Attenuated African swine fever virus and use thereof in vaccine compositions

Abstract

The present invention relates to African swine fever (ASF) attenuated viruses, wherein the genes EP402R and EP153R have been inactivated, useful as vaccines. The attenuated virus protects the pig from subsequent toxic virus challenges. The invention also relates to the use of these attenuated viruses in the treatment and / or prevention of ASF.

Description

Technical Field

[0001] This invention relates to attenuated African swine fever viruses that can be used as vaccines, wherein the genes have been inactivated. The attenuated virus protects pigs from subsequent viral attacks. This invention also relates to the use of such attenuated viruses in the treatment and / or prevention of African swine fever. Background Technology

[0002] African swine fever (ASF) is a devastating hemorrhagic disease in domestic and wild pigs caused by the large double-stranded DNA virus African swine fever virus (ASFV). ASFV is the only member of the Asfarviridae family and replicates primarily in the cytoplasm of cells. Virulent strains of ASFV can kill domestic pigs within approximately 5–14 days after infection, with a mortality rate approaching 100%.

[0003] ASFV can infect and replicate in *Phacochoerus* sp., *Bushpig* sp., and soft ticks (of which it is considered a vector), but few clinical signs are observed in these species, and long-term persistent infection can be established. ASFV was first described after European settlers introduced pigs into areas where it was prevalent; therefore, ASFV is an example of a “newly emerging infection.” The disease is currently endemic in many sub-Saharan countries and several regions in Europe and Southeast Asia. Vaccination is considered the most effective strategy and solution for disease control. However, no vaccine is currently available for ASF. In the past, some countries have achieved eradication through a variety of strategies, including large-scale culling on farms and increased biosecurity.

[0004] Although ASFV has resurfaced in recent decades, it has been most prominent in Georgia, where in 2007 the virus spread from the port city of Porti to the Caucasus region, reaching the Russian Federation and Eastern Europe, and rapidly spreading from Belgium in the west to the People's Republic of China in the east to Southeast Asia and the Pacific. Overall, ASF has been reported in 74 countries since 2005. Most recently, in 2022, multiple recurrences were reported in major territories including China, RF, Moldova, Ukraine, as well as northern Macedonia, Thailand, and Italy. These recent events highlight the extremely disturbing pattern of continuous transmission of ASFV.

[0005] Pork is one of the main sources of animal protein, accounting for more than 35% of global meat consumption. Therefore, this disease poses a serious threat to food safety worldwide. It also impacts biodiversity and ecosystem balance, as it affects not only domesticated farm pigs but also wild boars, including native breeds.

[0006] Attempts to vaccinate animals using classic methods such as extracts from infected cells, supernatants from infected porcine peripheral blood leukocytes, purified inactivated virus bodies, infected glutaraldehyde-fixed macrophages, or detergent-treated infected alveolar macrophages have failed to induce protective immunity. Other methods based on DNA vaccines or combinations of specific ASFV proteins and DNA (heterologous primary-booster vaccines) have also been tested but without success. Homologous protective immunity does indeed develop in pigs that survive viral infection. Pigs that survive acute infection with moderately virulent or attenuated variants of ASFV develop long-term antibodies against homologous viral challenges but rarely against heterologous viral challenges. Due to the severity of the infection and the enormous economic losses, it is crucial to develop mechanisms for preventing ASFV infection in the global swine industry.

