An artificial non-coding RNA molecule, DNA molecule, and biomaterial and their application in enhancing the carbon and nitrogen metabolism of rhizobia.

Abstract

The application provides an artificial non-coding RNA molecule, a DNA molecule and a biological material and application thereof in improving rhizobium carbon and nitrogen metabolic capacity, and belongs to the technical field of genetic engineering, wherein the nucleotide sequence of the artificial non-coding RNA molecule is shown as SEQ ID NO. 1, and the nucleotide sequence of the DNA molecule for transcribing the artificial non-coding RNA molecule is shown as SEQ ID NO. 2; the application also provides a recombinant vector and a recombinant rhizobium with high carbon and nitrogen metabolic capacity; the artificial non-coding RNA molecule and the recombinant expression vector constructed by using the RNA molecule provided by the application can significantly improve the utilization capacity of rhizobium malate, and further enhance the symbiotic nitrogen fixation capacity of rhizobium, and can significantly improve the yield and quality of legume crops in symbiosis with the legume crops.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an artificial non-coding RNA molecule, DNA molecule and biomaterial and their application in improving the carbon and nitrogen metabolism capacity of rhizobia. Background Technology

[0002] In the global agricultural production system, nitrogen, as an indispensable core nutrient element for plant growth and development, directly determines the yield and quality of crops. The symbiotic nitrogen-fixing system composed of legumes and rhizobia is currently the most efficient nitrogen-fixing biological system known in nature, accounting for a significant proportion of the total global biological nitrogen fixation and demonstrating irreplaceable application value in agricultural production. In this symbiotic system, rhizobia can invade the root system of legumes and form special symbiotic organs—root nodules. Through their nitrogenase system, they convert inert nitrogen from the air into ammoniacal nitrogen that plants can directly absorb and utilize, providing a stable nitrogen source for the host plant. At the same time, rhizobia rely on specific organic substances (such as sucrose and organic acids) released by the root system of the host legume through active secretion as a carbon source to meet the carbon skeleton and energy supply required for their own growth, reproduction, energy metabolism, and efficient operation of the nitrogenase system. The two form a close, mutually beneficial symbiotic relationship.

[0003] However, in actual agricultural ecosystems, the rhizosphere is a complex micro-ecosystem composed of various microorganisms such as bacteria, fungi, and actinomycetes, exhibiting extremely high microbial diversity and intense interspecific competition. This complex rhizosphere microenvironment significantly interferes with the production and release of root exudates in leguminous plants. On the one hand, other rhizosphere microorganisms compete with rhizobia for organic carbon sources produced by plant photosynthesis, leading to a reduction in the total amount of carbon source substances secreted by the roots to rhizobia, resulting in insufficient carbon source supply. On the other hand, some rhizosphere microorganisms alter the chemical composition and proportion of root exudates through metabolic activities, disrupting the rhizobia's recognition and utilization preferences for specific carbon sources, resulting in a significant decrease in the utilization rate of existing carbon sources by rhizobia. These problems directly restrict the colonization capacity, reproductive efficiency, and nitrogen fixation activity of rhizobia in the rhizosphere, thereby affecting the nitrogen fixation efficiency of the entire symbiotic nitrogen fixation system and becoming a core bottleneck limiting the large-scale and efficient application of this system in agricultural production. Therefore, how to improve the ability of rhizobia to recognize, absorb, and utilize carbon sources in the host root system through scientific means, and overcome the carbon source limitations brought about by the rhizosphere microenvironment, has become a key breakthrough for further enhancing the symbiotic nitrogen fixation ability of leguminous plants and rhizobia and promoting the industrial application of biological nitrogen fixation technology. It is also an important research direction in the fields of agricultural microbiology and plant nutrition.

[0004] With the deepening of research in molecular biology and microbial genetics, the role of non-coding RNA (ncRNA), a class of RNA molecules that do not encode proteins but have important regulatory functions, in the regulation of prokaryotic environmental adaptation is gradually being revealed. Studies have shown that ncRNA can directly interact with the mRNA molecules of target genes through base complementarity, regulating the expression of target genes at the post-transcriptional level. This can be achieved by either inhibiting translation through binding to the ribosome binding site of mRNA or promoting translation efficiency by stabilizing the secondary structure of mRNA, thereby precisely regulating key physiological processes in microorganisms such as carbon metabolism, nitrogen metabolism, quorum sensing, and environmental stress response. In the legume-rhizobium symbiotic system, ncRNA also plays a crucial role. It not only regulates the expression of carbon metabolism-related genes in rhizobia (such as carbon source transporter genes and sugar metabolism enzyme genes) but also participates in signal exchange between rhizobia and the host plant, influencing nodule formation and development.

