Application of ZmEREB93 gene knockout biological material in cultivation of high-yield and high-quality corn

Abstract

The invention discloses application of a ZmEREB93 gene knockout biological material in cultivation of high-yield and high-quality corn, and relates to the technical field of biology. The ZmEREB93 gene knockout strain is constructed, homozygous seeds of the ZmEREB93 gene knockout strain are subjected to seed test analysis, and it is found that corn kernels of the knockout strain are remarkably superior to a wild type in the aspects of the grain length, the grain width, the hundred-grain weight and the single plant yield. In the early, middle and late periods of grain filling, the corn grains of the knockout strain are obviously superior to a wild type control in shape and endosperm structure. Further determination of starch content and protein content shows that the starch content of seeds of the knockout strain is significantly higher than that of a wild type control group, the alcohol-soluble protein content is also significantly increased, and the total protein content is significantly higher than that of a control group. Therefore, the ZmEREB93 gene has an important application value in cultivation of a high-yield and high-quality new corn variety.

Description

TECHNICAL FIELD

[0001] The application relates to the field of biotechnology, and particularly relates to application of biological material for knocking out ZmEREB93 gene in cultivating high-yield and high-quality corn. BACKGROUND

[0002] Grain size and weight are important factors for determining the yield of corn. Corn grain traits belong to complex quantitative traits. The grain development process is not only closely related to yield-related characteristics such as endosperm cell proliferation and plasmodesmata rate, but also directly determines the nutritional quality attributes, such as storage protein components and starch structure.

[0003] In the field of corn grain trait research, although hundreds of quantitative trait loci (QTL) related to grain traits have been identified, few of the major QTLs can be finely mapped to specific genes. Even among the genes that have been successfully cloned and related to grain, the genes that can simultaneously improve yield and nutritional quality are extremely rare. Therefore, it is of great significance to explore genes with multiple effects and to elucidate the molecular basis of their coordinated regulation of grain yield formation and nutritional substance accumulation, which can provide a breakthrough strategy for the molecular design and breeding of corn with high yield and high quality.

[0004] Grain size and weight are also two main determinants of grain yield. In early grain breeding research, breeders identified some grain-related mutants, which can be mainly divided into three categories: the first category is grain-defective mutants (dek), including emp mutants, which affect the development of endosperm and embryo; the second category is embryo-specific mutants (emb), which are characterized by only affecting the development of embryo, while the formation process of endosperm remains normal; and the third category is endosperm-specific mutants, which only affect the development of endosperm.

[0005] Researchers have successfully cloned some genes related to grain development by using these identified mutants, such as EMP10, EMP11, EMP12, DEK10, DEK35, DEK37 and qKW9, which are members of the Pentatricopeptide repeat (PPR) gene family.

[0006] However, in the current research results and applications related to corn kernels, there is a common problem that yield and quality are difficult to balance. Specifically, in the traditional corn breeding and improvement process, high yield is often accompanied by low quality, and the problem of balancing the development of corn kernel yield and quality has not been fundamentally solved, which to some extent limits the development of corn breeding technology to a higher level, and also makes it difficult to meet the actual application scenarios of agricultural production of corn "high yield-high quality". SUMMARY

[0007] The purpose of the present application is to provide an application of a biological material for knocking out a ZmEREB93 gene in cultivating high-yield and high-quality corn, so as to solve the problems existing in the prior art. The present application finds that after knocking out the ZmEREB93 gene, the corn kernels become larger, the yield is improved, and the starch content and protein content are also improved, therefore, the ZmEREB93 gene has important application value in cultivating new varieties of high-yield and high-quality corn.

[0008] To achieve the above purpose, the present application provides the following solutions:

[0009] The present application provides an application of a biological material for knocking out a ZmEREB93 gene in cultivating high-yield and high-quality corn, wherein the nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO. 1.

[0010] The present application also provides an application of a biological material for knocking out a ZmEREB93 gene in improving the yield traits and / or quality traits of corn, wherein the nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO. 1.

[0011] Further, the yield traits include kernel length, kernel width, hundred-kernel weight and yield per plant;

[0012] The quality traits include starch, prolamin and total protein content.

[0013] Further, the biological material is any one of (1)-(2):

[0014] (1) a CRISPR / Cas9 gene knockout vector;

[0015] (2) a non-plant host cell comprising the CRISPR / Cas9 gene knockout vector.

[0016] Further, the nucleotide sequence of sgRNA of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO. 3 or SEQ ID NO. 4.

