Goose astrovirus, goose astrovirus egg yolk antibody as well as preparation method and application of goose astrovirus egg yolk antibody

By using goose astrovirus RD240629A to prepare an inactivated vaccine and egg yolk antibodies, the problem of goose astrovirus being difficult to control has been solved, providing an efficient, safe, and low-cost control method suitable for the prevention and treatment of goose astrovirus.

CN120888508APending Publication Date: 2025-11-04QINGDAO RUNDA BIOTECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511070875.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-31
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

The lack of effective antibodies against goose astrovirus in existing technologies makes goose astrovirus infection difficult to control. Furthermore, conventional disinfectants are not sensitive to the virus, vaccine development is difficult, there is a lack of ideal prevention and control drugs on the market, and antibody extraction methods are complex, resulting in huge market demand and production difficulties.

Method used

Using goose astrovirus RD240629A as the antigen, an inactivated vaccine was prepared. The egg yolk antibody preparation method included antigen preparation, inactivation, emulsification, immunization, collection of hyperimmune eggs, acid extraction, and caprylic acid degreasing to obtain highly effective and safe goose astrovirus egg yolk antibodies for the prevention and treatment of goose astrovirus diseases.

Benefits of technology

The prepared egg yolk antibodies have high antigen binding capacity and neutralizing activity, strong stability, are suitable for large-scale production, are safe with no drug residues, can effectively control goose astrovirus, reduce production costs, reduce potential harm to poultry and the environment, and meet the needs of green farming.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888508A_ABST
    Figure CN120888508A_ABST
Patent Text Reader

Abstract

The invention relates to the field of biological products, and particularly discloses a goose astrovirus, a goose astrovirus egg yolk antibody as well as a preparation method and application of the goose astrovirus egg yolk antibody. The invention relates to a goose astrovirus, which is named as RD240629A, is preserved in the China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC No: 46197, and the preservation date is September 23, 2024. The goose astrovirus is named as RD240629A, and the goose astrovirus is named as RD240629A and is preserved in the China General Microbiological Culture Collection Center (CGMCC). The goose astrovirus can be used for preparing the egg yolk antibody for preventing gout of goslings, the egg yolk antibody is good in safety, no local or whole-body adverse reaction caused by antibody injection occurs, infection of the novel goose astrovirus can be effectively prevented and / or treated, and the anti-gout effect is good. The prepared egg yolk antibody is evaluated by adopting antibody titer determination and a challenge protection test, the titer of the egg yolk antibody is not lower than 1: 256, and the egg yolk antibody has a good commercial development prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological products, in particular to a goose astrovirus, goose astrovirus yolk antibody and a preparation method and application thereof. BACKGROUND

[0002] The goose astrovirus (GAstV, Avastrovirus, Astroviridae) is a single-stranded positive-strand, non-enveloped RNA virus with a full-length viral genome of 7.9 kb. The virus is determined to be the pathogenic agent of viral gout disease in geese in recent years, and has broken out in many goose breeding areas in China since 2017. GAstV mainly infects 5-20-day-old goslings, with an incidence rate of 70%-80% and a mortality rate of 10%-30%. It mainly causes a large amount of urate deposition in the joint cavity and internal organs of diseased geese, weight loss, and becomes a dead goose, which has caused great economic losses to the goose breeding industry in China.

[0003] In recent years, the emergence of some new astroviruses and astrovirus variants has made the harm of astrovirus increasing, and astrovirus infection often causes environmental pollution, making it difficult to purify poultry diseases. The virus is stable in the environment and is not sensitive to conventional disinfectants, so the development of vaccines is very important for the prevention and control of the disease. Because the virus is difficult to propagate in vitro, it is difficult to develop conventional inactivated vaccines and attenuated vaccines. There is no ideal commercial drug on the market that can prevent and control the disease, and goose astrovirus antibodies for emergency prevention and early infection treatment of goose astrovirus are rarely reported. At the same time, the extraction method of goose astrovirus antibody is still one of the factors restricting the mass production of lgY, and the market demand for goose astrovirus antibody is huge.