[0005] Based on the aforementioned research, synthetic biology, as an emerging discipline integrating molecular biology, engineering, and informatics, offers a novel approach to solving the problem of carbon metabolism regulation in rhizobia through its core modular design concept. This concept advocates breaking down the complex physiological functions of organisms into "modules" with specific functions. By artificially designing, modifying, and assembling these functional modules, precise regulation and targeted modification of the organism's physiological processes can be achieved. Therefore, utilizing the modular design concept of synthetic biology, artificial non-coding RNA functional modules capable of specifically regulating the expression of carbon metabolism-related genes can be designed and constructed targeting key nodes in the carbon metabolism regulatory network of rhizobia. This not only overcomes the limitations of low efficiency and poor specificity of natural ncRNA regulation but also enables precise regulation of carbon source absorption, transport, and metabolism in rhizobia. This significantly enhances the ability of rhizobia to utilize host root carbon sources in complex rhizosphere environments, providing core technical support for the creation of highly efficient symbiotic nitrogen-fixing bacterial chassis strains. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide an artificial non-coding RNA molecule, a DNA molecule, and a biomaterial, and their application in improving the carbon and nitrogen metabolism capacity of rhizobia. The artificial non-coding RNA molecule provided by this invention can significantly improve the utilization of malic acid by rhizobia, thereby enhancing the symbiotic nitrogen fixation capacity of rhizobia.

[0007] This invention provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The present invention provides a DNA molecule, which is transcribed to obtain the artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0009] The present invention provides a gene expression cassette AbcR1, comprising a promoter that responds to a symbiotic nitrogen fixation signal and the DNA molecule thereon; the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO.3.

[0010] The present invention provides a recombinant vector, comprising an initial vector and the gene expression cassette AbcR1.

[0011] Preferably, the gene expression cassette AbcR1 is inserted into the multiple cloning site of the initial vector.

[0012] This invention provides the application of the artificial non-coding RNA molecule, the DNA molecule, the gene expression cassette AbcR1, and the recombinant vector in improving the carbon and nitrogen metabolism utilization of rhizobia.

[0013] This invention provides a recombinant rhizobium with highly efficient carbon and nitrogen metabolism capabilities, wherein the recombinant vector is introduced into a host rhizobium.

[0014] Preferably, the host rhizobium is *Rhizobium fischeri*.

[0015] This invention provides the application of the recombinant rhizobium in improving the yield and quality of leguminous crops.

[0016] This invention provides the application of the recombinant rhizobium in soil improvement.

[0017] Compared with the prior art, the present invention has the following beneficial effects: The present invention provides an artificial non-coding RNA molecule, which is based on *Rhizobium fischeri* (…). Sinorhizobium fredii The gene encoding phosphoenolpyruvate carboxykinase, a key enzyme regulating carbon metabolism in phosphoenolpyruvate, is... pckA By synthesizing conserved regions of mRNA sequences obtained through alignment, an artificial non-coding RNA molecule with a degenerate complementary pairing region is synthesized using artificial chemical synthesis methods. The artificial non-coding RNA molecule provided by this invention, and the recombinant expression vector constructed using this RNA molecule, can significantly improve the utilization of malic acid in rhizobia, thereby enhancing the symbiotic nitrogen fixation capacity of rhizobia. The artificial non-coding RNA molecule and / or DNA molecule provided by this invention can be applied to the construction of artificially efficient carbon-nitrogen coupling pathways in rhizobia.

