AFB1 instant detection magnetic probe based on pregnancy test paper, kit and detection method

Abstract

The invention belongs to the technical field of target instant detection, and discloses an AFB1 instant detection magnetic probe based on pregnancy test paper, a kit and a detection method. The magnetic probe for detecting the AFB1 is obtained by mixing and incubating Fe3O4 (at) Au nanoparticles and a 5 '-terminal sulfydryl modified aptamer complementary chain, and then incubating with Aptamer again. The method comprises the following steps: mixing a solution to be detected with a Fe3O4 (at) Au-cDNA / Aptamer magnetic probe, adding an EXOI solution for reaction, and performing magnetic separation to obtain a first reaction solution; mixing and incubating the first reaction solution and a ZrCl4 aqueous solution to obtain a second reaction solution; adding an HCG solution into the second reaction solution, mixing and incubating to obtain a third reaction solution; and detecting the third reaction liquid by using a commercial pregnancy test strip, observing color signals of a detection line and a quality control line, and judging the content of AFB1. The detection method has remarkable target universality, has the advantages of being rapid in response, convenient and fast to operate, controllable in cost and the like, and is suitable for on-site instant detection of the AFB1.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of target point-of-care testing (POCT), and particularly relates to a detection method of AFB1. BACKGROUND

[0002] Aflatoxin B1 (AFB1) is a toxic secondary metabolite produced by fungi, which is easy to contaminate peanut, corn, soybean and other grain and oil products. It is the most toxic and most harmful mycotoxin to human health among mycotoxins, and has been proved to have carcinogenic, teratogenic and mutagenic effects. More than 60 countries and organizations in the world have set standards for the content of AFB1 in food. For example, the Food and Drug Administration of China and the United States stipulates that the maximum content of AFB1 in food is 20 ng / g, and the European Commission allows the content of AFB1 to be in the range of 2-5 ng / g. Therefore, rapid and sensitive detection of aflatoxins is of great significance to environmental and food safety.

[0003] The main detection methods of AFB1 involve high-performance liquid chromatography and chromatography-mass spectrometry, enzyme-linked immunosorbent assay (ELISA) and other methods. These methods can usually provide accurate analysis results, but they require expensive and complex instruments, skilled operators, tedious pretreatment processes, etc., which consume a lot of time, labor and cost, thus limiting their practical application. Therefore, it is urgent to develop simple, economical and sensitive portable sensors for rapid detection of AFB1 content in food and environment.

[0004] With the increasing demand for on-site detection, lateral flow immunoassay (LFA) shows great potential for development due to its low cost, rapid response and easy operation. The entire detection process of this method usually takes 10-30 minutes, and it does not require complex instruments and professional operators, so it is widely used in food safety detection, environmental monitoring and disease diagnosis. However, the number of commercially available point-of-care testing (POCT) products is limited at this stage, and the development of new test strips faces challenges such as antibody labeling, complex preparation process, high cost, etc. Only a small part of them can be industrialized and enter the market, which greatly hinders the development process of pollutant detection test strips. For example, CN 117074658A discloses a rapid aflatoxin M1 detection kit and a detection method thereof. Although the detection sensitivity is improved to a certain extent, the signal of the kit is a fluorescence signal, which requires an additional device: a fluorescence detector, and the method requires a dark environment to read the signal, so it is not suitable for on-site rapid detection. In addition, self-made test strips may have material / technological differences during batch production, resulting in fluctuations in detection results (such as uneven color development, inconsistent sensitivity), and poor reproducibility of detection.

[0005] The pregnancy test strip as a commercialized product has the advantages of low cost, simple and easy detection method, and easy signal interpretation for end users. Based on the existing mature production process of the pregnancy test strip, by constructing a bridge between the target and human chorionic gonadotropin (HCG), the detection of different non-HCG target objects can be realized, which effectively simplifies the process from design to practical application. The target object conversion strategy based on the pregnancy test strip is recognized as a simple and reliable instant detection method. However, these methods involve the covalent connection process of HCG and ssDNA (such as CN 115078717A) or the HCG encapsulation process. The covalent connection process of HCG and ssDNA has problems such as complicated covalent connection steps, high cost, low efficiency, and possible loss of activity caused by the connection of hCG-DNA. Although the HCG encapsulation avoids covalent connection, it still has the problem of low efficiency, and the slow release of HCG leads to a long detection time, which is contrary to the concept of instant detection. Therefore, further improvement is needed to make the detection method more efficient. SUMMARY

[0006] To solve the above technical problems, the present application provides an AFB1 instant detection magnetic probe based on a pregnancy test strip, a kit and a detection method.