[0007] WO2020 / 049194 and Gallardo Carmina et al. (Veterinary Medicine, 2019, 1399-1404) described the ASFV strain Lv17 / WB / Rie1, an attenuated genotype II non-hemoadsorbed (HAD) ASFV isolated in Latvia, Europe in 2017. Sequence analysis of the EP402R gene, encoding the CD2-like protein that causes HAD, revealed a single adenosine deletion at positions 73 and 763 in the genome of the non-HAD ASFV Lv17 / WB / Rie1, which produces a truncated protein. The N-terminal extracellular domain of the EP402R protein, the ligand-binding domain (formed by amino acids 1-203 of the EP402R gene), is essential for efficient gene expression. Mutations in one or more nucleotides of the ligand-binding domain can disrupt the folding of the EP402R protein. However, disruption of the folding may imply differential folding and slower, but correct, expression of the EP402R protein. Although the EP402R mutation described at nucleotide position 393 in the ligand-binding domain of ASFV Lv17 / WB / Rie1 results in a nonfunctional protein, it has not been confirmed in vitro whether this mutation prevents EP402R protein (CD2v) expression during non-HAD Lv17 / WB / Rie1 viral infection. Therefore, the Lv17 / WB / Rie1 isolate can be considered a wild-type strain with a point mutation within the EP402R gene that confers a non-HAD characteristic, which appears to be associated with attenuation in the wild-type strain.

[0008] Petrovan Vlad et al. (Journal of Virology, 2022, 96, 1) described a virulent ASFV strain of genotype I (Benin97) containing deletions in the DP148R, EP153R, and EP402R genes. Petrovan Vlad et al. described that the additional deletion of EP153R (BeninΔDP148RΔEP153RΔEP402R) further attenuated the virus after immunization, but observed reduced protection and detectable levels of moderate challenge virus in the blood. Furthermore, the isolated deletion of EP153R from the BeninADP148R strain did not lead to further viral attenuation or reduce the duration of viral presence in the blood.

[0009] Document CA3170058A1 describes an attenuated ASFV strain named GeorgiaAK145RAEP153RCD2vQ96R, in which the K145R and EP153R genes are deleted, and the EP402R / CD2v protein is mutated to include the Q96R amino acid, which appears to reduce HAD activity but does not provide complete gene inactivation. Furthermore, this strain contains several functional forms of the MGF gene.

[0010] Therefore, there is a need in the art for improved live attenuated non-HAD ASFV strains that can provide effective protection against ASF in animals while remaining safe without restoring the HAD phenotype. Summary of the Invention

[0011] The inventors of this invention have discovered that, as disclosed in patent application WO2020 / 049194, inactivation of two genes in the naturally attenuated ASFVLv17 / WB / Rie1 strain produces a further attenuated strain of the virus, which, when used as an immunogenic composition / vaccine, provides excellent protection against viral challenge in pigs and wild boars without reversion to the HAD phenotype. This strain is also expected to be safe for pregnant sows.

[0012] Therefore, a first aspect of the present invention relates to a live attenuated African swine fever virus (ASFV) characterized by a modified form comprising the genome of the ASFV Lv17 / WB / Rie1 strain, wherein the EP153R and EP402R genes have been inactivated.

[0013] Surprisingly, inactivation of these two genes in strain Lv17 / WB / Rie1 resulted in an excellent balance between safety and efficacy of the live attenuated virus. Since the background strain was a wild-type isolate from wild boar, further attenuation of this strain (which is not pathogenic in wild boar) was expected to lead to low efficacy, particularly in wild boar. However, this was not the case. The new vaccine appears to be effective and safe for vaccinating both wild boar and domestic pigs, even at relatively low doses and after a single injection.

[0014] Another aspect of the invention relates to an immunogenic composition or vaccine composition comprising an attenuated ASFV according to the invention and a pharmaceutically suitable carrier or excipient.

[0015] Another aspect relates to the recombinant ASFV according to the invention, which is used for the prevention or treatment of diseases caused by ASFV infection.

[0016] Another aspect relates to a polynucleotide comprising first, second, and third regions, wherein the first region contains an expression cassette containing an ASFV heterologous gene, wherein the first region is laterally connected to the second and third regions, and wherein the second and third regions are ASFV genomic regions naturally laterally connected to the ASFV EP402R gene in the ASFV genome of the Lv17 / WB / Rie1 strain.

[0017] Another aspect relates to a carrier comprising the polynucleotides described in the present invention.

[0018] Another aspect relates to a host cell that contains the polynucleotides described in the invention or the vectors described in the invention.

