Application of nucleus gene ITS sequence in identifying and / or distinguishing pokeberry root and counterfeit product thereof

By designing a multiplex PCR method based on the nuclear gene ITS sequence and using specific primer pairs for PCR amplification, the problems of time-consuming, labor-intensive, and costly identification of pokeweed in existing technologies have been solved, enabling rapid, simple, and accurate identification of pokeweed and its adulterants.

CN120888686APending Publication Date: 2025-11-04JIANGYIN TIANJIANG PHARMA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511043251.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-11-04

AI Technical Summary

Technical Problem

Existing methods for identifying pokeweed mainly rely on morphological identification, microscopic identification, and barcode identification. These methods are time-consuming, labor-intensive, costly, and highly specialized, making it impossible to efficiently and accurately identify pokeweed and its counterfeits.

Method used

A multiplex PCR method based on the nuclear gene ITS sequence was designed. PCR amplification was performed using specific primer pairs. By observing the bands of the PCR products, the adulterants, including Phytolacca acinosa root, Zingiber officinale, and Dioscorea hypoglauca, were distinguished.

Benefits of technology

It enables rapid, simple, and accurate identification of pokeweed and its counterfeits, reduces costs, simplifies the identification process, and is applicable to the identification of medicinal powders.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120888686A_ABST
    Figure CN120888686A_ABST
Patent Text Reader

Abstract

The invention discloses application of a nuclear gene ITS sequence in identification and / or distinguishing of pokeberry root and counterfeit products thereof. The 1881st site of the nuclear gene ITS sequence with the GenBank login number of OL824854.1 is T or A, and the 1996 site nucleotide is T or C; or the nucleotide at the 1938th site is G or A, and the nucleotide at the 2031st site is T or A; the radix phytolaccae is Phytolacca aericana L. L., and the fake product is Phytolacca latinia (Moq.) Maxim., the radix phytolaccae is Phytolacca aericana L. L., and the fake product is Phytolacca latinia (Moq.) Maxim. According to the invention, a section of ITS bar code sequence capable of simultaneously identifying Phytolacca latbenia (Moq.) Maxim. In a sample to be detected is found for the first time, and the detection method designed based on the section of sequence is simple and reliable, is not influenced by the characters of medicinal materials, and can be used for accurately identifying medicinal material powder; the method has the advantages of high objectivity, no dependence on subjective judgment and the like.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to application of a cell nucleus gene ITS sequence to identification and / or differentiation of Phytolacca acinosa and its counterfeits, and belongs to the field of traditional Chinese medicines. BACKGROUND

[0002] Phytolacca acinosa Roxb. or Phytolacca americana L. is dug in autumn to next spring, and is dried or sun-dried after removing rootlets and mud and sand and being cut into pieces. The dried or sun-dried Phytolacca acinosa Roxb. or Phytolacca americana L. has the effects of relieving water retention, swelling, foot swelling and laryngeal obstruction, and is used for treating carbuncle, swelling and sore. Modern pharmacological research shows that Phytolacca acinosa Roxb. or Phytolacca americana L. has the effects of diuresis, kidney protection, antibacterial, antiviral, antitumor and anti-inflammatory. Investigation on Phytolacca acinosa Roxb. or Phytolacca americana L. in the market shows that the mainstream variety of Phytolacca acinosa Roxb. or Phytolacca americana L. in the market is Phytolacca americana L., and Phytolacca acinosa Roxb. is very rare in the market. In addition to Phytolacca americana L., Hedychium spicatum and Mirabilis jalapa are also used as Phytolacca acinosa Roxb. or Phytolacca americana L. in the market. In addition, Phytolacca latbenia (Moq.) Maxim. is also used as Phytolacca acinosa Roxb. or Phytolacca americana L. in Yunnan.