[0007] To achieve the above purpose, the technical scheme of the present application is as follows:

[0008] A preparation method of an AFB1 instant detection magnetic probe based on a pregnancy test strip, comprising the following steps:

[0009] (1) Synthesizing sodium citrate modified Fe3O4 nanoparticles by a hydrothermal method;

[0010] (2) Growing Au nanoparticles on the surface of the Fe3O4 nanoparticles prepared in step (1) to prepare Fe3O4@Au nanoparticles;

[0011] (3) Fixing the 5' end thiol-modified aptamer complementary strand (cDNA) on the Fe3O4@Au through Au-S bond, adding aptamer (Aptamer) for incubation, and obtaining the Fe3O4@Au-cDNA / Aptamer magnetic probe, i.e. the AFB1 instant detection magnetic probe based on the pregnancy test strip;

[0012] Wherein, the aptamer is a nucleic acid sequence that can specifically bind to AFB1; the nucleotide sequence of the 5' end thiol-modified aptamer complementary strand (cDNA) is SH-GAGACAACATGCGC (as shown in SEQ ID NO. 1); and the nucleotide sequence of the Aptamer is GCACGTGTTGTCTCTCTGTGTCTCGTGC (as shown in SEQ ID NO. 2).

[0013] Further, specifically, a preparation method of an AFB1 instant detection magnetic probe based on a pregnancy test strip, steps are:

[0014] (1) Dissolve sodium citrate in ethylene glycol, add anhydrous ferric chloride and ultrapure water, stir and dissolve, then add anhydrous sodium acetate, dissolve, and then prepare Fe3O4 nanoparticles by hydrothermal reaction, which is abbreviated as Fe3O4 NPs;

[0015] (2) Take an appropriate amount of Fe3O4 NPs prepared in step (1) to prepare a 20 mg / mL solution with ultrapure water for standby. Add ultrapure water to a three-necked flask, mechanically stir while passing nitrogen for 15 min, then add sodium citrate solution, heat in oil bath and reflux. Then add Fe3O4 solution, and when it boils again, immediately add chloroauric acid solution to make gold nucleate under hot reduction conditions. After the solution boils for 10 min, stop the reaction. After the solution is naturally cooled to room temperature, wash the product with ultrapure water to prepare Fe3O4@Au nanoparticles (abbreviated as Fe3O4@Au);

[0016] (3) Dissolve the 5' end modified thiol aptamer complementary chain cDNA with ultrapure water, activate it with tris(2-carboxyethyl) phosphine (TCEP) to obtain activated cDNA solution; Mix the Fe3O4@Au aqueous solution with the activated cDNA solution, incubate at room temperature for 16-20 h, salt, and wash with HEPES buffer solution. Then add 6-mercaptohexan-1-ol solution (solvent is HEPES buffer solution) to block the thiol group, incubate at room temperature for 1-2 h, and wash with HEPES buffer solution to obtain Fe3O4@Au-cDNA. Disperse the obtained Fe3O4@Au-cDNA in HEPES buffer solution, add Aptamer solution and incubate at room temperature for 1-2 h, and wash with HEPES buffer solution to obtain Fe3O4@Au-cDNA / Aptamer magnetic probe.

[0017] An AFB1 instant detection reagent, comprising the above-mentioned AFB1 instant detection magnetic probe based on a pregnancy test strip.

[0018] An AFB1 instant detection kit, comprising a commercially available pregnancy test strip, an HCG solution, an EXOI solution, the above-mentioned AFB1 instant detection reagent, and a ZrCl4 solution.

[0019] Further, the concentration of the AFB1 instant detection reagent (solvent: 10 mM HEPES buffer containing 10 mM MgCl2 and 50 mM NaCl) is 1 mg / mL, the concentration of the ZrCl4 solution is 200 μM-4000 μM, the concentration of the exonuclease I (EXOI) solution (solvent: ultrapure water) is 1-5 U / μL, and the concentration of the human chorionic gonadotropin (HCG) solution (solvent: ultrapure water) is 2 μg / mL-15 μg / mL.

[0020] For example, the concentration of the AFB1 instant detection reagent (solvent: 10 mM HEPES buffer containing 10 mM MgCl2 and 50 mM NaCl) is 1 mg / mL, the concentration of the ZrCl4 solution is 2000 μM, the concentration of the exonuclease I (EXOI) solution (solvent: ultrapure water) is 2 U / μL, and the concentration of the human chorionic gonadotropin (HCG) solution (solvent: ultrapure water) is 5 μg / mL.

[0021] A method for detecting AFB1 using the AFB1 instant detection kit described above for non-disease diagnosis, comprising the following steps:

[0022] (1) adding the sample solution to be tested, the exonuclease I (EXOI) solution, the AFB1 instant detection reagent into HEPES buffer and water to obtain a mixed solution; the mixed solution is reacted at room temperature, and the supernatant is separated by magnetic separation to obtain a first reaction solution;

[0023] (2) mixing the first reaction solution with the ZrCl4 solution to obtain a second reaction solution;

[0024] (3) adding the HCG solution to the second reaction solution to obtain a third reaction solution;

[0025] (4) detecting the third reaction solution by using a commercially available pregnancy test strip, waiting for 6 min-10 min, observing the color development of the quality control line and the detection line, and obtaining the AFB1 content in the sample solution to be tested according to the color development and the standard curve y=8.97x+1876.50.