[0004] Because the toxicity of the virus directly affects the condition of the antibody, it is necessary to screen astrovirus with strong pathogenicity and high immunogenicity, and to prepare goose astrovirus antibody with high purity, high titer and good treatment and prevention effect. SUMMARY

[0005] In order to prevent and control goose astrovirus, the application provides a high-efficiency and rapid biological agent, and provides a goose astrovirus, a goose astrovirus yolk antibody and a preparation method and application thereof.

[0006] In a first aspect, the application provides a goose astrovirus, which adopts the following technical scheme: A goose astrovirus, wherein the goose astrovirus (Goose astrovirus) is named RD240629A, is preserved in the China General Microbiological Culture Collection Center, and has a preservation number of CGMCC No: 46197 and a preservation date of September 23, 2024.

[0007] By adopting the technical scheme, raw materials are provided for vaccine protection test of virus strains of poultry breeding, vaccines and drugs are developed in a targeted manner, the development process of vaccines and drugs is accelerated, the prevention and control effect is improved, and it is of great significance in the aspect of goose epidemic prevention and control.

[0008] In a second aspect, the application provides a goose astrovirus yolk antibody, which adopts the following technical scheme: A goose astrovirus yolk antibody is prepared by using an inactivated vaccine prepared from a goose astrovirus RD240629A strain as an antigen.

[0009] By adopting the technical scheme, the yolk antibody has high antigen binding capacity and neutralization activity, is more stable in vitro, has more excellent heat resistance and acid and alkali resistance, is more suitable for large-scale production and application, and as a natural immune product, does not contain drug residues, avoids potential harm of chemical drugs to geese and the environment, ensures biological safety, and meets the needs of green breeding; the goose astrovirus is used to prepare the yolk antibody, the yolk antibody obtained has good immunization effect, and has the characteristics of high efficiency, safety, low cost and good environment, can prevent large-scale outbreak of goose astrovirus in goose flocks, and has effective protection effect and treatment effect, and improves the overall anti-risk ability of the goose breeding industry.

[0010] In a third aspect, the application provides a preparation method of a goose astrovirus yolk antibody, which adopts the following technical scheme: A preparation method of a goose astrovirus yolk antibody comprises the following steps: S1, preparing an antigen: using a goose astrovirus RD240629A to prepare an antigen; S2, preparing an inactivated antigen: inactivating the antigen with a formaldehyde solution to prepare an inactivated antigen; S3, preparing an immunizing antigen: uniformly mixing the inactivated antigen and sterilized Tween 80 to prepare an aqueous phase; uniformly mixing white oil and Span 80 to prepare an oil phase, mixing and emulsifying the oil phase and the aqueous phase to prepare an immunizing antigen; S4, preparing a yolk antibody: immunizing laying hens with the immunizing antigen, collecting high-immune eggs, disinfecting the high-immune eggs, collecting yolk, acidifying and extracting, removing fat with caprylic acid, filtering, concentrating, and preparing a goose astrovirus yolk antibody with a neutralization titer not less than 1:256.

[0011] By adopting the technical scheme, the virus is first inactivated after being prepared into an antigen, the safety of the vaccine is improved, the immunogenicity of the antigen is well maintained while the virus is effectively inactivated, the potential harm to poultry and subsequent users is reduced, the safety is high, and the immunogenicity of the virus antigen is stable by using formaldehyde solution for inactivation, then the yolk antibody is collected from high-immune eggs, the production is convenient, complex equipment and technology are not required, it is easy to scale up, the cost is low, and the emergency of poultry is also reduced.

[0012] Optionally, in the step S1, the antigen is prepared as follows: the goose star virus RD240629A is inoculated into 12-day-old goose embryos through the chorioallantoic membrane, and the allantoic fluid and dead embryo of the goose embryo that dies and has typical lesions at 36-120 hours are collected; the dead embryo is ground to obtain a slurry, centrifuged, repeatedly frozen and thawed to obtain an embryo grinding liquid; the allantoic fluid and the embryo grinding liquid are mixed and centrifuged, and the antigen is obtained after sterile test.

