cancer patients for 4h. (B) Representative images of SytoxRed staining (left panel) and Cit-histone 3 (CitH3) staining (right panel) in human neutrophils (magnification = 200x, scale bar = 100 pm) (n = 4 per group). Quantitative analysis of the right panel. (C) Experimental scheme: polymorphonuclear myeloid-derived suppressor cells (PMN-MDSCs) were extracted from the bone marrow of orthotopic ovarian tumor mice (Ly6G + CD11b + ), and stimulated with PMA or ID8 conditioned medium (ID8-CM). (D) Representative images of SytoxRed staining (left panel) and CitH3 staining (right panel) in WT mouse bone marrow neutrophils (magnification = 200x, scale bar = 100 pm) (n = 4 per group). Quantitative analysis of the right panel. (E) ALPK1 - / - Representative images of SytoxRed staining (left panel) and CitH3 staining (right panel) in mouse bone marrow neutrophils (magnification = 200x, scale bar = 100 pm) (n = 4 per group). (F) PMN-MDSCs from WT and ALPK1 - / - mice were stimulated with ID8-CM for 4h and then co-cultured with ID8-GFP cells. (G) Representative images of ID8-GFP cells attached to DNA released by neutrophils and stained with SytoxRed (lower panel; magnification = 200x, scale bar = 100 pm). Quantitative analysis of the number of attached ID8 cells (N = 4 per group, Student’s t test).

[0024] Figure 6 Validation of systemic ALPK1 knockout mice. ALPK1 gene was knocked out in mice using the CRISPR-Cas system (A). The complete absence of any ALPK1 gene product in peripheral blood granulocytes and monocytes (monocytes and lymphocytes) of Ficoll-Hypaque isolated ALPK1 - / - knockout (ALPK1 DETAILED DESCRIPTION

[0025] The application will be described in further detail below with specific embodiments. This should not be understood as limiting the scope of the above subject matter of the application to the following examples only, but any technology implemented on the basis of the content of the present application falls within the scope of the present application.

[0026] Reagents and materials used in the present application were commercially available unless otherwise specified.

[0027] I. Materials and Methods

[0028] 1. Determination of NLR cut-off value

[0029] Peripheral blood samples from OC patients and normal subjects were collected to calculate neutrophil-to-lymphocyte ratio (NLR). The cut-off value of high / low NLR was determined based on receiver operating characteristic (ROC) curve analysis, in which the "optimal" cut-off value was defined as the point on the ROC curve where the sum of sensitivity and specificity was the largest. The diagnostic performance of NLR for OC was assessed by calculating the area under the curve (AUC).

[0030] Blood samples with NLR below or above the cut-off value were collected from the second cohort of OC patients, and granulocytes (neutrophils) and monocytes (lymphocytes and monocytes) were isolated. Flow cytometry was used to detect the percentage of ALPK1-positive cells in CD15 + (granulocytes), CD8 + (cytotoxic T cells), CD4 + (helper T cells), and CD68 + (monocyte / macrophages). This study followed the Declaration of Helsinki and was approved by the Ethics Committee of Shengjing Hospital of China Medical University (approval number 2023PS1367K), and all patients were informed and signed the consent form.

[0031] 2. Construction of ALPK1 knockout (KO) mice

[0032] All mice were raised in a controlled environment (12 h light / 12 h dark cycle, humidity 45-55%, temperature 23±2°C). The animal experiments were approved by the Ethics Committee of Shengjing Hospital of China Medical University (2023PS1353K).

[0033] ALPK1 knockout mice were constructed in mouse zygotes by CRISPR / Cas9 genome editing technology. Single guide RNA (sgRNA) DNA templates were prepared using primers containing T7 promoters and sgRNA target sequences, sgRNA was transcribed by T7 High Efficiency Transcription Kit, and purified by EasyPure RNA Purification Kit. CRISPR / Cas9 protein and transcribed sgRNA were incubated in a 20 μL reaction system containing 1×TE buffer at room temperature for 10 min to assemble into CRISPR / Cas9 ribonucleoprotein (RNP) complex. sgRNA primer sequences: upstream target: ttcccgcagttcgtcagatgggg; downstream target: cagatgcagttcgcgcagcaagg.