[0026] The sample to be tested is a grain and oil product, such as contaminated peanuts, corn, soybeans, etc.

[0027] The HEPES buffer described above has a pH of 7.4 and a concentration of 100 mM, and contains 10 mM MgCl2 and 50 mM NaCl.

[0028] The volume of the mixed solution in step (1) is 50 μL, and the volume ratio of water, HEPES buffer, sample solution to be tested, exonuclease I solution, and AFB1 rapid detection reagent is 1:1:1:1:6; in the mixed solution, the final concentration of the AFB1 rapid detection magnetic probe is 0.6 mg / mL; the concentration of the exonuclease I solution is 2 U / μL; and the reaction time is 80-120 min.

[0029] Further, the reaction time in step (1) is 120 min.

[0030] In step (2), the total volume of the first reaction solution and the ZrCl4 solution is 45 μL, and the volume ratio of the first reaction solution to the ZrCl4 solution is 8:1; the concentration of the ZrCl4 solution is 2000 μM; and the incubation time is 5-15 min.

[0031] In step (3), the total volume of the HCG solution and the second reaction solution is 50 μL, and the volume ratio of the second reaction solution to the HCG solution is 9:1; the concentration of the HCG solution is 5 μg / mL; and the incubation time is 15-25 min.

[0032] The standard curve is obtained by the following method, and the steps are as follows:

[0033] S1: 5 μL of a series of target AFB1 solutions with concentrations of 500-3000 nM, 5 μL of an EXOI solution with a concentration of 2 U / μL, and 5 μL of a magnetic probe solution (volume of 30 mL, concentration of 1 mg / mL) in the AFB1 rapid detection reagent described above are mixed, 5 μL of 100 mM HEPES buffer and 5 μL of water are added, and a series of mixed solutions (the final concentrations of AFB1 are 50, 100, 150, 200, 250, and 300 nM, respectively) are obtained; the mixed solution is reacted, the supernatant is taken by magnetic separation, and a first reaction solution is obtained;

[0034] S2: 40 μL of the first reaction solution is mixed with a ZrCl4 solution (5 μL, mother liquor concentration of 2000 μM) and incubated for 5-15 min to obtain a second reaction solution;

[0035] S3: 5 μL of a 5 μg / mL HCG solution is added to 45 μL of the second reaction solution and incubated for 15-25 min to obtain a third reaction solution.

[0036] S4 uses a commercial pregnancy test strip to test the third reaction solution. After waiting 6-10 minutes, observe the color development of the control line and test line, and take a picture with a mobile phone. Then, use ImageJ software to calculate the signal intensity of the test line. The specific process is as follows: import the image into ImageJ software, click Image–Type-8-bit to convert the image to 8-bit format, then click Analyse-Gels and select the control line and test line of the test strip, then click Select First line, and then click Plot Gels. The analysis results will appear. Read the peak area to obtain the signal intensity value, and then plot the curve of AFB1 concentration versus signal intensity.

[0037] The beneficial effects of this invention are:

[0038] (1) This invention proposes a novel method for the instant detection of AFB1 based on pregnancy test strips. First, when AFB1 is present in the solution, the Aptamer in the Fe3O4@Au-cDNA / Aptamer magnetic probe can specifically bind to AFB1, competing for Aptamer from the magnetic probe into the solution. Subsequently, EXOI (hydrolyzable single-stranded DNA) is introduced to cleave the Aptamer / AFB1 complex, releasing AFB1, which then binds to the Aptamer on the magnetic probe, further amplifying the signal. After magnetic separation, a solution containing DNA and a mixture of nucleoside monophosphates obtained from EXOI cleavage is obtained, thereby converting the AFB1 concentration signal into DNA and nucleoside monophosphate concentration signals. Second, based on Zr... 4+ Regulating HCG protein activity for pregnancy test strip detection of the non-HCG target AFB1: When the target AFB1 is present, its concentration signal is converted into DNA and nucleoside monophosphate concentration signals. At this point, ZrCl4 solution is added, because the phosphate groups on the DNA and nucleoside monophosphate react with ZrCl4... 4+ Strong coordination between Zr 4+ It preferentially binds to phosphate groups, so HCG activity is not affected and it can still be recognized by the T line on the pregnancy test strip, thus enabling quantitative detection of AFB1. However, when AFB1 is absent from the system, the magnetically separated solution does not contain DNA or nucleoside monophosphate. In this case, adding ZrCl4 aqueous solution will cause electrostatic and hydrophobic interactions between ZrCl4 and the target DNA. 4+ It can bind to HCG and destroy its secondary structure, leading to a decrease in HCG's biological activity. When tested on a pregnancy test strip, the T line cannot capture HCG, resulting in no color development.