[0013] By using the above technical solution, the goose embryo with low degree of tissue differentiation is used for virus proliferation, and high-concentration virus antigen can be prepared, which is easy to collect and process and simple to operate.

[0014] Optionally, in the step S2, the inactivation method of the formaldehyde solution on the antigen is as follows: the formaldehyde solution is added to the antigen, and the formaldehyde solution is mixed until the final concentration of the formaldehyde solution is 0.1%, and then the mixture is inactivated at 37℃ for 24 hours after being sealed, to obtain the inactivated antigen.

[0015] By using the above technical solution, the formaldehyde solution is used to inactivate the antigen, which can effectively inactivate the virus and maintain the immunogenicity of the antigen, and reduce the potential harm to the goose.

[0016] Optionally, in the step S4, the immunization method is as follows: the immunization antigen is injected into the laying hen, and the eggs are collected after four immunizations for detection, and the eggs with neutralizing titer not less than 1:1600 are qualified high immune eggs.

[0017] By using the above technical solution, the antibody prepared from the high immune eggs with titer not less than 1:1600 can quickly bind and remove free viruses, and significantly reduce the risk of infection.

[0018] Optionally, in the step S4, the method for collecting egg yolk is as follows: the high immune egg is separated into egg white and egg yolk, the egg yolk and the sodium phosphate dibasic solution are mixed according to a volume ratio of 1:1, filtered, and then the sodium phosphate dibasic solution with a volume ratio of 2 times the egg yolk is added and stirred at a uniform speed.

[0019] By using the above technical solution, after the sodium phosphate dibasic solution is mixed with the egg yolk, the pH value can be relieved and adjusted, the acid-base balance of the system is maintained, the stability of the antibody is improved, the activity of the antibody is ensured, and the purification effect is promoted.

[0020] Optionally, in the step S4, the method for acidification extraction is as follows: the mixed solution of the egg yolk and the sodium phosphate dibasic solution collected from the egg yolk is mixed with a settling agent, the volume ratio of the mixed solution of the egg yolk and the sodium phosphate dibasic solution to the settling agent is 1:1, the mixture is settled, the pH is adjusted to 6, and the mixture is settled at 4℃ until the titer of the supernatant is not less than 1:256.

[0021] By adopting the technical scheme, the yolk is settled by using a settling agent, and then the pH value is adjusted, so that the lipoprotein is dissolved, and the impurities are reduced. Moreover, the acidification extraction does not need organic solvents or high-temperature treatment, so that the antigen binding capacity is not affected, the operation condition is mild, and the safety is high.

[0022] Optionally, the octanoic acid defatting method in the step S4 is that octanoic acid is added into the acidification extraction product, the concentration of the octanoic acid is 0.1%, and then the mixture is placed at room temperature for 2-6 hours.

[0023] By adopting the technical scheme, under the conditions of low ionic strength and acidity, the octanoic acid forms an irreversible precipitate with most yolk proteins, and the lgY antibody protein does not react and remains in the supernatant, so that the operation is simple, the antibody activity is not damaged, the defatting effect is good, and the purity of the yolk antibody is improved.

[0024] In a fourth aspect, the application provides a use of the goose astrovirus yolk antibody in treatment or prevention of goose astrovirus disease.

[0025] By adopting the technical scheme, with the scale development of the goose breeding industry, the prevention and control demand of infectious diseases such as goose astrovirus is increasingly urgent. The goose astrovirus yolk antibody as a new biological preparation has significant advantages in the goose breeding, including high efficiency, safety, low cost, and environmental friendliness, and is expected to become an important means for disease prevention and control in the goose breeding industry.

[0026] In summary, the application has the following beneficial effects: Due to the fact that the application adopts the goose astrovirus RD240629A with strong pathogenicity and high immunogenicity, and the inactivated vaccine prepared by using the goose astrovirus RD240629A as an antigen to prepare the yolk antibody has high safety and specificity, good treatment and prevention effects, and low production cost, the application can effectively prevent and control diseases caused by the goose astrovirus, and promote the development of the industry in a green, efficient, and sustainable direction. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 It is an agarose gel electrophoresis map of the goose astrovirus RD240629A (lane 1 is a marker, lanes 2-3 are the goose astrovirus RD240629A, and lane 4 is an ASTV negative control).