[0003] At present, the identification methods of Phytolacca acinosa Roxb. and its common counterfeits in the market mainly include character identification, microscopic identification and bar code identification. Zhang Xiguo et al. distinguish eight kinds of Phytolacca acinosa Roxb. counterfeits through morphological research, and Lv Ruihua et al. identify several common Phytolacca acinosa Roxb. counterfeits based on ITS2 and psbA-trnH bar code sequences. Character identification can only identify the whole body, and cannot identify the powder; microscopic identification has low resolution, and is time-consuming and labor-consuming; bar code identification needs to sequence the PCR product, has high cost, and needs relevant molecular biology knowledge, and is highly professional. The multiple PCR identification method of the present application only judges by the presence or absence of bands, is highly objective, and no similar research is found through literature retrieval. SUMMARY

[0004] The first object of the present application is to provide a gene site of an ITS sequence and application thereof in identification and / or differentiation of Phytolacca acinosa Roxb. and its counterfeits. The second object of the present application is to provide specific primers designed based on the gene site of the ITS bar code sequence and application thereof.

[0005] Technical solution: The application provides an application of a cell nucleus gene ITS sequence in identifying and / or distinguishing between Phytolacca acinosa and its counterfeit products, wherein the cell nucleus gene ITS sequence has a GenBank login number of OL824854.1, and the 1881th nucleotide is T or A, and the 1996th nucleotide is T or C; or the 1938th nucleotide is G or A, and the 2031th nucleotide is T or A; the Phytolacca acinosa is Phytolacca americana L., and the counterfeit product is Phytolacca latbenia (Moq.) Maxim.

[0006] Further, when the 1881th and 1996th nucleotides of the cell nucleus gene ITS sequence are both T, the to-be-detected medicinal material is Phytolacca americana L.; when the 1881th nucleotide is A and the 1996th nucleotide is C, the to-be-detected medicinal material is Phytolacca latbenia (Moq.) Maxim.; when the 1938th nucleotide of the cell nucleus gene ITS sequence is G and the 2031th nucleotide is T, the to-be-detected medicinal material is Phytolacca americana L.; and when the 1938th and 2031th nucleotides are both A, the to-be-detected medicinal material is Phytolacca latbenia (Moq.) Maxim.

[0007] Further, the specific primer pairs designed based on the cell nucleus gene ITS sequence are any one or two pairs of nucleotide sequences shown in SEQ ID NO. 1-2 or shown in SEQ ID NO. 3-4.

[0008] The application further provides a kit for identifying and / or distinguishing between Phytolacca acinosa and its counterfeit products, wherein the kit comprises the specific primer pairs of the nucleotide sequences shown in SEQ ID NO. 1-2 and / or shown in SEQ ID NO. 3-4.

[0009] The application further provides a multiplex PCR method for identifying or distinguishing Phytolacca acinosa Roxb. or Phytolacca latbenia (Moq.) Maxim., comprising the following steps: extracting genomic DNA of a sample to be detected as a template, performing PCR amplification by using specific primer pairs of nucleotide sequences shown in SEQ ID NO. 1-2 and / or shown in SEQ ID NO. 3-4, and when a 153 bp band appears after electrophoresis of a PCR product, the sample to be detected is Phytolacca acinosa Roxb.; if a 130 bp band appears, the sample to be detected is Phytolacca latbenia (Moq.) Maxim., and when no band appears after electrophoresis of the PCR product, the sample to be detected is a fake product other than Phytolacca acinosa Roxb. and Phytolacca latbenia (Moq.) Maxim..

[0010] Further, the fake product comprises Mirabilis jalapa L., Morinda officinalis How, and Pueraria mirifica.

[0011] Further, the PCR detection system comprises DNA polymerase, 10x Taq Buffer, dNTP, specific primers, DNA template, and sterile water.

[0012] Further, the DNA polymerase is rTaq DNA polymerase, Taq HS DNA polymerase or 2x M5 HiPerplus Taq HiFi PCR mix (with blue dye).

[0013] Further, the PCR reaction program is 95 DEG C pre-denaturation for 3 min, 94 DEG C denaturation for 30 s, 58 DEG C or 60 DEG C annealing for 30 s, 72 DEG C extension for 30 s, a total of 35 cycles, and 72 DEG C final extension for 5 min.

[0014] Further, the template concentration is 30-100 ng.