[0039] (2) The detection method has the advantages of simple detection process (only three-step reaction), simple separation (only magnetic separation by a magnet), low cost, high sensitivity (detection line as low as 17nM) and good specificity, and can meet the demand of AFB1 instant detection.

[0040] (3) The application provides a target conversion strategy for regulating the biological activity of human chorionic gonadotropin (HCG) based on the coordination of zirconium ions (Zr 4+ ) and aptamers, and provides an Fe3O4@Au-cDNA / Aptamer magnetic probe, method and kit for detecting AFB1 by using a pregnancy test strip, which has the advantages of intuitive results, high sensitivity, rapidness and convenience, and is suitable for AFB1 instant detection in the fields of public health, agriculture and environmental monitoring. BRIEF DESCRIPTION OF DRAWINGS

[0041] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of these drawings.

[0042] Figure 1 It is a schematic diagram of the AFB1 detection principle based on the commercially available pregnancy test strip of the application.

[0043] Figure 2 It is the micro-morphology of Fe3O4 and Fe3O4@Au, wherein A and B are scanning electron microscope (SEM) images of synthesized Fe3O4 and Fe3O4@Au respectively; C and D are transmission electron microscope (TEM) images of synthesized Fe3O4 and Fe3O4@Au respectively.

[0044] Figure 3 It is the X-ray diffraction (XRD) pattern of synthesized Fe3O4 and Fe3O4@Au.

[0045] Figure 4 A is the ultraviolet-visible absorption spectrum (UV-VIS) of the synthesized Fe3O4@Au-cDNA / Aptamer magnetic probe, Figure 4 B is the zeta potential graph of the probe.

[0046] Figure 5 It is the response of the pregnancy test strip to different components.

[0047] Figure 6For the optimization process of the reaction process, wherein (a) is the optimization result of ZrCl4 concentration; (b) is the content optimization result of Fe3O4@Au-cDNA / Aptamer magnetic probe; (c) is the optimization result of reaction time.

[0048] Figure 7 For the detection effect evaluation of AFB1; A is the detection standard curve of different concentrations of AFB1, and the inserted drawing is the color development of the pregnancy test strip for detecting different concentrations of AFB1; B is the detection specificity experimental result of the application. DETAILED DESCRIPTION

[0049] The technical solutions in the embodiments of the application will be described clearly and completely below with reference to the drawings in the embodiments of the application. Obviously, the described embodiments are only part of the embodiments of the application, rather than all the embodiments of the application. Based on the embodiments in the application, all other embodiments obtained by a person of ordinary skill in the art without creative labor are within the protection scope of the application

[0050] Table 1 Base sequence of aptamer complementary chain cDNA and Aptamer

[0051]

[0052] The cDNA solution: 2OD thiol-modified cDNA (14nt, 17.83nmol) in dry powder form ordered from Shanghai Generay Biotech Co., Ltd. is dissolved in 178.3ul of ultrapure water, and the concentration is 100uM.

[0053] The Aptamer solution: 2OD Aptamer (28nt, 8.915nmol) in dry powder form ordered from Shanghai Generay Biotech Co., Ltd. is dissolved in 89.15ul of ultrapure water, and the concentration is 100uM.

[0054] Example 1: Preparation of AFB1 instant detection magnetic probe

[0055] The preparation method of the AFB1 instant detection magnetic probe (Fe3O4@Au-cDNA / Aptamer magnetic probe) based on the pregnancy test paper in this embodiment is as follows:

[0056] (1) Preparation of Fe3O4 nanoparticles: Take 20 mL of ethylene glycol in a small beaker, add 0.2 g of sodium citrate, and stir vigorously to dissolve completely. After the solution is clear and transparent, add 0.6499 g of anhydrous ferric chloride and 433 μL of ultrapure water. Ultrasonic dissolution, after dissolution, stirring for 10 min, then add 1.5 g of anhydrous sodium acetate, after dissolution, stirring for 15 min. Finally, the solution is loaded into the reaction kettle, and the reaction is carried out at 200°C for 12 h. The product is washed with anhydrous ethanol and dried under vacuum at 30°C to obtain Fe3O4 nanoparticles.

[0057] (2) Preparation of Fe3O4@Au nanoparticles: Take an appropriate amount of the above Fe3O4 NPs and prepare a 20 mg / mL solution with ultrapure water. Add 20 mL of ultrapure water to a 100 mL three-necked flask, and stir mechanically while purging with nitrogen for 15 min. Then add 2.9 mL of sodium citrate solution (38.4 mM), heat the oil bath and reflux. Then add 1 mL of Fe3O4 solution (20 mg / mL), and after boiling again, immediately add 150 μL of 1% chloroauric acid solution to nucleate gold under hot reduction conditions. After the solution boils for 10 min, stop the reaction. After the solution is naturally cooled to room temperature, the product is washed with ultrapure water three times to obtain Fe3O4@Au nanoparticles (abbreviated as Fe3O4@Au).