[0034] Epididymal sperm from 10-12 week old male C57BL / 6 mice were collected and cultured in c-TYH medium to induce capacitation. Oocytes from 8-10 week old female C57BL / 6 mice treated with pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) were collected and co-incubated with capacitated sperm for in vitro fertilization (IVF). After 6h of fertilization, zygotes were washed with M2 medium and transferred to KSOMAA medium. Then, ALPK1 specific RNP complex was microinjected into the male pronucleus of zygotes, which were continuously cultured in KSOMAA medium until transplantation into pseudopregnant ICR female mice.

[0035] Twelve-week-old female ICR mice were mated with vasectomized ICR male mice to obtain pseudopregnant mice. Only female mice with vaginal plugs were identified as embryo transfer recipients (0.5-day-old pseudopregnant mice). Two-cell stage embryos were transferred into the uterus of pseudopregnant ICR female mice, and the recipient mice naturally gave birth. Tail samples were taken from 14-day-old pups and genotyped by PCR amplification. Positive founders (F0 generation) were mated with wild-type C57BL / 6 mice to obtain F1 heterozygotes, and F1 mice were further mated to generate F2 homozygotes. All mice were genotyped by tail-vein PCR, and the experimental control group used wild-type mice from the same litter.

[0036] 3. Ovarian orthotopic tumor model.

[0037] The ovarian orthotopic tumor model was established according to the literature (Song, M., et al., Tumor derived UBR5 promotes ovarian cancer growth and metastasis through inducing immunosuppressive macrophages. Nat Commun, 2020. 11(1): p. 6298.). GFP-labeled ID8 cells (1 x 10 6 were injected into the left ovarian bursa of 8-week-old ALPK1 knockout female mice through a dorsal midline incision. Starting at 2 weeks after ID8 injection, tumor growth and metastasis were evaluated by live imaging every week for 4 weeks. At the end of week 6, mice were sacrificed, and ovarian tissues were collected and photographed. The short and long diameters of tumors were measured to calculate the volume (formula: 0.5 x short diameter 2 x long diameter). Omental and mesenteric tissues were collected, the number of tumor nodules was recorded, and single-cell suspensions were prepared to quantify the proportion of ID8-GFP cells.

[0038] 4. Peritoneal metastasis model.

[0039] GFP-labeled ID8 cells (1 x 10 7

[0040] 5. Preparation of single cell suspension.

[0041] 5.1 Preparation of single cell suspension of human peripheral blood.

[0042] 5-10 mL of anti-coagulated peripheral blood was collected from 12 OC patients with NLR higher than the cut-off value and 17 OC patients with NLR lower than the cut-off value. Granulocytes and mononuclear cells (lymphocytes and monocyte / macrophages) were separated by Ficoll-Hypaque density gradient centrifugation for 25 min at 800 g. The white middle layer (containing mononuclear cells) between the blood cell layer and the Ficoll-Hypaque layer was collected, transferred to a new centrifuge tube, washed with PBS for 3 times, and the precipitate was collected by centrifugation. The red blood cells in the lower layer were removed by red blood cell lysis method, and the granulocyte precipitate was collected.

[0043] 5.2 Preparation of single cell suspension of mouse bone marrow.

[0044] The tibia and femur of ALPK1 knockout (KO) or wild type (WT) mice were taken, and the epiphyses at both ends were cut off. The bone marrow cavity was flushed with serum-free medium using a sterile syringe, and the cell mixture was filtered through a cell filter and collected in a centrifuge tube, which was centrifuged at 150 g for 5 min. The polymorphonuclear myeloid-derived suppressor cells (PMN-MDSC, i.e. CD11b + Ly6G + population, also known as granulocytic MDSCs) were isolated using a mouse MDSC sorting kit (method as above).

[0045] 5. Flow cytometry.

[0046] Single cell suspensions of human peripheral blood, mouse peripheral blood and bone marrow were collected. The single cell suspension was incubated with flow cytometry antibodies at room temperature in the dark for 15 min, and analyzed using a NovoCyte flow cytometer.

[0047] 5.3.1 Analysis of granulocytes in human peripheral blood.