[0015] Further, the nucleotide sequence of the amplification fragment of Phytolacca acinosa Roxb. is shown in SEQ ID NO. 5, and the nucleotide sequence of the amplification fragment of Phytolacca latbenia (Moq.) Maxim. is shown in SEQ ID NO. 6.

[0016] Beneficial effects: compared with the prior art, the application has the following outstanding advantages: the application first finds that an ITS sequence can simultaneously identify Phytolacca acinosa Roxb. and Phytolacca latbenia (Moq.) Maxim. in a sample to be detected, a detection method designed based on the sequence is simple and reliable, is not affected by the properties of medicinal materials, and can accurately identify medicinal material powder. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 is a single annealing temperature investigation chart;

[0018] Figure 2 is a multiple different polymerase investigation chart;

[0019] Figure 3 is a different cycle number investigation chart;

[0020] Figure 4 is a template amount investigation chart;

[0021] Figure 5 is a different manufacturer PCR instrument investigation chart;

[0022] Figure 6 is a medicinal material adaptability investigation chart;

[0023] Figure 7 is a comparison chart of the ITS sequence of the nuclear genome of Phytolacca latbenia (Moq.) Maxim. downloaded from the NCBI gene library. DETAILED DESCRIPTION

[0024] The technical solutions of the present application will be further described below in combination with the drawings.

[0025] Example 1

[0026] 1. Instruments and samples

[0027] 1.1 Instruments

[0028] Electric heating constant temperature water bath (Shanghai Boxin Medical Biological Instrument Co., Ltd.), centrifuge (Thermo Fisher Scientific), high-throughput tissue grinder (Suizhen Biological Technology Co., Ltd.), sterilization pot (Shanghai Shen'an Medical Instrument Factory), PCR instrument (Thermo Fisher Scientific), PCR instrument (Bio-rad, USA), WIX electrophoresis system (Vexin Technology Co., Ltd.), gel imaging system (Azure Biosystems, USA), NanoDrop TM One micro-volume UV-Vis spectrophotometer (Thermo Fisher Scientific). C micro-volume UV-Vis spectrophotometer (Thermo Fisher Scientific).

[0029] 1.2 Reagents

[0030] GenRed nucleic acid dye (RT211, Tiangen Biotech Co., Ltd.), HiPure Agarose (MF103-01, Meibao Biotech Co., Ltd.), 2000bp plus DNA Marker (MF025-1, Meibao Biotech Co., Ltd.), Ex Taq DNA polymerase (RR53A, Baori Biotech Co., Ltd.), 2xM5 HiPerplus Taq HiFi PCR mix (with blue dye) (MF002-Plus, Meibao Biotech Co., Ltd.), rTaq DNA polymerase (R001A, Baori Biotech Co., Ltd.), Taq HS DNA polymerase (R007A, Baori Biotech Co., Ltd.).

[0031] 1.3 Sample

[0032] The samples used in this study were purchased from the national market. Among them, (Pokeweed (Phytolacca americana) meets the requirements of Chinese Pharmacopoeia 2020 edition, and the medicinal material information is shown in Table 1.

[0033] Table 1 Sample information

[0034]

[0035]

[0036] 2、Experimental method

[0037] 2.1 Primer design

[0038] The ITS sequences of Phytolacca americana L. and Phytolacca latbenia (Moq.) Maxim. (see Table 1) were downloaded from the NCBI gene library and imported into BioEdit for alignment. Align the sequences and find the difference sites. Figure 7

[0039] According to the difference sites, the following two primer pairs were designed and synthesized, see Table 2.