[0017] The application also provides a biological material for improving yield traits and / or quality traits of corn, the biological material being any one of (1)-(2):

[0018] (1) a CRISPR / Cas9 gene knockout vector;

[0019] (2) a non-plant host cell comprising the CRISPR / Cas9 gene knockout vector.

[0020] Further, the nucleotide sequence of sgRNA of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO. 3 and SEQ ID NO. 4.

[0021] The application also provides a method for improving yield traits and / or quality traits of corn, comprising the steps of knocking out a ZmEREB93 gene of corn and constructing a transgenic corn plant with the ZmEREB93 gene knocked out.

[0022] The nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO. 1.

[0023] Further, the yield traits include kernel length, kernel width, 100-kernel weight and yield per plant.

[0024] The quality traits include starch content, prolamin content and total protein content.

[0025] Further, the ZmEREB93 gene is knocked out by using a CRISPR / Cas9 gene knockout method.

[0026] The application discloses the following technical effects:

[0027] The application finds a grain development-related gene, which is a corn AP2 family transcription factor isolated and cloned from corn inbred line B73, contains a conserved AP2 domain, and is named as ZmEREB93. The application constructs a ZmEREB93 gene knockout strain, and performs seed analysis on homozygous seeds, finds that the corn kernels of the knockout strain are significantly better than those of the wild type in kernel length, kernel width, 100-kernel weight and yield per plant. In the early, middle and late stages of grain filling, the corn kernels of the knockout strain are obviously better than those of the wild type in shape and endosperm structure. Further determination of starch content and protein content finds that the starch content of the kernels of the knockout strain is significantly higher than that of the wild type, the prolamin content is also significantly improved, and the total protein content is significantly higher than that of the control group.

[0028] In summary, the application finds that after knocking out the ZmEREB93 gene, the corn kernels become larger, the yield is improved, and the starch content and protein content are also increased. Therefore, the ZmEREB93 gene has important application value in cultivating new corn varieties with high yield and high quality. BRIEF DESCRIPTION OF DRAWINGS

[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of these drawings.

[0030] Figure 1 Figure is a grain phenotype observation chart of wild type and ZmEREB93 knockout lines;

[0031] Figure 2 Figure is a grain length (A), grain width (B), hundred-grain weight (C) and single plant yield (D) statistical chart of wild type and ZmEREB93 knockout lines;

[0032] Figure 3 Figure is a paraffin section chart of wild type and ZmEREB93 knockout lines in the grain development process;

[0033] Figure 4 Figure is a starch content statistical chart of wild type and ZmEREB93 knockout lines;

[0034] Figure 5 Figure is a statistical chart of alcohol-soluble protein (A), non-alcohol-soluble protein (B) and total protein (C) content of wild type and ZmEREB93 knockout lines. DETAILED DESCRIPTION

[0035] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the present application.

[0036] It should be understood that the terms described in the present application are only for describing the specific embodiments, and are not used to limit the present application. In addition, for the numerical range in the present application, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between any stated value or intermediate value in the range, and any other stated value or intermediate value in the range is also included in the present application. The upper limit and the lower limit of these smaller ranges can be independently included or excluded from the range.

[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All patents, patent applications, publications, and descriptions mentioned herein are incorporated by reference for the disclosure and the description of the procedures and / or materials in connection with which the disclosure was made. In the case of conflict, the present description will control.

[0038] Many modifications and variations of this application of the application described herein will be apparent to those of ordinary skill in the art without departing from the scope or spirit of the application. Other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only. It is to be understood that the application is not limited in scope by the specific embodiments described herein. Rather, the intent is to embrace all changes and modifications that fall within the spirit and scope of the claims.

[0039] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0040] The present application discovers a gene related to kernel development, which is a transcription factor of AP2 family in corn isolated and cloned from corn inbred line B73, containing a conserved AP2 domain, named ZmEREB93. The CDS sequence of ZmEREB93 gene is shown as SEQ ID NO. 1, and the amino acid sequence of the encoded ZmEREB93 protein is shown as SEQ ID NO. 2.