[0048] Anti-CD45-fluorescein isothiocyanate (FITC), anti-CD15-phycoerythrin (PE) and anti-ALPK1-allophycocyanin (APC) were used to detect the proportion of ALPK1 positive cells in CD45 + CD15 + neutrophils. CD15 + ​Neutrophil purity was 95-97%, with the remainder being low CD15 expressing eosinophils and monocytes.

[0049] 5.3.2 Human peripheral blood mononuclear cell subpopulation analysis.

[0050] CD8 + T cells: anti-CD3-FITC, anti-CD8-PE, and anti-ALPK1-APC, detecting CD3 + CD8 + ALPK1 positive cells in the population.

[0051] CD4 + T cells: anti-CD3-FITC, anti-CD4-PE, and anti-ALPK1-APC, detecting CD3 + CD4 + ALPK1 positive cells in the population.

[0052] Macrophages: anti-CD68-PE and anti-ALPK1-APC, detecting CD68 + ALPK1 positive cells in the population.

[0053] 5.3.3 Mouse peripheral blood and bone marrow neutrophil analysis.

[0054] Neutrophil populations were identified by anti-CD11b and anti-Ly6G antibody labeling.

[0055] 6. Microscopy.

[0056] 6.1 Immunofluorescence (IF) / immunohistochemistry (IHC) staining: Frozen samples of ovarian orthotopic tumors, omentum, and peritoneal tissues were fixed with paraformaldehyde (PFA) and paraffin-embedded at 5 pm thickness, baked at 60 °C for 1 h, and deparaffinated. After rehydration, sections were microwaved in citrate antigen retrieval buffer. Regions were outlined with a hydrophobic barrier pen, and 1% bovine serum albumin (BSA) blocking solution was added (over the outlined regions) and incubated for 15 min.

[0057] 6.2 Neutrophil infiltration detection: Ly6G antibody (1:50) and Alexa Fluor-labeled goat anti-mouse IgG secondary antibody (1:200) were used for staining, and the neutrophil infiltration in omentum and peritoneal tissues was evaluated.

[0058] 6.3 NETs visualization and quantification: Serial sections from the same donor were stained with Ly6G (1:50) and citrullinated histone H3 (Cit-H3) antibody (1:2000), followed by incubation with Alexa Fluor 488-labeled goat anti-mouse IgG (1:200) and Alexa Fluor 555-labeled goat anti-rabbit IgG (1:200). Nuclei were stained with DAPI.

[0059] 6.4 Immunohistochemistry (IHC) analysis: Paraffin-embedded ovarian orthotopic tumor sections (5 pm) were rehydrated and incubated with Ly6G antibody (1:50) and HRP-labeled goat anti-mouse IgG (1:200) after antigen retrieval with 0.3% hydrogen peroxide and blocking with 1% BSA. Signals were developed with 3,3'-diaminobenzidine (DAB) and cell nuclei were counterstained with hematoxylin. Sections were observed and photographed under a fluorescence microscope.

[0060] 7. In vitro NETs detection.

[0061] 7.1 Pretreatment.

[0062] Neutrophils were isolated from peripheral blood of normal subjects by Ficoll-Hypaque density gradient centrifugation and verified purity >95% by flow cytometry with anti-CD15 antibody. Ascites samples from stage III / IV ovarian cancer patients were collected by puncture or surgery according to the method in the literature (Emmons, T.R., et al., Mechanisms Driving Neutrophil-Induced T-cell Immunoparalysis in Ovarian Cancer. Cancer Immunol Res, 2021. 9(7): p. 790-810.). Newly isolated neutrophils were mixed with ascites sample medium at a ratio of 1:1 and incubated for 4h (ascites treatment group).

[0063] PMN-MDSCs (Ly6G + CD11b + population) were isolated from bone marrow of ovarian orthotopic tumor model mice (method see above) using mouse MDSC sorting kit with purity >90%. Supernatant of ID8 cells cultured for 72h was collected and mixed with fresh medium at a ratio of 1:1 to prepare ID8 conditioned medium (ID8-CM) for neutrophil incubation for 4h (ID8-CM treatment group). Neutrophils were treated with 50nM phorbol ester (PMA) for 4h as positive control (Lapponi, M.J., et al., Regulation of neutrophil extracellular trap formation by anti-inflammatory drugs. J Pharmacol Exp Ther, 2013. 345(3): p. 430-7.).