[0058] (3) Preparation of Fe3O4@Au-cDNA / Aptamer magnetic probe: The dry powder of 2OD thiol-modified cDNA (14nt, 17.83nmol) ordered from Shanghai Biotech was dissolved with 178.3μL of ultrapure water. 10mM tris(2-carboxyethyl)phosphine (TCEP) aqueous solution was mixed with 100μM cDNA solution at a volume ratio of 5:4 (the final concentration of cDNA was 44.44μM), and incubated at room temperature for 1h. The cDNA was activated to reduce the disulfide bond formed between the thiol-modified aptamer. 1mL of Fe3O4@Au aqueous solution with a concentration of 1mg / mL was mixed with 45μL of activated cDNA and incubated at room temperature for 18h in a disc homogenizer. After incubation, 1M NaCl solution was added in three times within 8h to perform salting, so that the final solution had a NaCl concentration of 0.1M. After salting, the solution was washed with pH=7.4, 10mM HEPES (containing 50mM NaCl, 10mM MgCl2) buffer for 3 times, then dispersed with 1mL of 10μM 6-mercaptohexan-1-ol solution (10mM HEPES buffer as solvent) and incubated at room temperature for 1.5h in a disc homogenizer. After 1.5h, the solution was washed with 10mM HEPES buffer for 3 times, dispersed in 1mL of 10mM HEPES buffer, and incubated with Aptamer solution at a molar ratio of 1:1 at room temperature for 1.5h. After 1.5h, the solution was washed with 10mM HEPES buffer for 3 times to obtain Fe3O4@Au-cDNA / Aptamer magnetic probe. The probe was dispersed in 1mL of 10mM HEPES buffer (pH 7.4, containing 10mM MgCl2, 50mM NaCl) to obtain Fe3O4@Au-cDNA / Aptamer magnetic probe solution, which was stored at 4℃.

[0059] The morphology and structure of Fe3O4@Au-cDNA / Aptamer magnetic probe were characterized by SEM, TEM, XRD, and UV-VIS. As shown in FIGS. Figure 2 A and C, the Fe3O4 nanoparticles had a regular shape and a relatively smooth surface. Figure 2 B and D, a large number of Au particles appeared on the surface of Fe3O4 nanoparticles.

[0060] Figure 3For the XRD patterns of Fe3O4 and Fe3O4@Au, the characteristic peaks (2θ = 30.3°, 35.7°, 43.3°, 54.1°, 57.4° and 62.9°) correspond to the (220), (311), (400), (422), (511) and (440) planes of Fe3O4, while after modification with Au nanoparticles, characteristic peaks of Au nanoparticles are also shown at 2θ = 38.2°, 44.5°, 64.5° and 77.5°, which proves the successful synthesis of Fe3O4@Au.

[0061] After incubation of Fe3O4@Au with cDNA and Aptamer, Figure 4 As shown by UV-visible spectroscopy, compared with Fe3O4, Fe3O4@Au shows a characteristic peak of Au nanoparticles at 550 nm, and Fe3O4@Au-cDNA / Aptamer also shows a characteristic peak of DNA at 260 nm, which proves the successful modification of cDNA / Aptamer.

[0062] The Zeta potentials of Fe3O4, Fe3O4@Au and Fe3O4@Au-cDNA / Aptamer are shown in Figure 4 As shown in B, after modification with negatively charged Au nanoparticles and negatively charged cDNA / Aptamer, the potential is obviously reduced, from -12.7 mV to -22.5 mV and -29 mV, which further proves the successful preparation of the above materials.

[0063] Example 2: Feasibility and condition optimization

[0064] I. Feasibility

[0065] The present application studies the influence of different components in the system on the color development of the pregnancy test strip, and the results are shown in Figure 5 As can be seen, after adding the target AFB1, the HCG signal is basically unchanged, indicating that AFB1 does not affect the activity of free HCG and has no effect on the color development process of HCG on the test strip. 4+ There is no color signal on the test strip detection line, indicating that Aptamer (AF28), Zr 4+ There is no background interference in the detection process; HCG and Zr 4+ After incubation, the color signal of the test strip is significantly reduced, proving that Zr 4+ destroyed the biological activity of HCG, so it cannot be captured by the test strip T line antibody to develop color, but when AF28 and Zr 4+ react first and then add HCG, the test strip detection line signal recovers, proving that the phosphate backbone on the Aptamer is combined with Zr 4+ due to coordination, and Zr4+ The results fully prove that the target conversion strategy based on the coordination of zirconium ions (Zr 4+ )-aptamer regulates the biological activity of human chorionic gonadotropin (HCG) and is feasible for the detection of AFB1 by pregnancy test strips.