[0028] Figure 2 It is a dissection map of a goose embryo infected with the goose astrovirus RD240629A.

[0029] Figure 3 It is a dissection map of the internal organs of a sick gosling infected with the goose astrovirus RD240629A (left is the heart, middle is the kidney, and right is the liver).

[0030] Figure 4Genetic homology alignment chart of goose astrovirus RD240629A strain.

[0031] Figure 5 Genetic phylogenetic tree chart of goose astrovirus RD240629A strain. According to the phylogenetic analysis, RD240629A has a distant relationship with the existing sequences, belongs to a new branch, and is a newly discovered strain. DETAILED DESCRIPTION

[0032] The following examples further illustrate the present application. EXAMPLE

[0033] Among the following raw materials, the sterile PBS solution is selected from Wuhan Dr. De Biological Engineering Co., Ltd., 2xTap PCR StarMix is purchased from Beijing Kangrunchengye Biological Technology Co., Ltd., Tween 80 and Span 80 are purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd.; StarSceipt III One-Step RT-RCR Kit (Dye) extraction kit is purchased from genstar, and other raw materials are ordinary market.

[0034] Example 1: isolation and identification of a goose astrovirus RD240629A: 1. Virus isolation: collect the diseased goose from a suspected goose factory infected with astrovirus in Shandong area, take 100g of liver, spleen, kidney and pancreas tissue, add sterile PBS solution at a ratio of 1:2 (W / V) in the tissue, grind and homogenize, freeze-thaw 3 times, centrifuge at 6000 rpm for 15 min, take the supernatant for strain isolation and purification, filter with a sterile filter, pass the sterile test, and store at -20℃ for standby. The virus filtrate is inoculated into 12-13 day old goose embryos, 0.2ml per embryo, incubated at 38.5℃, and the embryos are checked daily. The goose embryos that died within 24 hours were discarded, and the typical goose embryos that died and had lesions were collected, cooled at 2-8℃ for 12-24h, and the goose embryo allantoic fluid and embryo grinding liquid were obtained.

[0035] 2. Virus identification 2.1 Virus DNA extraction: the specific operation process is carried out according to the StarSceipt III One-Step RT-RCR Kit (Dye) extraction kit instructions, and the sample addition amount is 300μL.

[0036] 2.2 Identification primer: NDRV-F: TGGTGGTGYCTYCTCAARA; NDRV-R: GYCKGTCATCMCCRTARCA, the fragment length of the secondary identification primer is 601bp.

[0037] 2.3 PCR amplification system: 20 μL amplification system was used for amplification, and the specific reagents are shown in Table 1.

[0038] Table 1 PCR amplification system (20 μL) Component Total system (20 μL) Template 4 2 x Tap PCR Star Mix 10 Upstream primer 2 Downstream primer 2 ddH2O 2 2.4 Amplification procedure: PCR reaction parameters: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 55°C annealing for 40 s, 72°C extension for 40 s, 30 cycles; after the end of the cycle, 72°C extension for 10 min, 4°C storage; the PCR product after the reaction was completed was subjected to 1% agarose gel electrophoresis. The obtained PCR electrophoretogram is shown in Figure 1 , from which it can be seen that the target fragment is successfully amplified, and the size of the amplified band is consistent with the expectation, which is named goose astrovirus RD240629A, and is preserved in China General Microbiological Culture Collection Center (CGMCC), with a microbial preservation number of CGMCC NO: 46197, and the nucleotide sequence is as follows: ATGGGATATTACGTATGATCTTGTGTGCTGATCCAGTATATACAAGGATTGGAGCCATGTT TGAGCAGGACCAGAATGAGAAAATGAAGCAACAGACAGAACGGCGGGCTGCACAAGT TGGTTGGACACCCTTTTTTGGTGGAATACATCAGCGAGTATCTAGGCTTATTGGTGGTGG TGACAGGTTTTTTGTAGAGACGGACTGGACGCGTTATGATGGAACGTTGCCCAAGCCTC TTTTCTGGCGGATACGACAGATGCGTTACTTTTTCCTGTCCAACCATCATAAGACACCAC AGCTTAAGAAACTCTATGATTGGTATGTTAAAAACCTAGTCGAAAAAATTATATTATTACC AACTGGGGAGGTTTGTACAGTTAAGAAGGGAAATCCAAGTGGCCAATATTCAACAACA GTGGACAACAATATGTGTAATGTCTGGCTCACCCATTTTGAGATAGCTTATCTTTATTGGA AACAGCATGGGTCATTGCCGACGCTCAGATTACTCAGGGATAATGTCACCATGATTTGCTACGGAA.