[0064] 7.2 NETs visualization.

[0065] NETs were observed using SytoxRed or CitH3 staining. Newly isolated neutrophils were stimulated with ascites fluid, ID8-CM, or PMA for 4 h to induce NET formation. After stimulation, cells were fixed with 4% paraformaldehyde (PFA) at room temperature for 20 min, and permeabilized with 0.1% Triton X-100 for 15 min. After washing with PBS, cells were blocked with 5% BSA at room temperature for 15 min, and then stained as follows: CitH3 staining: Incubate overnight at 4°C with citrullinated histone H3 antibody (1:2000), followed by incubation at room temperature in the dark for 15 min with AlexaFluor®555-labeled anti-rabbit IgG secondary antibody (1:200). SytoxRed staining: Add the cell-permeable nucleic acid dye SytoxRed (1:1000) directly and incubate at room temperature in the dark for 15 min.

[0066] After staining, the cells were washed with PBS and counterstained with DAPI. Finally, the slides were mounted with antifluorescence quenching mounting medium, and the NETs structure was observed and photographed using a confocal microscope.

[0067] 8. Cell capture experiment.

[0068] The effect of ALPK1 on NETs capturing tumor cells was evaluated according to the reference (Lee, W., et al., Neutrophils facilitate ovarian cancer premetastatic niche formation in the omentum. J Exp Med, 2019. 216(1): p.176-194.). Wild-type (WT) and ALPK1 knockout mouse-derived PMN-MDSCs were seeded in culture dishes and stimulated with ID8 conditioned medium (ID8-CM) for 4 h (method as above). After removing the medium, neutrophils were gently washed with PBS, and fresh medium was added. GFP-labeled ID8 cells were co-incubated with neutrophils for 1 h. Following the aforementioned immunofluorescence staining procedure, the cell mixture was stained with SytoxRed and DAPI. Each group was divided into three replicates, and the number of captured ID8 cells was counted under a 200x microscope using multiple fields of view.

[0069] 14. Survival Experiment.

[0070] GFP-labeled ID8 cells (1×10⁻⁶) 6 (1) ALPK1 knockout mice were injected into the left ovarian cyst of WT female mice through a single midline incision on the back. Starting from week 2 after ID8 injection, tumor progression was monitored weekly by in vivo imaging until week 10, and mouse survival curves were recorded.

[0071] 15. Statistical analysis.

[0072] Data analysis was performed using GraphPadPrism 9.5 software.

[0073] Data presentation: Quantitative data are represented as mean ± standard deviation (mean ± SD), and qualitative data are represented as sample size (n).

[0074] Correlation analysis: The correlation between NLR and patient clinical data was assessed using the chi-square test (χ² test).

[0075] Between-group differences: The Student's test is used when the data conforms to a normal distribution, and the test is used when the data does not conform to a normal distribution.

[0076] Comparisons at multiple time points: Two-way ANOVA combined with Sidak post-hoc test was used. The significance threshold was set at P < 0.05.

[0077] II. Experimental Results.

[0078] 1. Correlation between clinicopathological features of ovarian cancer (OC) patients and NLR.

[0079] The neutrophil-lymphocyte ratio (NLR) is a commonly used indicator for assessing infection status. Clinical studies have shown that ovarian cancer patients with elevated NLRs typically exhibit more aggressive tumor features and a poorer prognosis. Figure 1 A). This study collected peripheral blood samples from patients to determine the NLR cutoff value, and a total of 178 samples were included (83 normal subjects and 95 ovarian cancer patients). Figure 1 B). The NLR range for normal subjects was 0.67–2.92 (median 1.73), while the NLR range for ovarian cancer patients was 1.2–15.83 (median 3.18). Figure 2 B). Previous literature reports NLR cutoff values ​​for ovarian cancer patients ranging from 2.6 to 5.25 (…). Figure 1 A). Through ROC curve analysis, this study determined the optimal critical value for NLR to be 2.255 (AUC = 0.8009, P The NLR values ​​were <0.001, sensitivity = 0.6316, and specificity = 0.8313. Ninety-five ovarian cancer patients were divided into a high NLR group (≥2.255, n = 60) and a low NLR group (<2.255, n = 35). As shown in Table 1, high NLR was significantly associated with advanced FIGO stage, peritoneal metastasis, and lymph node metastasis, suggesting the importance of NLR in the progression of ovarian cancer.