[0040] Table 2 Primer sequence

[0041]

[0042] ​The sequence of the product amplified by the specific primer pair of Phytolacca acinosa is shown in SEQ ID NO: 5, with a length of 153 bp, which is: CAGAACGACCCGCGAACATGTTATCACACATCGGGAGGGGCGTCCGTTGCCCTCG GGCTTCGGCCACCTCTCCTCGTCGGTGGGTGCTCCTCGTGGGTGCCTTCCCGGCAA AACAACGAACCCCGGCGCGGAATGCGCCAAGGAACATGTACA;

[0043] The sequence of the product amplified by the specific primer pair of Phytolacca latbenia (Moq.) Maxim. is shown in SEQ ID NO: 6, with a length of 130 bp, which is: GCTTCGGTCACCTCTCCTCATCGGTGGGTGCTCCTCG TGGGTGCCTTCCCGGTAAAACAATGAACCCCGGCGCGGAACGCGCCAAGGAAAAT GTACAATAGAGTGCCCACCCAACCTCGGTTTTCCGGTG.

[0044] 2.2 Extraction of genomic DNA

[0045] The surface of the sample was wiped with 75% ethanol, and after irradiation under ultraviolet light for 30 minutes, the DNA was extracted using the CTAB method, with the following steps:

[0046] 1) Take about 100 mg of fresh plant tissue or about 30 mg of dry tissue, and add liquid oxygen for grinding.

[0047] 2) Add 900 μL of sterilized CTAB solution, 0.02 g of PVP40 powder, and 10 μL of mercaptoethanol to the ground powder, mix well by quickly inverting the centrifuge tube, and then place the centrifuge tube in a 65°C water bath for 120 min. During the water bath process, invert the centrifuge tube several times to mix the sample.

[0048] 3) Add 900 μL of chloroform-isopropanol 24:1, mix well, and centrifuge at 12,000 rpm (~ 13,400 x g) for 10 min.

[0049] 4) Carefully transfer 750 μL of the upper aqueous phase obtained in the previous step to a new centrifuge tube, add 750 μL of chloroform-isopropanol 24:1, mix well, and centrifuge at 12,000 rpm (~ 13,400 x g) for 10 min.

[0050] 5) Carefully pipette 500 μL of the supernatant from the previous step into a new centrifuge tube, add 330 μL of isopropanol, mix well, and store at -20 °C for 1 h. Remove the tube and centrifuge at 12,000 rpm (~ 13,400 x g) for 10 min.

[0051] 6) Discard the supernatant, add 500 μL of 70% ethanol, rinse for 1 min, centrifuge at 12,000 rpm (~ 13,400 x g) for 5 min, and discard the supernatant.

[0052] 7) Add 500 μL of 70% ethanol, rinse for 1 min, centrifuge at 12,000 rpm (~ 13,400 x g) for 5 min, and discard the supernatant.

[0053] 8) Add 500 μL of absolute ethanol, rinse for 1 min, centrifuge at 12,000 rpm (~ 13,400 x g) for 5 min, and discard the supernatant.

[0054] 9) Place the microcentrifuge tube with the DNA pellet in a 37 °C constant temperature shaker for 300 min to evaporate the ethanol, add 100 μL of TE to dissolve, and store at -20 °C.

[0055] 2.3 Screening and optimization of PCR conditions

[0056] The initial PCR reaction conditions were as follows: PCR reaction system (25 μL): 2 x M5 HiPerplus Taq HiFi PCR mix (with blue dye) 12.5 μL, primers each 0.25 μL (the final concentration of each primer was 0.1 μM), DNA template 1 μL (30 ng), and sterile water to make up to 25 μL. The reaction program was as follows: 95 °C pre-denaturation for 3 min, (94 °C denaturation for 30 s, 56 °C annealing for 30 s, 72 °C extension for 30 s) for a total of 35 cycles, and 72 °C final extension for 5 min. After the PCR reaction was completed, 2.5 μL of the PCR product was taken, mixed well, and subjected to 3.0% agarose gel electrophoresis detection. The gel imaging system was observed and imaged. The PCR instrument used was Thermo Fisher Scientific.

[0057] Condition optimization: The annealing temperature (56 °C, 58 °C, 60 °C, 62 °C), the number of cycles (29, 32, 35), the concentration of template DNA (3, 10, 30, 100 ng / μL), different Taq enzymes (2 x M5 HiPerplus Taq HiFi PCR mix (with blue dye), rTaq DNA Polymerase, Taq HS DNA Polymerase, ExTaq DNA Polymerase), and different manufacturers of PCR instruments (Thermo Fisher Scientific, Bio-rad, USA) were investigated to determine the optimal PCR reaction.