[0066] The detection principle of aflatoxin B1 (AFB1) of the application is as shown in the figure. Figure 1 Firstly, the Fe3O4@Au-cDNA / Aptamer magnetic probe is fixed with cDNA on the surface of Fe3O4@Au through Au-S bond and connects Aptamer through base complementary pairing. When AFB1 exists in the solution, AFB1 can specifically bind with AFB1, competes AFB1 from the magnetic probe to the solution, and introduces EXOI (hydrolysable single-stranded DNA) to cut the AFB1 / AFB1 complex, releases AFB1, and further realizes signal amplification. After magnetic separation, a solution containing DNA and nucleoside monophosphate cut by EXOI is obtained, so as to convert the concentration signal of AFB1 into the concentration signal of DNA and nucleoside monophosphate. Secondly, based on the regulation of HCG protein activity for the detection of non-HCG target AFB1 by pregnancy test strips, when the target AFB1 exists, the concentration signal thereof is converted into the concentration signal of DNA and nucleoside monophosphate. At this time, ZrCl4 solution is added. Due to the strong coordination between the phosphate group on DNA and nucleoside monophosphate and Zr 4+ 4+ 4+ will preferentially combine with the phosphate group, and the activity of HCG will not be affected, and the T line of the pregnancy test strip can still be recognized and developed, so as to realize the quantitative detection of AFB1. When there is no AFB1 in the system, DNA and nucleoside monophosphate do not exist in the solution after magnetic separation. At this time, ZrCl4 aqueous solution is added. Due to electrostatic and hydrophobic effects, Zr 4+ will combine with HCG and destroy the secondary structure of HCG, resulting in a decrease in the biological activity of HCG. In the detection of the pregnancy test strip, the T line cannot capture HCG, resulting in no color development.

[0067] II. Condition optimization

[0068] 1. Optimization of the amount of ZrCl4

[0069] ​​5 μL of HCG solution with a concentration of 5 μg / mL, 5 μL of EXOI solution with a concentration of 2 U / μL and 5 μL of HEPES buffer with a concentration of 100 mM were added to different amounts of ZrCl4 solution in a 0.5 mL centrifuge tube, and then ultrapure water was added to make the total volume 50 μL. After vortex mixing (so that the final concentration of ZrCl4 was 20 μM, 50 μM, 100 μM, 200 μM and 400 μM), the mixture was incubated at room temperature for 20 minutes. After incubation, the test solution was tested using a test strip, and the signal intensity was read. The results are shown in Figure 6 a. When the concentration of ZrCl4 reached 200 μM, the signal was basically eliminated, indicating that the biological activity of HCG had been completely quenched, so this concentration was selected in the subsequent experiments.

[0070] 2. Optimization of the amount of Fe3O4@Au-cDNA / Aptamer magnetic probe

[0071] Under the optimized ZrCl4 concentration, the amount of probe was optimized. AFB1 with a final concentration of 300 nM was incubated with different volumes of Fe3O4@Au-cDNA / Aptamer magnetic probe for 4 hours, so that the final concentration of AFB1 in the mixed solution of step (a) was 0.2 mg / mL, 0.4 mg / mL, 0.6 mg / mL and 0.8 mg / mL, respectively. After incubation, the signal intensity was detected according to the detection method. The specific steps are as follows:

[0072] (a) 5 μL of AFB1 solution containing 3000 nM (final concentration of 300 nM in 50 μL) was mixed with the above-mentioned 30 μL of Fe3O4@Au-cDNA / Aptamer magnetic probe solution with different concentrations in a 0.5 mL centrifuge tube, and 5 μL of EXOI solution with a concentration of 2 U / μL, 5 μL of HEPES buffer with a concentration of 100 mM and 5 μL of water were added. After vortex mixing, a mixed solution was obtained; the mixed solution was reacted at room temperature for 4 hours, and 40 μL of supernatant solution was taken after magnetic separation to obtain a first reaction liquid.

[0073] (b) 5 μL of ZrCl4 aqueous solution with a concentration of 2000 μM (final concentration of 200 μM in 50 μL) was added to the first reaction liquid obtained in step (a), and the mixture was thoroughly mixed and incubated at room temperature for 10 minutes to obtain a second reaction liquid.

[0074] (c) 5 μL of HCG solution with a concentration of 5 μg / mL was added to the second reaction liquid obtained in step (b), and the mixture was thoroughly mixed and incubated at room temperature for 20 minutes to obtain a third reaction liquid;

[0075] (d) The pregnancy test strip was inserted into the third reaction solution obtained in step (c), and the experimental results were recorded by taking a photo after 7 minutes. The signal intensity of the test strip detection line was analyzed using Image J software to optimize the optimal probe concentration.

[0076] The results are shown in Table 2. Figure 6 As shown in Table 2, when the final concentration of Fe3O4@Au-cDNA / Aptamer magnetic probe reached 0.6 mg / mL, the signal change intensity tended to be flat, so this concentration was selected for detection in subsequent experiments.