[0080] Given the significant regulatory role of ALPK1 on immune cells, we further investigated the expression of ALPK1 in specific immune cells. Peripheral blood immune cells from ovarian cancer patients were analyzed by flow cytometry (strategy see [link to strategy]). Figure 1D), found that neutrophils, T cells (CD4 + or CD8 + ) and macrophages all expressed ALPK1 ( Figure 1 D), with the proportion of ALPK1 positive cells in neutrophils being significantly higher than that in T cells (about 6-8%) and macrophages (about 2%), reaching about 40% ( Figure 1 E). In addition, the expression level of ALPK1 in neutrophils in patients in the high NLR group was significantly higher than that in the low NLR group ( Figure 1 E). The above results show that ALPK1 may mainly participate in the regulation of neutrophil function in the microenvironment of ovarian cancer, and the expression of ALPK1 in neutrophils is up-regulated in patients with high NLR.

[0081] .

[0082] 2. ALPK1 is highly expressed in neutrophils of ovarian cancer (OC) patients.

[0083] Based on the above biological results, we bred ALPK1 - / - mice. The knockout of ALPK1 in immune cells (including granulocytes and monocytes) was verified by RT-qPCR, WB and immunofluorescence staining, and the results showed that ALPK1 gene and protein expression was detected in WT mice, while ALPK1 - / - mice were deleted ( Figure 6 ). To evaluate the role of ALPK1 in OC metastasis and immune regulation, we constructed an abdominal (ectopic) tumor metastasis model in female C57BL / 6 mice with normal immune function (wild type or ALPK1 knockout) by intraperitoneal injection of ID8-GFP cells ( Figure 2 A). Two weeks after tumor inoculation, bioluminescence imaging showed increased fluorescence expression in mice, and the fluorescence curve showed that the tumor growth of ALPK1 - / - mice was inhibited after three weeks ( Figure 2 B). Dissection and quantitative analysis showed that the tumor burden of ALPK1 - / - mice was reduced, manifested as a decrease in the number of tumor nodules ( Figure 2 C).

[0084] Compared with WT mice, the proportion of CD11b - / - Ly6G + neutrophils in the peripheral blood of ALPK1 + mice was reduced ( Figure 2 D). In addition, the level of such cells in the bone marrow was also significantly reduced ( Figure 2 E). These data suggest that the deletion of ALPK1 may inhibit tumor-induced myelopoiesis and / or bone marrow release of neutrophils.

[0085] 3. ALPK1 knockout inhibits ovarian cancer (OC) growth and metastasis and limits neutrophil accumulation in orthotopic tumor-bearing mice.

[0086] Ectopic transplantation models cannot reveal how tumor microenvironment interactions lead to distant metastasis as deeply as orthotopic tumor models. We further validated the anti-tumor and anti-metastatic effects of ALPK1 in vivo in an orthotopic ID8 tumor model. Figure 3 A). Tumor growth was monitored by bioluminescent signals with GFP-labeled ID8 cells. The fluorescence signals of primary tumor tissues in each group gradually increased over time after orthotopic injection of ID8-GFP cells into the ovarian bursa of mice. Figure 3 B). Compared with WT mice, ALPK1 knockout significantly inhibited the growth of ID8 tumors in mice, as evidenced by a decrease in fluorescence signals in primary tumor tissues. Figure 3 B). Meanwhile, gross dissection of ovarian tissues showed that the tumor volume was significantly reduced in the knockout group compared with the control tumor. Figure 3 C).