[0058] 3 Result analysis

[0059] After all the PCR reactions, the operation was as follows: 3 μL of PCR product was taken, 1 μL of 6x Loading buffer was added, and after mixing, 2.5% agarose gel electrophoresis detection was performed at 160V for 30 minutes. Imaging was observed on a gel imaging system.

[0060] 3.1 Multiplex PCR annealing temperature exploration

[0061] On the basis of the initial reaction conditions, the annealing temperature in the reaction program was investigated. The reaction program was 95°C pre-denaturation for 3 min, (94°C denaturation for 30 s, 56°C, 58°C, 60°C, 62°C annealing for 30 s, 72°C extension for 30 s) for a total of 35 cycles, and 72°C final extension for 5 min. The results are shown in Table 1, wherein the sample numbers are 1-3. Pokeweed (Phytolacca acinosa Roxb.) (SLU01, SLU02, SLU03), 4-5. Phytolacca latbenia (Moq.) Maxim. (YNS01, YNS02), N is sterile water, and M is a 2000 bp plus DNA Marker. When the primers SEQ ID NO. 1-2 were used for detection, the annealing temperature was 56°C, 58°C, 60°C, and 62°C, and the pokeweed (Phytolacca acinosa Roxb.) had a single band at about 170 bp (A), while when the primers SEQ ID NO. 3-4 were used for detection, the Phytolacca latbenia (Moq.) Maxim. had a faint band at an annealing temperature of 56°C and 62°C (B), so 58°C and 60°C were selected as the multiplex PCR annealing temperature. Figure 1 Figure 1 Figure 1

[0062] 3.2 Multiplex polymerase investigation

[0063] ​​​On the basis of the initial reaction conditions, 4 kinds of polymerases, 2xM5 HiPer plus Taq HiFi PCR mix(with blue dye), rTaq DNA Polymerase, Taq HS DNA Polymerase, ExTaq DNA Polymerase were investigated. When ExTaq DNA Polymerase was used, the PCR reaction system was: sterile water 19.3 μL, 10xExTaq Buffer 2.5 μL, dNTP 1.5 μL, primer 0.25 μL (the final concentration of each primer was 0.1 μM), ExTaq DNA Polymerase 0.2 μL, DNA template 1 μL (30 ng); when 2xM5 HiPer plus Taq HiFi PCR mix(with blue dye) was used, the PCR reaction system was: 2xM5 HiPer plus Taq HiFi PCR mix(with blue dye) 12.5 μL, primer 0.25 μL (the final concentration of each primer was 0.1 μM) DNA template 1 μL (30 ng), supplemented with sterile water to 25 μL; when rTaq DNA Polymerase and Taq HS DNA Polymerase were used, the PCR reaction system was: sterile water 19.3 μL, 10xTaq Taq Buffer 2.5 μL, dNTP 1.5 μL, primer 0.25 μL (the final concentration of each primer was 0.1 μM), rTaq DNA Polymerase 0.2 μL, DNA template 1 μL (30 ng) or sterile water 19.3 μL, 10xTaq Taq Buffer 2.5 μL, dNTP 1.5 μL, primer 0.25 μL (the final concentration of each primer was 0.1 μM), Taq HS DNA Polymerase 0.2 μL, DNA template 1 μL (30 ng).

[0064] The results are as follows Figure 2As shown in the figure, the sample numbers for detection are 1-3. Pokeweed (Pokeweed (P. americana) (SLU01, SLU02, SLU03), 4-5. Phytolacca latbenia (Moq.) Maxim. (YNS01, YNS02), N is sterile water (blank), and M is 2000 bp plus DNA Marker. The results show that when amplification is performed using four types of polymerase, except for ExTaq DNA Polymerase, which has no band, the other three types of polymerase amplification, Pokeweed (P. americana), and Phytolacca latbenia (Moq.) Maxim. all have a single band at the corresponding position. Therefore, rTaq DNA Polymerase, Taq HS DNA Polymerase, and 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) can all be used as the optimal polymerase for this method.