[0077] 3. Optimization of detection reaction time when adding probes and targets

[0078] Under the above optimal conditions (the final concentration of AFB1 was 300 nM and the final concentration of Fe3O4@Au-cDNA / Aptamer magnetic probe was 0.6 mg / mL), the incubation time for detection when adding probes and targets was optimized. The reaction time of step (a) was set to 0.5 hours, 1 hour, 2 hours, and 4 hours, respectively. After incubation, the signal intensity was read according to the detection method. The specific steps are as follows:

[0079] (a) 5 μL of target AFB1 solution containing 3000 nM (50 μL volume, final concentration 300 nM) was mixed with the above 30 μL Fe3O4@Au-cDNA / Aptamer magnetic probe solution with a concentration of 1 mg / mL in a 0.5 mL centrifuge tube, and 5 μL of 2 U / μL EXOI solution, 5 μL of 100 mM HEPES buffer, and 5 μL of water were added. After vortex mixing, different reaction times (0.5 hours, 1 hour, 2 hours, and 4 hours) were set at room temperature, and 40 μL of supernatant solution was taken after magnetic separation to obtain the first reaction solution;

[0080] (b) 5 μL of ZrCl4 aqueous solution with a concentration of 2000 μM (50 μL, final concentration 200 μM) was added to the first reaction solution obtained in step (a), and the mixture was incubated at room temperature for 10 minutes to obtain the second reaction solution;

[0081] (c) 5 μL of HCG solution with a concentration of 5 μg / mL was added to the second reaction solution obtained in step (b), and the mixture was incubated at room temperature for 20 minutes to obtain the third reaction solution;

[0082] (d) The pregnancy test strip was inserted into the third reaction solution obtained in step (c), and the experimental results were recorded by taking a photo after 7 minutes. The signal intensity of the test strip detection line was analyzed using Image J software to optimize the optimal probe concentration.

[0083] The results are shown in Table 2. Figure 6As shown in Figure c, when the incubation time reaches 2 hours, the signal intensity tends to be flat, and thus the incubation time is selected for detection.

[0084] Example 3: Sensitivity and specificity of detection of AFB1

[0085] The detection process of sensitivity is detected under the optimized conditions, and the specific steps are as follows:

[0086] (1) 5 μL of a series of AFB1 standard solutions with a concentration range of 500-3000 nM (the final concentrations are 50 nM, 100 nM, 150 nM, 200 nM, 250 nM, and 300 nM, respectively) are mixed with 30 μL of the Fe3O4@Au-cDNA / Aptamer magnetic probe solution with a concentration of 1 mg / mL in a 0.5 mL centrifuge tube, and 5 μL of 2 U / μL EXOI solution, 5 μL of 100 mM HEPES buffer, and 5 μL of water are added. After vortex mixing, the reaction is carried out at room temperature for 2 hours, and 40 μL of supernatant solution is obtained after magnetic separation to obtain the first reaction solution.

[0087] (2) 5 μL of a ZrCl4 aqueous solution with a concentration of 2000 μM (the final concentration is 200 μM) is added to the first reaction solution obtained in step (1), and after fully mixing, the incubation is carried out at room temperature for 10 minutes to obtain the second reaction solution.

[0088] (3) 5 μL of HCG solution (5 μg / mL) is added to the second reaction solution obtained in step (2), and after fully mixing, the incubation is carried out at room temperature for 20 minutes to obtain the third reaction solution;

[0089] (4) The pregnancy test strip is inserted into the third reaction solution obtained in step (3), and after 7 minutes, the experimental results are recorded by taking a picture, and the Image J software is used to analyze the signal intensity of the detection line of the test strip. The color signal intensity corresponding to the concentration is obtained, and the standard curve is drawn with the AFB1 concentration (the final concentration in step (1)) as the abscissa and the color signal intensity as the ordinate. The results are shown in Figure A. Figure 7 As shown in Figure A, the signal intensity value of the detection line of the pregnancy test strip shows a linear relationship in the range of 50-300 nM, and the detection limit is 17 nM according to the signal-to-noise ratio of 3 times.

[0090] Specificity detection: AFB1, FB2, OTA, AFB2, and DON toxins are used as detection materials to study the detection specificity of the application. The above-mentioned samples are prepared so that the final concentration of the AFB1 sample is 50 nM, and the final concentrations of the other samples are 500 nM. AFB1 is 50 nM, and the detection is carried out according to the above-mentioned method. As shown in Figure B, the signal intensity of the detection line of the pregnancy test strip shows a linear relationship in the range of 50-300 nM, and the detection limit is 17 nM according to the signal-to-noise ratio of 3 times. Figure 7FB2, OTA, AFB2 and DON toxin signals are significantly reduced compared with the AFB1 signal, indicating that the detection method proposed in the application has high specificity.