[0087] Immune cells in the tumor microenvironment (TME) are key factors in tumor metastasis. Bioluminescent signals showed that metastasis was detectable at weeks 5 and 6. Figure 3 B). At the end of week 6, mice were sacrificed to examine tumor metastasis and neutrophil infiltration. A large number of Ly6G + Neutrophil infiltration in the primary tumors of ALPK1 - / - mice was significantly reduced. Figure 3 D).

[0088] Next, we evaluated the effect of ALPK1 on the metastatic tropism of OC. Tumor metastasis is a dynamic process in which primary tumor cells detach from the primary lesion and spread to different tissues and organs to form metastatic lesions. In particular, OC cells tend to metastasize to peritoneal adipose tissues, including the peritoneum, greater omentum, and mesentery. A large number of and larger metastatic nodules were observed in the peritoneum, greater omentum, and mesentery of WT tumor-bearing mice, while ALPK1 - / - Tumor-bearing mice only observed a few nodules in these peritoneal sites. Figure 3 E). Flow cytometry showed that the proportion of ID8-GFP cells in the greater omentum and mesentery of ALPK1 - / - mice was generally lower than that in WT mice, indicating that ALPK1 knockout effectively inhibited the peritoneal dissemination of ovarian cancer. Figure 3 F).

[0089] Subsequently, we explored whether the impaired peritoneal dissemination phenotype in ALPK1 - / - mice was due to limited neutrophil recruitment. Immunofluorescence staining confirmed that ALPK1 - / -Tumor-infiltrating neutrophil numbers were significantly reduced in the omentum and peritoneum of tumor-bearing mice Figure 3 G). ALPK1 - / - CXCL1 and CXCL2 protein levels were reduced in primary ovarian tumors of mice, suggesting that ALPK1 deletion might inhibit neutrophil recruitment in primary ovarian tumors Figure 3 H). Moreover, compared to WT tumor-bearing mice, ALPK1 - / - Ly6G + CD11b + Neutrophil total numbers were reduced Figure 3 I). Notably, WT or ALPK1 - / - mice, which were not injected with ID8 cells, did not show significant changes in peripheral blood neutrophil numbers Figure 4 I), indicating that ALPK1 deletion does not affect circulating neutrophil numbers under normal physiological conditions.

[0090] Taken together, these results suggest that ALPK1 knockout might hamper neutrophil migration from the blood, thus preventing the accumulation of tumor-infiltrating neutrophils in the tumor and pre-metastatic niches.

[0091] 4. ALPK1 knockout inhibits NETs formation in a tumor engrafted mouse model.

[0092] The pro-metastatic role of neutrophils in ovarian cancer (OC) is associated with the formation of NETs (neutrophil extracellular traps). Given the neutrophilic infiltrate observed in both primary tumors and metastatic sites, we explored whether ALPK1 plays a role in NETs formation. Immunofluorescence analysis revealed NETs infiltrate in different sites of tumor-bearing mice. Assessment of the ovary Figure 4 A) and the main target tissues of OC metastasis, including the omentum Figure 4 B) and the peritoneal wall Figure 4 C) showed that Ly6G significantly co-localized with the NETs component Cit-H3 in C57BL / 6 mice with primary tumors in situ, indicating NETs formation Figure 4 A-C). In contrast, in ALPK1 - / - mice, not only the number of Ly6G + cells was reduced in these sites, but also the CitH3 positive signal was significantly attenuated in Ly6G + cells, indicating that ALPK1 knockout inhibits NETs formation in the ovary and in the invaded peritoneal and omental tissues Figure 5 A-C). This suggests that ALPK1 knockout inhibits tumor growth and metastasis by limiting neutrophil infiltration and NETs release in the peritoneum and omentum.

[0093] 5. NETs formation is driven by tumor-derived factors and this process is impaired by ALPK1 deletion.