[0018] Furthermore, the symbiotic signal-induced gene expression cassette AbcR1 significantly enhances the carbon source utilization capacity of rhizobia, especially malic acid, the main carbon source during rhizobia symbiosis. The recombinant rhizobia provided by this invention significantly improves the growth-promoting effect, nodule number, and nitrogenase activity when symbiotic with legumes, by 1.12 times, 1.32 times, and 1.23 times respectively compared to the basal species. This demonstrates that the recombinant rhizobia provided by this invention can significantly improve the yield and quality of legumes. Attached Figure Description

[0019] Picture 1 A schematic diagram illustrating the construction of the recombinant expression vector provided by this invention;

[0020] Picture 2 PCR validation results for the recombinant expression vector provided by this invention;

[0021] Picture 3 The utilization capacity of carbon sources such as malic acid by the chassis bacteria of the present invention and the recombinant rhizobium S. fredii (pAbcR1) provided by the present invention was determined.

[0022] Picture 4 The binding ability of the artificial non-coding RNA provided in this invention to the pckA mRNA encoding the phosphoenolpyruvate carboxykinase gene was determined, wherein (a) AbcR1 and pckA (b) shows AbcR1 binding to mRNA molecules; pckA (c) shows the binding of pckA-m1 mRNA molecules with a 6-base mutation; pckA The pckA-m2 mRNA molecule, which has a 9-base mutation in its mRNA, binds to it. Detailed Implementation

[0023] This invention provides an artificial non-coding RNA molecule, the nucleotide sequence of which is shown in SEQ ID NO.1, and is as follows:

[0024] agcygayacyygyyyggyggcyycyccycccagygccaccgcaggagaygyyccccycyggaggyycyaayaayyyygaccacyaccaggggcccacayyyccygcggyccgcyyyyyyy.

[0025] The above-mentioned artificial non-coding RNA molecule is based on the present invention of *Rhizobium fischeri* (F. ferruginea). Sinorhizobium fredii By comparing the conserved region of the sequence obtained from the alignment of the pckA mRNA encoding gene, a key enzyme in carbon metabolism regulation (PCR), an artificial non-coding RNA molecule with a degenerate complementary pairing region was synthesized using artificial chemical synthesis methods.

[0026] This invention provides a DNA molecule, which is transcribed to obtain the artificial non-coding RNA molecule. The nucleotide sequence of the DNA molecule is shown in SEQ ID NO.2, and is as follows:

[0027] agctgatacttgtttggtggcttctcctcccagtgccaccgcaggagatgttcccctctggaggttctaataattttgaccactaccaggggcccacatttcctgcggtccgcttttttt.

[0028] This invention provides a gene expression cassette AbcR1, comprising a promoter that responds to symbiotic nitrogen fixation signals and the DNA molecule thereon; the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO.3, and is as follows:

[0029] .

[0030] The expression of the artificial non-coding RNA molecule provided by this invention is controlled by a symbiotic nitrogen fixation signal-inducible promoter element. This invention synthesizes the DNA molecule sequence and promoter sequence of the aforementioned artificial non-coding RNA using an artificial synthesis method, obtaining the gene expression cassette AbcR1 of this non-coding RNA molecule. The gene expression cassette AbcR1 induces repressed secondary structure unwinding through base complementarity with the pckA mRNA encoding the phosphoenolpyruvate carboxykinase gene from *Plasmodium styracifolium*, leading to highly efficient expression of phosphoenolpyruvate carboxykinase. The DNA molecule described in this invention participates in the post-transcriptional regulation of the phosphoenolpyruvate carboxykinase gene in microorganisms under the control of a symbiotic nitrogen fixation signal-inducible promoter.

[0031] The present invention provides a recombinant vector, comprising an initial vector and the gene expression cassette AbcR1.

[0032] In this invention, the gene expression cassette AbcR1 is preferably inserted into the multiple cloning site of the initial vector, and more preferably into... Bam HI restriction site and Hind Between the III restriction enzyme sites. This invention does not specifically limit the preparation method or specific operating parameters of the recombinant vector; conventional enzyme digestion and ligation operations in the art are sufficient. In this invention, the initial vector is preferably pBBR1MCS-2.

[0033] The present invention also provides the application of the artificial non-coding RNA molecule, the DNA molecule, the gene expression cassette AbcR1, and the recombinant vector in improving the carbon and nitrogen metabolism utilization of rhizobia.

[0034] This invention provides a recombinant rhizobium with highly efficient carbon and nitrogen metabolism capabilities, wherein the recombinant vector is introduced into a host rhizobium.

[0035] In this invention, the host rhizobium is preferably *Rhizobium fischeri*, more preferably *Rhizobium fischeri* CCBAU45436. The method for transferring the recombinant vector into the recombinant vector is preferably a triphilic conjugation method.