[0039] 2.5 Goose astrovirus RD240629A virulence to SPF goose embryos The goose astrovirus RD240629A was diluted 1:100 with sterile PBS solution (0.01 mol / L, pH = 7.2), and 10 12-day-old SPF goose embryos were inoculated with 0.2 ml of the diluted solution each, and incubated at 38.5°C. The mortality of the SPF goose embryos was observed 24-168 h after inoculation, as shown in Table 2. The dead goose embryos were dissected, and the results were as follows: Figure 2 The dead goose embryos showed obvious hemorrhage and edema, and were reddish.

[0040] Table 2 Analysis of the mortality of SPF goose embryos Time / h 12 24 36 48 72 84 96 RD240629A 0 0 7 2 1 / / Time / h 108 120 132 144 156 Number of deaths Total number RD240629A / / / / / 10 10 2.6 Determination of the median infectious dose (ELD50) of goose astrovirus RD240629A The isolated goose astrovirus RD240629A stock solution was diluted 10 times with PBS solution (0.01 mol / L, pH = 7.2) to obtain 8 dilutions, and each dilution was inoculated into 10 9-day-old susceptible goose embryos via the chorioallantoic membrane, with 0.2 ml of the diluted solution per embryo. Ten goose embryos were inoculated with 0.2 ml of normal saline as a control, and incubated at 37°C. The goose embryos were observed daily, and the dead goose embryos were discarded within 24 h. Then, the goose embryos were observed every 24 h until 168 h. The cumulative number of dead and surviving goose embryos at each dilution was counted, and the ELD50 of the virus in 0.2 mL of the suspension was calculated according to the Reed-Muench method. The results are shown in Table 3, which shows that the goose astrovirus RD240629A has strong virulence and high infection mortality.

[0041] Table 3 Mortality of inoculated goose embryos and ELD50 Example 2: A method for preparing a goose astrovirus yolk antibody, comprising the following steps: S1, Preparation of antigen with goose astrovirus RD240629A: The goose astrovirus RD240629A isolated in Example 1 was inoculated into 12-day-old specific pathogen-free goose embryos by allantoic inoculation at a dose of 0.2 mL / embryo. The dead embryos within 24 h were discarded, and the goose embryo allantoic fluid and dead embryo bodies that died and had typical lesions at 36-120 h were collected. The dead embryo bodies were ground to obtain a slurry, which was centrifuged at 4,000 rpm for 30 min. The slurry was repeatedly frozen and thawed three times to obtain a ground embryo slurry. The collected goose embryo allantoic fluid and the ground embryo slurry were mixed at a ratio of 1:2 (V / V), centrifuged at 6,000 rpm for 15 min, and then the supernatant was quantitatively dispensed and stored at a low temperature after sterility test. Thus, the antigen was obtained.

[0042] S2, Preparation of inactivated antigen by inactivating the antigen with formaldehyde solution: The qualified antigen (the mortality of 12-day-old susceptible goose embryos after inoculation should be at least 80% within 24-168 h, and the PCR electrophoresis strip should be correct and clear) was mixed, formaldehyde solution with a concentration of 10% was added, and the mixture was mixed thoroughly to obtain a final concentration of 0.1% formaldehyde solution. Then, the formaldehyde solution was poured into a sterile stainless steel container, which was tightly closed and stirred at 37°C for 24 h (the timing started from the temperature of the antigen rising to 37°C, and the stirring was performed 3-4 times during the period). After inactivation, samples were taken for inactivation test. The inactivated antigen was stored at 2-8°C for standby use.