[0065] 3.3 Investigation of the number of cycles

[0066] On the basis of the initial reaction conditions, the number of cycles was investigated, which was 29, 32, and 35 times, respectively. The results are shown in the figure. Figure 3 As shown in the figure, the sample numbers for detection are 1-3. Pokeweed (Pokeweed (P. americana) (SLU01, SLU02, SLU03), 4-5. Phytolacca latbenia (Moq.) Maxim. (YNS01, YNS02), N is sterile water (blank), and M is 2000 bp plus DNA Marker. The results show that when amplification is performed using four types of polymerase, except for ExTaq DNA Polymerase, which has no band, the other three types of polymerase amplification, Pokeweed (P. americana), and Phytolacca latbenia (Moq.) Maxim. all have a single band at the corresponding position. Therefore, rTaq DNA Polymerase, Taq HS DNA Polymerase, and 2×M5 HiPer plus Taq HiFi PCR mix (with blue dye) can all be used as the optimal polymerase for this method.

[0067] 3.4 Investigation of the amount of DNA template

[0068] On the basis of the initial reaction conditions, the DNA template concentration was investigated, which was 3, 10, 30, and 100 ng / μL, respectively. The results are shown in the figure. Figure 4As shown, the test samples were numbered 1-3. Pokeweed (Pokeweed (Phytolacca latbenia) (SLU01, SLU02, SLU03) and 4-5. Phytolacca latbenia (Moq.) Maxim. (YNS01, YNS02), respectively. N represents sterile water and M represents a 2000bp plus DNA Marker. When the DNA template concentration was 3 and 10 ng / μL, the Pokeweed (Phytolacca latbenia) samples showed no bands or very light colors. At 30 and 100 ng, both Pokeweed (Phytolacca latbenia) and Phytolacca latbenia (Moq.) Maxim. showed specific bands at the corresponding positions. Therefore, it is recommended that the template amount be 30-100 ng during amplification.

[0069] 3.5 Examination of Instruments from Different Brands

[0070] Based on the initial reaction conditions, the adaptability of the instrument was investigated, and the results are as follows: Figure 5 As shown in the figure, the sample numbers for testing were 1-3. Pokeweed (Pokeweed (Phytolacca latbenia) (SLU01, SLU02, SLU03), 4-5. Phytolacca latbenia (Moq.) Maxim. (YNS01, YNS02), N was sterile water, and M was 2000bp plus DNA Marker. Both Thermo Fisher Scientific and Bio-Rad instruments amplified specific bands at the corresponding positions for Pokeweed (Phytolacca latbenia) and Phytolacca latbenia (Moq.) Maxim.

[0071] 3.6 Adaptability Assessment

[0072] The suitability of the method was verified by testing all batches in Table 1 under optimal PCR reaction conditions. Optimal PCR reaction conditions: 19.3 μL sterile water, 2.5 μL 10×Taq Taq Buffer, 1.5 μL dNTPs, 0.25 μL each primer (final concentration of each primer was 0.1 μM), 0.2 μL rTaq DNA Polymerase, and 1 μL (30 ng) DNA template. The reaction program was 95℃ pre-denaturation for 3 min, (94℃ denaturation for 30 s, 58℃ annealing for 30 s, 72℃ extension for 30 s) for 35 cycles, followed by a final extension at 72℃ for 5 min. N represents sterile water, and M represents a 2000 bp plus DNA marker. Results are as follows: Figure 6As shown, 1-9 are corresponding to Phytolacca acinosa (Roxb.) Wendl. in Table 1, 10-18 are corresponding to Phytolacca latbenia (Moq.) Maxim. in Table 1, 19-21 are corresponding to Jatropha podagrica Hook. in Table 1, 22-23 are corresponding to Phytolacca hexa-merrillii in Table 1, 24-25 are corresponding to Euryale ferox in Table 1, N is sterile water, and M is 2000bp plus DNA Marker. The results show that Phytolacca acinosa (Roxb.) Wendl. amplifies specific bands at 170bp, Phytolacca latbenia (Moq.) Maxim. amplifies specific bands at 150bp, and the rest of the counterfeits have no bands.