[0036] This invention provides the application of the recombinant rhizobium in improving the yield and quality of leguminous crops.

[0037] This invention provides the application of the recombinant rhizobium in soil improvement.

[0038] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0039] Example 1

[0040] This embodiment illustrates the construction of the artificial non-coding RNA recombinant expression vector provided by the present invention.

[0041] This invention is based on *Rhizobium fischeri* (F. ferruginea). Sinorhizobium fredii The gene encoding phosphoenolpyruvate carboxykinase, a key enzyme regulating carbon metabolism in phosphoenolpyruvate, is... pckA Using the conserved regions of the mRNA sequence obtained from alignment, an artificial non-coding RNA molecule with a degenerate complementary pairing region was synthesized through artificial chemical synthesis. abcR1 Its nucleic acid sequence is shown in SEQ ID NO: 1.

[0042] The DNA molecule of the artificial non-coding RNA molecule was obtained by transcription, and its nucleotide sequence is shown in SEQ ID NO.2.

[0043] The expression of the artificial non-coding RNA molecule is controlled by a symbiotic nitrogen fixation signal-induced promoter element. The DNA molecule sequence and promoter sequence of the above-mentioned artificial non-coding RNA were synthesized by artificial synthesis method, and the gene expression cassette AbcR1 of the non-coding RNA molecule was obtained. The nucleotide sequence is shown in SEQ ID NO.3.

[0044] Then, the artificial non-coding RNA gene expression cassette AbcR1 and expression vector pBBR1MCS-2 were respectively... Bam HI and Hind III. After double enzyme digestion, the gene expression cassette AbcR1 was inserted into the multiple cloning site of pBBR1MCS-2 using seamless cloning technology. Finally, PCR sequencing confirmed the insertion, yielding the recombinant E. coli strain DH5a3 (pAbcR1) expressing the AbcR1 functional module. The construction of the recombinant expression vector pAbcR1 is as follows: Picture 1 As shown in the figure, the direction of gene transcription is indicated by arrows, and the insertion sites are Bam HI and Hind Ш. The PCR verification results of the recombinant expression vector are as follows. Picture 2 As shown, the recombinant expression vector of the present invention can amplify the above-mentioned DNA fragment with a band size of 526 bp.

[0045] The functional module AbcR1 expression vector was transformed into *Rhizobium fischeri* ( Sinorhizobium frediiThe cells were transformed via triparental conjugation in CCBAU45436. First, overnight cultured chassis strain CCBAU 45436, *E. coli* DH5a3 expressing the helper plasmid pRK2013 (pRK2013), and recombinant *E. coli* DH5a3 expressing artificial non-coding RNA (pAbcR1) were centrifuged at 6000 rpm for 5 min, and the supernatant was discarded to collect the bacterial cells. The cells were then washed twice with physiological saline, and resuspended in 1 mL of physiological saline in an Eppendorf tube. After centrifugation at 6000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended again with 60 μL of physiological saline and spotted onto antibiotic-free TY solid medium. After incubation at 30 ℃ for 2 days, bacterial colonies were picked and resuspended in 1 mL of physiological saline, serially diluted, and plated onto corresponding antibiotic-protected plates for 2 days. Finally, colony PCR and sequencing confirmed the presence of recombinant rhizobia. S. fredii (pAbcR1).

[0046] Example 2

[0047] This embodiment is used to determine the carbon source utilization capacity of the recombinant rhizobium provided by the present invention:

[0048] The carbon source utilization capacity of recombinant rhizobia was detected using a Biolog GN3 96-well identification plate. The specific steps are as follows:

[0049] Rhizobium fischeri CCBAU45436 (hereinafter referred to as chassis bacterium) S. fredii ) and recombinant rhizobia S. fredii (pAbcR1) was activated for two generations on YMA plates to maintain the viability of the strain; fresh bacterial cells were scraped off with a 1 mL pipette, resuspended and mixed in the inoculum, and then the turbidity in the colorimetric tube was adjusted to 95% ± 2% using a turbidimeter; the bacterial suspension was then poured into the storage tank, and 100 μL of the bacterial suspension was added to a Biolog GN3 96-well identification plate using an 8-channel pipette, with three replicates per group; finally, the microplate was placed directly into the Omnilog reader box for incubation, the Omnilog system program was set, and the plate was incubated at 30 ℃ for 48 h, and the substrate metabolism was analyzed by scanning the identification plate.