[0041] SEQ ID NO. 1:

[0042] ATGCAGCAGATGGAGTGGGACATGAGAGGAGGAGGGCACGGTAGCGCTGTCGGGGACGGTGGGCCTGGTGGACGCGGCCTTACTGTCGGAGGCGGCGTCGCTCTCGCTGTCGGGGGAGGGGACCAGCAGCGCGTGGAGGCGCACTACCGCGGCGTCCGGAAGCGGCCGTGGGGTCGGTACGCGGCCGAGATCCGCGACCCCTGGAGGAAGACGCGCGTGTGGCTGGGCACCTACGACACGCCCGTCGAGGCCGCCATGGCCTACGACCGCGCCGCCGTCGCGCTGCGCGGCTCCAAGGCCAGGACCAACTTCACCGCGGGCCGCGGCGGCGCCCGGGCCACGCCCGTCCAGGCCCGCCCGCTCCCGCACCCCGCGCTGGCGCCCGGCCACTTCAGCGGGCTCGACGCCACACACTCGTCGCCCTGGCACGTCGTCTATCTCCCACCGCCCAGGTTGCACCAGCAGGCCCTGGCGCCGCCGATGCCCCTCGTGGCAGTGGCAGGCGACGTCGCCACGTCGCTGCCGTCCACGGCGCTGGAGCTCCGGACGGGGCCCAAGGCCCTCCCGTTCGACCTCAACGAACCGCCGTCGTTGCTGTTCGGCTCGCTGTCTCCGTGA.

[0043] SEQ ID NO. 2:

[0044] MQQMEWDMRGGGHGSAVGDGGPGGRGLTVGGGVALAVGGGDQQRVEAHYRGVRKRPWGRYAAEIRDPWRKTRVWLGTYDTPVEAAMAYDRAAVALRGSKARTNFTAGRGGARATPVQARPLPHPALAPGHFSGLDATHSSPWHVVYLPPPRLHQQALAPPMPLVAVAGDVATSLPSTALELRTGPKALPFDLNEPPSLLFGSLSP.

[0045] Example 1

[0046] I. Experimental Methods

[0047] 1. Construction of CRISPR / Cas9 knockout vector for ZmEREB93 gene

[0048] The target of ZmEREB93 gene was designed by using Huannong CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and the target with high target score, low off-target rate and suitable position was selected. The sgRNA sequences were: sgRNA1: GGTGGACGCGGCCTTACTGTCGG (SEQ ID NO. 3) and sgRNA2: ACCAACTTCACCGCGGGCCGCGG (SEQ ID NO. 4). The specific vector construction and genetic transformation were completed by Unicombing Biotechnology Co., Ltd., and the transformation background was KN5585. The double-target method was used for gene knockout by using the above designed sgRNA1 and sgRNA2.

[0049] 2. Positive identification of edited lines

[0050] The amplification primer sequences were designed and synthesized by using Primer5 software (as shown in Table 1).

[0051] Table 1 Identification primer sequences

[0052]

[0053] The following PCR reaction system (Table 2) and program were used for amplification:

[0054] Table 2 PCR reaction system

[0055]

[0056] The PCR amplification program was: 94℃, 3min; 94℃ 30s, 62℃ 30s, 72℃ 40s, 36 cycles; 72℃ 5min; 10℃ holding. The separation was performed by 1.5% agarose gel electrophoresis, and the purified and recovered products were sent to a biological company for Sanger sequencing, and the sequence alignment was performed by using Geneious software.

[0057] 3. Field yield trait investigation of ZmEREB93 gene knockout material

[0058] The field test was carried out in Xishuangbanna Nanfanzu base and Chongzhou base for two consecutive years. The ZmEREB93 gene knockout homozygous lines and wild type controls were planted by using random block design. After mature harvest, 100 kernels in the middle of the ear were taken, and the length, width, hundred kernel weight and single ear kernel weight (30 ears for each line) of each kernel were scanned by using automatic grain testing instrument (Wseen, SC-G) to obtain yield related indexes.

[0059] 4. Paraffin section observation of the morphological structure of maize endosperm cells

[0060] The kernels of each ZmEREB93 gene knockout line were collected at 6, 12, 18, and 24 days after pollination, vacuum infiltrated with FAA fixing solution (ethanol: glacial acetic acid: formaldehyde: water = 50:5:10:35) at 4°C overnight, dehydrated with gradient ethanol, and cleared with xylene, and then embedded in paraffin to prepare 8-12 pm serial sections. After hydration, the sections were subjected to PAS staining (periodic acid-Schiff reaction) to show the endosperm cell structure, and photographed using a stereomicroscope.

[0061] 5. Determination of nutritional quality-related indicators in kernels of ZmEREB93 gene knockout materials

[0062] 5.1 Starch content determination: Four mature ears were selected for each line, and four seeds were independently taken from each ear. A starch content kit (Solabio, BC0705) was used to measure the total starch content in the kernels according to the steps provided in the kit. The specific steps are as follows:

[0063] (1) The mature kernels of wild type (KN5585) and ZmEREB93 gene knockout materials were thoroughly ground in a mortar, and three replicates were set for each material. 0.03 g of powder and 0.6 mL of starch extraction reagent 1 were added to a 2 mL centrifuge tube, which was placed in a 80°C water bath for 30 min, centrifuged at 3000 g for 5 min, and the supernatant was discarded.