[0043] Test of inactivated antigen: 2.1 Sterility test: The inactivated antigen was tested according to the appendix of the 2015 edition of Chinese Veterinary Pharmacopoeia, and the growth was sterile.

[0044] 2.2 Inactivation test: The inactivated antigen was inoculated into 12-day-old specific pathogen-free goose embryos by allantoic inoculation at a dose of 0.2 mL / embryo. The inoculated embryos were observed for 168 h. All the specific pathogen-free goose embryos should be alive, and the blind transmission of one generation should also be performed. All the specific pathogen-free goose embryos should still be alive.

[0045] S3, Preparation of immune antigen: 3.1 Preparation of oil phase: 94 g of white oil and 6 g of Span-80 were mixed, heated to 90°C while stirring, sterilized at 121°C for 30 min, and used as the oil phase. 3.2 Preparation of water phase: 94 g of inactivated antigen and 4 g of sterilized Tween-80 were mixed uniformly to completely dissolve the Tween-80, and the water phase was prepared. 3.3 Emulsification: The oil phase was added to a high-speed shearing instrument, stirred at a speed of 15,000 r / min, and the water phase was added at the same time. The ratio of the oil phase to the water phase was 3:1 (v / v), and the mixture was emulsified for 6 min. The mixture was aseptically dispensed into 250 ml sterile bottles and stored at 2-8°C.

[0046] 3.4 Test of immune antigen: 3.4.1, Characteristic: appearance: milky white uniform emulsion.

[0047] Dosage form: water-in-oil: take a clean straw, take a small amount of immune antigen and add it to cold water, except for the first drop, none of them spread.

[0048] Stability: take 10 ml of immune antigen and add it to a centrifuge tube, centrifuge at 3000 r / min for 15 min, the water phase of 0.1 ml is separated from the bottom of the tube, not more than 0.5 ml.

[0049] 3.4.2, Sterility test: according to the 2015 edition of Chinese Veterinary Pharmacopoeia Appendix for testing, no sterile growth.

[0050] 3.4.3, Safety test: 10 14-day-old SPF chickens were used, and 2 ml of immune antigen was injected into the leg muscles, and observed for 14 days. No local and systemic adverse reactions caused by injection of immune antigen were observed.

[0051] 3.4.4, Immunogenicity: 20 60-day-old SPF chickens were used, of which 15 were injected with 1 ml of immune antigen in the leg muscles, and another 5 were used as a control group, injected with an equal amount of normal saline. Blood was collected 21 days after immunization, and serum was separated. After inactivation at 56°C for 30 min, the neutralizing antibody titer in serum was determined. The antibody neutralization titer of the immunized group was 1:1800, and the neutralization antibody titer of the control group was negative.

[0052] S4, Yolk antibody preparation: 4.1 Immunization of laying hens: first immunization, 140-day-old commercial laying hens were injected with immune antigen prepared by muscle, 0.5 ml per chicken; second immunization, 15 days after the first immunization, the prepared immune antigen was injected by muscle, 1 ml per chicken; third immunization, 15 days after the second immunization, the prepared immune antigen was injected by muscle, 1.5 ml per chicken; fourth immunization, 30 days after the third immunization, the prepared immune antigen was injected by muscle, 2 ml per chicken. Start collecting eggs for detection 14 days after the fourth immunization. When the egg neutralizing antibody titer is not less than 1:1600, collect high immune eggs and store at 4°C for standby.

[0053] 4.2 Disinfection of hyperimmune eggs: immerse the hyperimmune eggs in a 0.1% solution of benzalkonium chloride at 42°C for 15 minutes, then drain the water, rinse with running water to remove surface dirt, and fumigate the eggs with a 0.1% solution of glutaraldehyde for 30 minutes;

[0054] 4.4 Acidification and extraction: add the precipitant to the settling tank at a ratio of 1:1 (V / V) of egg yolk liquid to precipitant, adjust the pH of the precipitant solution to 6 with a 30% citric acid solution, and precipitate at 4°C for 12 hours. After the precipitate is completely removed and the supernatant has a titer of no less than 1:256, transfer the supernatant for caprylic acid lipid removal. The precipitant is prepared by dissolving PVP and trehalose to concentrations of 6.66 g / L and 4.16 g / L, respectively, in an equal amount of purified water.