[0050] The results are as follows Picture 3 As shown, with the chassis bacteria S. fredii In comparison, recombinant rhizobia S. fredii (pAbcR1) significantly improved the utilization of 10 carbon sources, including malic acid, the main carbon source in rhizobium symbiosis, which was 1.22 times that of diatoms.

[0051] This embodiment demonstrates that the artificial non-coding RNA functional module AbcR1, expressed in response to symbiotic signals, can significantly improve the carbon source utilization capacity of chassis bacteria, especially malic acid, the main carbon source during rhizobium symbiosis.

[0052] Example 3

[0053] This example is used to determine the symbiotic nitrogen fixation ability of the provided recombinant rhizobium with Jidou 17:

[0054] The effects of recombinant rhizobia on the growth-promoting, nodulation, and nitrogen-fixing abilities of Jidou 17 were analyzed using a vermiculite pot experiment. The specific steps are as follows:

[0055] Select uniformly sized, intact, and smooth seeds of the Jidou 17 variety and place them in an Erlenmeyer flask. Sterilize the seeds in a clean bench: wash with anhydrous ethanol for 1 min; pour out the anhydrous ethanol and rinse once with sterile water; wash with a 1:5 diluted sodium hypochlorite solution for 2 min; pour out the solution and rinse once with sterile water; rinse the seeds 5 times with sterile water containing a fungicide (PPM); rinse twice with sterile water; then use sterile tweezers to spread the seeds evenly on a large petri dish containing 0.6% water agar; finally, place the petri dish in a black plastic bag and germinate at 28 ℃ in the dark for 2-3 days.

[0056] During seed germination, sterilize consumables such as water containers, upper cups for vermiculite, and absorbent ropes; mix vermiculite evenly with low-nitrogen plant nutrient solution (1 kg of vermiculite is mixed with 1.5 L of low-nitrogen plant nutrient solution, which can be divided into 25 pots), and then sterilize at 121 ℃ for 90 min.

[0057] After the soybeans germinate, select seeds that are evenly germinated and growing well on a large petri dish for transplanting. Place the seeds root-down into the upper cup containing vermiculite, and fill the lower water container with water. Place the container in an artificial climate chamber for cultivation (60% humidity, 16 hours of light, 8 hours of darkness; temperature: 26℃ during the day, 22℃ at night).

[0058] During seedling growth, the substrate bacteria S. fredii and recombinant rhizobia S. fredii (pAbcR1) was inoculated into YMA liquid medium and cultured at 30 ℃ for two days. When the seedlings developed their first true leaves, the cultured bacterial suspension was centrifuged, the supernatant was discarded, and the bacterial cells were resuspended in 0.85% physiological saline and washed twice. The suspension was centrifuged at 6000 rpm for 10 min, the supernatant was discarded, and finally the suspension was resuspended in PBS. The OD of the bacterial suspension was then calculated. 600 Adjust the pH to 0.2, inoculate 1 ml of bacterial solution into the soybean roots, culture for 3 weeks, replenish water regularly every week, and set up 8 replicates per group.

[0059] Finally, symbiotic indicators of soybeans, such as aboveground plant height, number of root nodules, fresh weight of root nodules, and nitrogenase activity, were detected.

[0060] The results are shown in Table 1. Compared with the substrate bacteria, the recombinant rhizobium significantly improved the growth-promoting effect, nodule number, and nitrogenase activity when coexisting with Jidou 17, which were 1.12 times, 1.32 times, and 1.23 times that of the substrate bacteria, respectively.

[0061] Table 1. Symbiotic nitrogen fixation phenotype analysis of soybean inoculated with basal flora and recombinant rhizobia.

[0062]

[0063] This embodiment demonstrates that the artificial non-coding RNA functional module AbcR1, expressed in response to symbiotic signals, can significantly enhance the symbiotic nitrogen fixation capacity of Chameleonella.