[0091] Example 4: Detection of actual samples

[0092] In order to study the application feasibility of the established detection method in actual samples, the spiked recovery rate experiment was carried out in the actual samples. 14 mL of methanol and 6 m of ultrapure water were mixed to prepare an extraction solution, and the mixture of the extraction solution and 5 g of sample peanut grinding pulp was oscillated for 60 minutes, then centrifuged at 6000 rpm for 10 minutes to extract the supernatant, then the obtained solution was dialyzed by using an ultrafiltration membrane (0.22 um). Then, the treated sample was intensified by adding AFB1 standard solution to prepare spiked samples containing 50, 150 and 300 nM of AFB1. The analysis results of AFB1 in the peanut sample are shown in Table 2.

[0093] Table 2: Recovery rate of AFB1 spiked in peanut sample

[0094]

[0095] As can be seen from Table 2, the recovery rate of AFB1 is 95.14% to 103.70%, and the relative standard deviation RSD is less than 10%, indicating that the developed kit has good feasibility for determining AFB1 in complex matrix.

[0096] The above only describes the preferred embodiments of the present application and is not used to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A method for preparing a magnetic probe for the instant detection of AFB1 based on pregnancy test strips, characterized in that, The steps are as follows: (1) Fe3O4 nanoparticles were prepared by hydrothermal reaction; (2) Au nanoparticles are grown on the surface of the Fe3O4 nanoparticles obtained in step (1) to obtain Fe3O4@Au nanoparticles; (3) Fe3O4@Au nanoparticles were incubated with the complementary strand of the aptamer, and then the aptamer was added for incubation to obtain the Fe3O4@Au-cDNA / Aptamer magnetic probe, namely the AFB1 instant detection magnetic probe. The aptamer is a nucleotide sequence that can specifically bind to AFB1; the nucleotide sequence of the complementary strand of the aptamer is shown in SEQ ID NO.1, with a thiol group modified at its 5' end; the nucleotide sequence of the aptamer is shown in SEQ ID NO.

2.

2. The method for preparing the AFB1 instant detection magnetic probe based on pregnancy test strips according to claim 1, characterized in that, The aptamer complementary chain needs to be activated by tris(2-carboxyethyl)phosphine first.

3. An AFB1 instant detection magnetic probe based on a pregnancy test strip prepared using the preparation method described in claim 1 or 2.

4. An AFB1 point-of-care test kit, characterized in that, Includes the AFB1 instant detection magnetic probe based on a pregnancy test strip as described in claim 3.

5. An AFB1 point-of-care test kit, characterized in that, The reagents include commercially available pregnancy test strips, HCG solution, exonuclease I solution, the AFB1 instant detection reagent as described in claim 4, and ZrCl4 solution.

6. The AFB1 point-of-care test kit according to claim 5, characterized in that, The concentration of the AFB1 instant detection reagent is 1 mg / mL, the concentration of the ZrCl4 solution is 200 μM-4000 μM, the concentration of the exonuclease I solution is 1-5 U / μL, and the concentration of the HCG solution is 2 μg / mL-15 μg / mL.

7. A method for detecting AFB1 using the AFB1 point-of-care test kit according to claim 5 or 6 for non-disease diagnosis purposes, characterized in that, The steps are as follows: (1) Add the sample solution to be tested, exonuclease I solution, and AFB1 instant detection reagent to HEPES buffer and water to obtain a mixed solution; react the mixed solution at room temperature, and then magnetically separate the supernatant to obtain the first reaction solution; (2) The first reaction solution was mixed with ZrCl4 solution and incubated to obtain the second reaction solution; (3) Add the HCG solution to the second reaction solution and incubate to obtain the third reaction solution; (4) Use commercially available pregnancy test strips to test the third reaction solution. Wait 6 min-10 min and observe the color development of the control line and the test line. Based on the color development and the standard curve y=8.97x+1876.50, obtain the AFB1 content in the sample solution to be tested.

8. The method for detecting AFB1 using the AFB1 point-of-care test kit for non-disease diagnosis as described in claim 7, characterized in that, In step (1), the volume of the mixed solution is 50 μL, and the volume ratio of water, HEPES buffer, sample solution to be tested, exonuclease I solution and AFB1 instant detection reagent is 1:1:1:1:6; the final concentration of the AFB1 instant detection magnetic probe in the mixed solution is 0.6 mg / mL; the concentration of exonuclease I solution is 2 U / μL; and the reaction time is 80-120 min.

9. The method for detecting AFB1 using the AFB1 point-of-care test kit for non-disease diagnosis as described in claim 8, characterized in that, In step (2), the total volume of the first reaction solution and the ZrCl4 solution is 45 μL, the volume ratio of the first reaction solution to the ZrCl4 solution is 8:1, the concentration of the ZrCl4 solution is 2000 μM, and the incubation time is 5 min-15 min.

10. The method for detecting AFB1 using the AFB1 point-of-care test kit for non-disease diagnosis according to claim 9, characterized in that, In step (3), the total volume of HCG solution and second reaction solution is 50 μL, the volume ratio of second reaction solution to HCG solution is 9:1, the concentration of HCG solution is 5 μg / mL, and the incubation time is 15 min-25 min.

Images