[0055] 4.5 Caprylic acid lipid removal: add caprylic acid to the supernatant to a final concentration of 0.1%, mix thoroughly, and let stand at room temperature for 2-6 hours. Then, remove the impurities with filter cloth to obtain the crude yolk antibody solution of goose astrovirus RD240629A.

[0056] 4.6 Sterilization filtration: filter and sterilize using a 0.22 μm microporous filter.

[0057] 4.7 Virus removal by ultrafiltration: filter and remove viruses using an ultrafiltration membrane with a molecular weight cutoff of 1000 kDa.

[0058] 4.7 Ultrafiltration concentration: concentrate the crude antibody solution 2-fold using an ultrafiltration membrane with a molecular weight cutoff of 100 kDa.

[0059] 4.8 Antibody titer determination: the neutralizing antibody titer of the concentrated crude antibody solution of goose astrovirus RD240629A is no less than 1:256.

[0060] 4.9 Subpackaging: subpackage quantitatively, seal, and store at 2-8°C.

[0061] Performance test 1. Goose astrovirus RD240629A infection and yolk antibody protection test Select 7-day-old specific pathogen-free geese 950, randomly divided into 4 groups, weighing, treatment regimen as shown in Table 4, respectively, isolated feeding, clinical observation after infection day by day, statistics of morbidity and mortality, the results as shown in Table 5. Infection on the 7th day, all goslings were euthanized and necropsy, necropsy chart see figure (judgment method: poor appetite, slow movement, single leg lameness, standing difficulty, gradually wasting, excretion of uric acid salt wrapped white loose stool and other clinical symptoms).

[0062] Table 4 gosling on goose astrovirus RD240629A infection and protection test scheme Table 5 gosling morbidity and mortality statistics results Group Total number of tests per group Number of cases per group Morbidity Protection rate / % Negative control group 50 0 0 100 Attack non-treatment group 300 286 95.3 4.7 Attack treatment group 300 9 3 97 Attack prevention group 300 5 1.7 98.3 From the data in Table 5, the goose astrovirus yolk antibody of the application has excellent preventive protection efficacy, in the face of goose astrovirus RD240629A strain attack, the protection rate of gosling is 97-98.3%.

[0063] The necropsy chart of the gosling can be seen that the heart, liver and spleen and other internal organs and joint cavity surface uric acid salt deposition, kidney enlargement, color light, ureter full of crystalline uric acid salt.

[0064] 2, goose astrovirus yolk antibody treatment application Select a large goose test area in Shandong Province, select one of the sick goose house as the test object. The goose house is divided into two isolated areas, respectively feeding 2000 geese of 2 weeks of age, the sick geese in the two isolated areas are treated respectively, the first area goose house: injection of market purchased goose astrovirus antibody, 1 mL per goose; The second area goose house: injection of goose astrovirus yolk antibody prepared in Example 2, 1 mL per goose, continuous observation for 7 days, record the gosling morbidity (judgment method of gosling astrovirus disease: poor appetite, slow movement, single leg lameness, standing difficulty, gradually wasting, excretion of uric acid salt wrapped white loose stool and other clinical symptoms, necropsy of sick geese can be seen that the heart, liver and spleen and other internal organs and joint cavity surface uric acid salt deposition; kidney enlargement, color light, ureter full of crystalline uric acid salt).

[0065] The results show that: the first area of the gosling in the goose house injected with yolk antibody, the feed intake and mental state did not improve significantly, from the 5th day of injection of yolk antibody, there were sick goslings died, the protection rate of sick goslings within 7 days was 82.5%; The feed intake of sick goslings in the second area of the goose house began to increase after 2 days of treatment with goose astrovirus antibody, the mental state improved, and the protection rate was 92.6% after 7 days; In the face of astrovirus attack, the yolk antibody prepared in the application has better protection effect than the market yolk antibody, and has better prevention and control effect.