[0064] Example 4

[0065] This embodiment uses a micro-thermal surge experiment to identify the artificial non-coding RNA gene expression cassette and the phosphoenolpyruvate carboxylkinase-encoding gene provided by this invention. pckA The binding ability of mRNA is determined through the following steps:

[0066] The 30 bp 5' FAM fluorescently labeled material required for this experiment was synthesized by Shanghai Sangon Biotech Co., Ltd. pckA mRNA sequences were used as probes; and 120 bp full-length artificial non-coding RNA sequences were obtained through in vitro transcription as ligands.

[0067] The concentration of AbcR1 used was 6 μM, and the concentration of the labeled probe mRNA was 200 nM. Then, the AbcR1 was serially diluted by half concentration, and 10 μL was taken and mixed with the same volume of target. The mixed sample was added to 16 standard capillary tubes and left to stand for 5 min.

[0068] The artificial noncoding RNA gene expression cassette AbcR1 and... (The sentence is incomplete and requires more context to be translated accurately.) pckA The binding ability between mRNAs was analyzed and the dissociation constant Kd was calculated.

[0069] Kd = [A] × [L] / [AL],

[0070] Where [A] is the concentration of free fluorescent molecules, [L] is the concentration of free ligands, and [AL] is the concentration of the A and L complex.

[0071] The results are as follows Picture 4 As shown, the artificial non-coding RNA gene expression cassette AbcR1 and pckA The micro-thermophoretic fitting curves between mRNAs were all typical "S"-shaped curves, and the K-axis binding coefficients of the two were...d The value is 53.52 ± 81.65 nM. pckA After a 6-base mutation in the mRNA, AbcR1 binds to PckAm-m1 mRNA with a Kd value of 233.75 ± 116.84 nM, and the binding ability is [missing information]. pckA The percentage of unmutated mRNA was 22.90%. After further mutation of 3 bases, AbcR1 and... pckA mRNA no longer binds. This indicates that the artificial non-coding RNA functional module AbcR1 and... pckA There is a strong tendency for mRNAs to bind to each other.

[0072] This embodiment demonstrates that the artificial non-coding RNA functional module AbcR1 can interact with the gene encoding phosphoenolpyruvate carboxykinase through base pairing. pckA mRNA interactions, thereby regulating the carbon source utilization ability of host chassis bacteria at the post-transcriptional level.

[0073] As can be seen from the above embodiments, the artificial non-coding RNA molecule provided by the present invention can significantly improve the utilization capacity of rhizobia by malic acid, enhance the symbiotic nitrogen fixation capacity of rhizobia, and improve the yield and quality of legume crops. It has important theoretical significance for promoting the innovative development of biological nitrogen fixation technology, and has important practical value for reducing agricultural production's dependence on chemical nitrogen fertilizers and realizing green and sustainable agricultural development.

[0074] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An artificial non-coding RNA molecule, characterized in that, The artificial non-coding RNA molecule is transcribed from a DNA molecule shown in SEQ ID NO.

2.

2. A DNA molecule, characterized in that, The DNA molecule is transcribed to obtain the artificial non-coding RNA molecule of claim 1, and the nucleotide sequence of the DNA molecule is shown in SEQ ID NO.

2.

3. A gene expression cassette AbcRl, characterized in that, The gene expression cassette comprises a promoter responsive to symbiotic nitrogen fixation signal and the DNA molecule of claim 2; and the nucleotide sequence of the gene expression cassette is shown in SEQ ID NO.

3.

4. A recombinant vector, characterized in that, The gene expression cassette AbcR1 comprises an initial vector and the gene expression cassette AbcR1 of claim 3.

5. The recombinant vector of claim 4, wherein, The gene expression cassette AbcR1 is inserted into the multiple cloning site of the initial vector.

6. The artificial non-coding RNA molecule of claim 1, the DNA molecule of claim 2, the gene expression cassette AbcR1 of claim 3, or the recombinant vector of claim 4 or 5 is used for improving carbon metabolic utilization of Bradyrhizobium sp. (Sinorhizobium fredii).

7. A recombinant rhizobium with highly efficient carbon metabolism capacity, characterized in that, The recombinant vector of claim 4 or 5 is transformed into a host rhizobium, which is Bradyrhizobium sp. (Sinorhizobium fredii).

8. Use of the recombinant Rhizobium of claim 7 for increasing yield and quality of legume crops, characterized in that, After the recombinant rhizobium is inoculated into soybean, the aboveground plant height, nodule number, nodule fresh weight and nitrogenase activity of the soybean are improved.

Images