[0064] (2) 300 pL of distilled water was added to the precipitate, which was placed in a boiling water bath for 15 min. After cooling, 0.6 mL of starch extraction reagent 2 was added, and the mixture was again placed in a boiling water bath for 15 min, with shaking for 3 times during the process. After cooling, the mixture was centrifuged at 8000 g for 15 min, and the supernatant was diluted 200 times for measurement.

[0065] (3) Standard preparation: 10 mg / mL glucose standard solution was diluted to 1, 0.2, 0.1, 0.05, 0.04, 0.03, 0.02, and 0.01 mg / mL solutions.

[0066] (4) Standard determination: 0.2 mL of standard solution (distilled water as blank control) and 1 mL of starch extraction reagent 3 were added to a 2 mL centrifuge tube, which was placed in a 95°C water bath for 10 min. After cooling, the absorbance value was measured at 620 nm using a spectrophotometer (distilled water calibration), and the A 标准 , A 空白 values were read out. The A 标准 -A 空白 values were calculated.

[0067] (5) Sample determination: take 0.2 mL of the diluted sample (distilled water as blank control) and 1 mL of starch extraction reagent into a 2 mL centrifuge tube, 95°C water bath for 10 min, cool down and use a spectrophotometer to determine the absorbance at 620 nm (distilled water calibration), read A 测定 , A 空白 , calculate ΔA = A 测定 -A 空白 .

[0068] (6) According to the standard tube concentration (x, mg / mL) and absorbance ΔA (y, ΔA), establish a standard curve, and bring the sample determination ΔA into the standard curve to obtain x.

[0069] (7) Starch content (mg / g) = 0.811x / sample mass (0.03 g) x dilution multiple (200).

[0070] 5.2 Protein content determination in kernels

[0071] 5.2.1 Alcohol-soluble protein extraction

[0072] The alcohol-soluble protein extraction buffer is shown in Table 3.

[0073] Table 3 Alcohol-soluble protein extraction buffer

[0074]

[0075] The extraction steps are as follows:

[0076] (1) Take the kernels of wild type KN5585 and ZmEREB93 gene knockout mutant strain, respectively, and divide them into three groups. Remove the seed coat and embryo from the kernels, leaving only the endosperm;

[0077] (2) Grind the endosperm into powder;

[0078] (3) Weigh 100 mg of powder into a 2 mL centrifuge tube, add 1 mL of alcohol-soluble protein extraction buffer, and shake well after adding the buffer;

[0079] (4) Place the mixture for 2 h or overnight at room temperature (25°C) or overnight at 28°C (preferably overnight for dry seeds; place the sample in a grinder at 60 Hz for 60 s, and let it stand for 20 min after completion;

[0080] (5) Centrifuge at 13,000 rpm for 15 min; take 100 μL of supernatant into a new centrifuge tube, and add 10 μL of 10% SDS solution;

[0081] (6) Vacuum for about 70 min until the liquid evaporates; dissolve the alcohol-soluble protein: add 100 μL of ddH2O to the dry seeds, and store at -20°C for later use.

[0082] 5.2.2 Non-alcohol soluble protein extraction step

[0083] The non-alcohol soluble protein extraction Buffer is shown in Table 4.

[0084] Table 4 Non-alcohol soluble protein extraction Buffer

[0085]

[0086] The extraction steps are as follows:

[0087] (1) The same as the alcohol soluble protein extraction step (1)-(4) of 5.2.1;

[0088] (2) Centrifuge at 13000 rpm for 15 min to remove all supernatant;

[0089] (3) Repeat the above step 3 times and remove the supernatant;

[0090] (4) Vacuum to no liquid residue;

[0091] (5) Add 1 mL of non-alcohol extraction buffer, shake and stand for 2 h;

[0092] (6) Centrifuge at 13000 rpm for 15 min;

[0093] (7) Take the supernatant into a new centrifuge tube and store at -20°C for standby.

[0094] 5.2.3 Total protein extraction

[0095] The total protein extraction Buffer is shown in Table 5.

[0096] Table 5 Total protein extraction Buffer

[0097]

[0098]

[0099] The extraction steps are as follows:

[0100] Remove the seed coat and embryo, leaving only the endosperm; grind the endosperm into powder; weigh 100 mg of powder into a 2 mL centrifuge tube, add 1 mL of total protein extraction solution, stir at room temperature for 60 min, centrifuge at 12,000 rpm for 15 min, collect the supernatant, repeat twice, and combine the supernatant to obtain the total protein extraction solution.