[0094] The ovarian tumor microenvironment is a unique complex structure composed of primary tumors and malignant ascites. Ascites is a common clinical feature of advanced OC and plays an important role in OC metastasis. As mentioned previously, the bone marrow releases increased numbers of neutrophils in the cancerous state, and ascites chemoattracts and induces neutrophils to assume an inhibitory phenotype. We collected peripheral blood plasma from healthy donors, enriched neutrophils by Ficoll-Hypaque density gradient centrifugation, and identified them by CD15 Figure 5 A). Ascites from advanced OC patients with high NLR (>2.255) were obtained to assess their potential to induce NETs release. Neutrophils stimulated by ascites released more extracellular DNA fibers Figure 5 A). To verify whether the DNA originated from NETs, CitH3 immunoreactivity was further detected, and the results showed that most of the neutrophils treated with ascites were CitH3 positive Figure 5 A). PMA (a classical NETs inducer) was used as a positive control in the experiment.

[0095] Ascites contains various tumorigenic cytokines, chemokines, and other factors secreted by cancer cells or immune cells. Next, we investigated whether OC cell-derived factors induced NETs release. Although the peripheral blood volume is large, the number of isolated neutrophils is small (about 2-5 x 10 5 ), whereas a large number of neutrophils are stored in the bone marrow. Therefore, we isolated PMN-MDSCs from ALPK1 - / - or WT mice by Ficoll-Hypaque (Fig. Figure 5 C) and identified them by CD11b + Ly6G + ID8 cell-conditioned medium (ID8-CM) induced the release of large-area NETs from bone marrow neutrophils, as evidenced by an increase in SytoxRed-positive and CitH3-stained reticular structures (Fig. Figure 5 D-E). Regardless of ID8-CM or PMA treatment, ALPK1 - / - neutrophils formed fewer NETs than WT cells (Fig. Figure 5 D-E). NETosis is a unique form of cell death characterized by the release of DNA reticular structures with decondensed chromatin. ID8-CM-treated ALPK1 - / - neutrophils had fewer CitH3-positive cells (Fig. Figure 5 E), and the colocalization of CitH3 and extracellular DNA fibers was significantly reduced (Fig. Figure 5 E), indicating that ALPK1 knockout not only inhibited neutrophil activation but also limited NETs formation.

[0096] NETs promote metastasis by trapping tumor cells. Results show that ALPK1 deletion not only inhibits NETs formation, but also reduces NET-positive neutrophil adhesion to ID8 cells (Fig. 6F-G). These data suggest that ALPK1 is involved in regulating NETs formation and tumor cell adhesion to NETs. ​ F-G). These data suggest that ALPK1 is involved in regulating NETs formation and tumor cell adhesion to NETs.

[0097] In summary, our studies reveal a mechanism by which ALPK1 knockout inhibits ovarian cancer growth and metastasis by suppressing neutrophil infiltration and NETs (neutrophil extracellular traps) formation in primary ovarian cancer (OC) tumors and metastatic sites. These data provide important evidence for developing tumor metastasis treatment strategies targeting ALPK1.

[0098] The above only describes the preferred embodiments of the present application and is not used to limit the patent scope of the present application. For those skilled in the art, the present application can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. Application of ALPK1 inhibitors in the preparation of drugs for the prevention of ovarian cancer.

2. Application of ALPK1 inhibitors in the preparation of drugs for preventing peritoneal metastasis of ovarian cancer.

3. Application of ALPK1 inhibitors in the preparation of reagents to inhibit the formation of extracellular traps in neutrophils.

4. The application according to any one of claims 1 to 3, characterized in that, The ALPK1 inhibitors include small molecule compounds, antibodies, or fragments thereof that reduce ALPK1 expression levels, or gene editing that directly acts on the ALPK1 gene itself or its expression process.

5. The application according to claim 4, characterized in that, The ALPK1 inhibitor includes an sgRNA that specifically targets the ALPK1 gene, and the nucleotide sequence of the sgRNA is shown in any one of SEQ ID NO.1 to SEQ ID NO.

2.

6. A kit for assessing the risk of ovarian cancer metastasis, characterized in that, The kit contains reagents for detecting ALPK1 protein expression levels or their associated neutrophil infiltration.

7. The kit according to claim 6, characterized in that, The kit also contains reagents for detecting NETs markers in peritoneal fluid or blood.

8. Application of ALPK1 protein as a target for the prevention of ovarian cancer.

9. Application of ALPK1 protein as a target for preventing peritoneal metastasis of ovarian cancer.

10. The application according to any one of claims 8 to 9, characterized in that, The target is a drug target.

Images