[0066] The embodiments are only illustrative of the present application, and are not intended to limit the present application. Those skilled in the art can make modifications to the embodiments according to the present application without creative contribution, as long as the modifications are within the scope of the claims of the present application.

Claims

1. A goose star virus, characterized in that, The goose astrovirus is named RD240629A and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No: 46197 on September 23, 2024.

2. A goose stellate virus egg yolk antibody, characterized in that, The inactivated vaccine prepared using the goose astrovirus RD240629A strain as described in claim 1 was used as the antigen.

3. A method for preparing goose stellate virus egg yolk antibody, characterized in that, Includes the following steps: S1. Antigen preparation: Antigen was prepared using goose astrovirus RD240629A; S2. Preparation of inactivated antigen: The antigen is inactivated with formaldehyde solution to obtain inactivated antigen; S3. Preparation of immunoantigen: The inactivated antigen and sterile Tween 80 are mixed evenly to obtain an aqueous phase; white oil and Span 80 are mixed evenly to obtain an oil phase; the oil phase and the aqueous phase are mixed and emulsified to obtain the immunoantigen. S4. Preparation of egg yolk antibodies: The laying hens are immunized with the immunogen, and hyperimmune eggs are collected. The hyperimmune eggs are disinfected, the egg yolks are collected, acidified and extracted, degreased with caprylic acid, filtered, concentrated, and goose astrovirus egg yolk antibodies with a neutralizing titer of not less than 1:256 are obtained.

4. The method for preparing goose stellate virus egg yolk antibody according to claim 1, characterized in that: In step S1, the antigen is prepared as follows: Goose astrovirus RD240629A is inoculated into 12-day-old goose embryos via the chorioallantoic membrane. Allantoic fluid and dead embryos that died at 36-120 hours and showed typical lesions are collected. The dead embryos are ground to obtain a slurry, centrifuged, and repeatedly frozen and thawed to obtain an embryo grinding solution. The goose embryo allantoic fluid and the embryo grinding solution are mixed, centrifuged, and the antigen is obtained after passing the sterility test. It is then frozen and stored.

5. The method for preparing goose astrovirus egg yolk antibody according to claim 1, characterized in that: The method for inactivating the antigen with formaldehyde solution in step S2 is as follows: add formaldehyde solution to the antigen, mix thoroughly until the final concentration of formaldehyde solution is 0.1%, seal and inactivate at 37°C for 24 hours to obtain inactivated antigen.

6. The method for preparing goose astrovirus egg yolk antibody according to claim 1, characterized in that: The immunization method in step S4 is as follows: the immune antigen is injected into laying hens, and after four immunizations, the eggs are collected for testing. Eggs with a neutralization titer of not less than 1:1600 are considered qualified high-immune eggs.

7. The method for preparing goose stellate virus egg yolk antibody according to claim 1, characterized in that: The method for collecting egg yolk in step S4 is as follows: separate the egg white and egg yolk from the high-immunity egg, mix the egg yolk and disodium hydrogen phosphate solution at a volume ratio of 1:1, filter, and then add disodium hydrogen phosphate solution at a volume ratio of 2 times that of the egg yolk, and stir at a uniform speed.

8. The method for preparing goose stellate virus egg yolk antibody according to claim 7, characterized in that: The acidification extraction method in step S4 is as follows: the mixture of egg yolk and disodium hydrogen phosphate obtained by collecting egg yolk is mixed with a settling agent, the volume ratio of the egg yolk and disodium hydrogen phosphate mixture to the settling agent is 1:1, the mixture is allowed to settle, the pH is adjusted to 6, and the mixture is allowed to settle at 4°C until the titer of the supernatant is not less than 1:

256.

9. The method for preparing goose stellate virus egg yolk antibody according to claim 1, characterized in that: The method for degreasing with octanoic acid in step S4 is as follows: add octanoic acid to the acidified extract until the octanoic acid concentration is 0.1%, mix and let stand at room temperature for 2-6 hours.

10. The use of the goose astrovirus yolk antibody according to claim 2 in the treatment or prevention of goose astrovirus disease.