[0101] 5.2.4 Protein content determination

[0102] The alcohol soluble protein, non-alcohol soluble protein and total protein extracted from the seeds are determined by BCA protein concentration determination kit (P0012).

[0103] II. Experimental results

[0104] 1. Two homozygous knockout lines KO93-1 and KO93-2 were identified by Sanger sequencing, wherein KO93-1 deletes 117 bp and KO93-2 deletes 237 bp. Figure 1 Phenotypic identification was performed on the two knockout lines, and the results showed that the kernel length, kernel width, 100-kernel weight and yield per plant of the knockout lines were significantly higher than those of the wild type, Figure 2 respectively increased by 6.92%, 4.36%, 11.15% and 12.51%. The above results show that the loss of function of ZmEREB93 gene can promote the corn kernel to become larger, thereby increasing the yield.

[0105] 2. The corn kernels at 6 days, 12 days, 18 days and 24 days after pollination were taken respectively, paraffin section technology was used for histological analysis, and the sections were dyed by using toluidine blue staining method. The results show that in the early stage (6 days after pollination), the middle stage (12 days after pollination) and the late stage (18 days and 24 days after pollination) of corn kernel filling, the corn kernels of the knockout lines are obviously larger than those of the wild type control group in shape and endosperm structure. Figure 3

[0106] 3. The starch content of the kernel of the ZmEREB93 knockout line was accurately determined and compared with that of the wild type corn kernel. The results show that the starch content of the ZmEREB93 knockout line is significantly higher than that of the wild type, Figure 4 and the difference is statistically significant (P<0.05). Specifically, the accumulation amount of starch in the kernel of the knockout line is obviously improved compared with that of the wild type, which means that after the ZmEREB93 gene is knocked out, important changes may occur in the metabolic pathway of starch synthesis or accumulation in the corn kernel, thereby leading to a significant increase in the starch content.

[0107] 4. The content of zein in the kernel of the ZmEREB93 knockout line is significantly increased compared with that of the wild type. However, the content of non-zein protein does not show significant difference between the knockout line and the wild type. Nevertheless, due to the significant increase in the content of zein, the total protein content of the ZmEREB93 knockout line is significantly higher than that of the wild type, which shows that the knockout of the ZmEREB93 gene mainly affects the synthesis or accumulation of zein, and has less effect on non-zein protein. Figure 5

[0108] ​​The above described embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement made by those skilled in the art to the technical solutions of the present application without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. The application of a biomaterial with the ZmEREB93 gene knocked out in the breeding of high-yield and high-quality maize, characterized in that, The nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO.

1.

2. The application of a biomaterial with the ZmEREB93 gene knocked out in improving yield and / or quality traits in maize, characterized in that, The nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO.

1.

3. The application according to claim 2, characterized in that, The yield traits include grain length, grain width, 100-grain weight, and yield per plant; the quality traits include starch, prolysin, and total protein content.

4. The application according to claim 3, characterized in that, The biomaterial is any one of (1)-(2): (1) CRISPR / Cas9 gene knockout vector; (2) Non-plant host cells containing the CRISPR / Cas9 gene knockout vector.

5. The application according to claim 4, characterized in that, The nucleotide sequence of the sgRNA of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO.3 or SEQ ID NO.

4.

6. A biomaterial for improving yield and / or quality traits in maize, characterized in that, The biomaterial is any one of (1)-(2): (1) CRISPR / Cas9 gene knockout vector; (2) Non-plant host cells containing the CRISPR / Cas9 gene knockout vector.

7. The biomaterial according to claim 6, characterized in that, The nucleotide sequence of the sgRNA of the CRISPR / Cas9 gene knockout vector is shown in SEQ ID NO.3 and SEQ ID NO.

4.

8. A method for improving yield and / or quality traits of maize, characterized in that, This includes the steps of knocking out the ZmEREB93 gene in maize to construct transgenic maize plants with the ZmEREB93 gene knocked out. The nucleotide sequence of the ZmEREB93 gene is shown in SEQ ID NO.

1.

9. The method according to claim 8, characterized in that, The yield traits include grain length, grain width, 100-grain weight, and yield per plant; The quality traits include starch, prolyl protein, and total protein content.

10. The method according to claim 8, characterized in that, The ZmEREB93 gene was knocked out using the CRISPR / Cas9 gene knockout method.

Images