[0073] Finally, according to the above results, the optimal specific PCR reaction conditions are determined as follows: the PCR reaction system is: sterile water 19.3 μL, 10×Taq Buffer 2.5 μL, dNTP 1.5 μL, primer 0.25 μL (the final concentration of each primer is 0.1 μM), r Taq DNA Polymerase 0.2 μL, and DNA template 1 μL (30-100 ng). The reaction program is 95℃ pre-denaturation for 3 min, (94℃ denaturation for 30 s, 58℃ or 60℃ annealing for 30 s, 72℃ extension for 30 s) for a total of 35 cycles, and 72℃ final extension for 5 min.

Claims

1. The application of nuclear gene ITS sequence in the identification and / or differentiation of pokeweed and its adulterants, characterized in that, The nuclear gene ITS sequence with GenBank accession number OL824854.1 has a T or A at position 1881 and a T or C at position 1996; or a G or A at position 1938 and a T or A at position 2031; the pokeweed is Phytolacca americana L., and the adulterant is Phytolacca latbenia (Moq.) Maxim.

2. The application of the nuclear gene ITS sequence according to claim 1 in the identification and / or differentiation of pokeweed and its adulterants, characterized in that, When both nucleotides at positions 1881 and 1996 of the nuclear gene ITS sequence are T, the test material is Phytolacca americana L.; when nucleotide at position 1881 is A and nucleotide at position 1996 is C, the test material is Phytolacca latbenia (Moq.) Maxim.; when nucleotide at position 1938 of the nuclear gene ITS sequence is G and nucleotide at position 2031 is T, the test material is Phytolacca americana L.; when both nucleotides at positions 1938 and 2031 are A, the test material is Phytolacca latbenia (Moq.) Maxim.

3. The application of the nuclear gene ITS sequence according to claim 1 in the identification and / or differentiation of pokeweed and its adulterants, characterized in that, Nucleotide sequences designed based on the nuclear gene ITS sequence are shown in SEQ ID NO. 1-2 or any one or two pairs of specific primers shown in SEQ ID NO. 3-4.

4. A kit for identifying and / or distinguishing pokeweed and its adulterants, characterized in that, The kit includes specific primer pairs with nucleotide sequences as shown in SEQ ID NO. 1-2 and / or SEQ ID NO. 3-4.

5. A multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim., characterized in that, The procedure includes the following steps: extracting genomic DNA from the sample to be tested as a template, performing PCR amplification using specific primer pairs with nucleotide sequences as shown in SEQ ID NO. 1-2 and / or as shown in SEQ ID NO. 3-4; if a 153bp band appears after electrophoresis of the PCR product, the sample to be tested is Phytolacca latbenia (Moq.) Maxim.; if a 130bp band appears, the sample to be tested is Phytolacca latbenia (Moq.) Maxim.; if no band appears after electrophoresis of the PCR product, the sample to be tested is an adulterant other than Phytolacca latbenia or Phytolacca latbenia (Moq.) Maxim.

6. The multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim. according to claim 5, characterized in that, The counterfeit products include Mirabilis jalapa root, Ginger scabra (Phytolacca acinosa), and Dioscorea hypoglauca.

7. The multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim. according to claim 5, characterized in that, The PCR detection system includes DNA polymerase, 10×Taq Buffer, dNTPs, specific primers, DNA template, and sterile water.

8. The multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim. according to claim 7, characterized in that, The DNA polymerase is rTaq DNA polymerase, Taq HS DNA polymerase, or 2×M5HiPerplus Taq HiFi PCR mix (with blue dye).

9. The multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim. according to claim 5, characterized in that, The PCR reaction program is as follows: 95℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, 58℃ or 60℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles; 72℃ final extension for 5 min.

10. The multiplex PCR method for identifying or distinguishing *Phytolacca latbenia* (Moq.) Maxim. according to claim 5, characterized in that, The template concentration is 30-100 ng.