[0019] Another aspect of the invention relates to a method for producing recombinant African swine fever virus (ASFV) according to the invention, the method comprising:

[0020] (i) Modifying target cells in the following ways

[0021] - Introducing the polynucleotide according to the present invention

[0022] - Infect the cells with the ASFV Lv17 / WB / Rie1 strain, and

[0023] - Introduce means to generate double-strand DNA breaks in the genome of the attenuated ASFV strain within or near the regions containing the EP402R and EP153R genes.

[0024] (ii) The target cells are maintained under conditions sufficient to allow double-strand DNA breaks to occur in the ASFV genome and to permit homologous recombination between the ASFV genome containing the DNA breaks and the second and third regions of the polynucleotide, thereby causing the first region within the polynucleotide introduced in step (i) to replace the regions encoding the EP402R and EP153R genes, and

[0025] (iii) The recombinant ASFV is recovered from the supernatant and / or from the whole cell extract, and ASFV virions containing the reporter gene are selected. Attached Figure Description

[0026] Figure 1 Use 10 4 (Square, dashed line) and 10 3 (Circle, dotted line) Mean clinical signs (CS) scores of wild boars orally vaccinated with ASFV Lv17 / WB / Rie1, unvaccinated (cross, dotted line), and non-surviving (diamond, solid line)

[0027] Figure 2 Use 10 4 (Square, solid line) and 10 2 (Rhombus, dotted line) Mean clinical signs (CS) scores of wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD and those that did not survive (circle, dashed line).

[0028] Figure 3 Use 10 4 (Square, dashed line) and 10 3 (Circle, dotted line) Average rectal temperature of wild boars orally inoculated with ASFV Lv17 / WB / Rie1, unimmunized (cross, dotted line), and non-surviving (diamond, solid line)

[0029] Figure 4 Use 10 4 (Solid line) and 10 2 (Dashed line) Average rectal temperature of wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD.

[0030] Figure 5 .to use 10 4 The mean viremia value represented by quantitative cycling (Cq) values ​​of real-time PCR performed on orally inoculated and non-surviving wild boars with ASFV Lv17 / WB / Rie1 (square, dashed line) and 103 (circle, dotted dashed line) wild boars (diamond, solid line).

[0031] Figure 6 Use 10 4 (Solid line) and 102 (Dashed line) represents the mean value of real-time PCR quantitative cycling (Cq) values ​​for wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD, expressed as viremia.

[0032] Figure 7 Use 10 4 (Circles, solid lines) and 103 (squares, dashed lines) represent the percentage of wild boars with a positive antibody response (ELISA) after oral inoculation with ASFV Lv17 / WB / Rie1.

[0033] Figure 8 Use 10 4 (Circle, solid line) and 10 2 (Square, dotted lines) Percentage of wild boars with a positive antibody response (ELISA) after oral inoculation with ASFV Lv17 / WB / Rie1-ΔCD.

[0034] Figure 9 Use 10 4 The mean clinical signs (CS) scores of ASFV Lv17 / WB / Rie1 orally immunized, non-immunized (cross, dotted line) wild boars and challenged control animals (diamond, solid line) are (square, dashed line) and 103 (circle, dashed line).

[0035] Figure 10 Use 10 4 (Dark blue) and 10 3 (Circle, dotted line) Average rectal temperature of unimmunized (cross, dotted line) wild boars orally inoculated with ASFV Lv17 / WB / Rie1 and challenged control animals (diamond, solid line).

[0036] Figure 11 Use 10 4 (Square, solid line) and 10 2 (Rhombus, dotted line) Mean clinical signs (CS) scores after challenge for wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD and those that did not survive (circle, dashed line).

[0037] Figure 12 Use 10 4 (Solid line) and 10 2 (Dashed line) Average rectal temperature of wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD after challenge.

[0038] Figure 13 Display using 10 4(Solid line) and 103 (dotted line) are Kaplan-Meier curves for survival time after challenge in wild boars orally inoculated with ASFV Lv17 / WB / Rie1 and controls (dashed line).

[0039] Figure 14 Display using 10 4 (Solid line) and 10 2 (Dotted line) Kaplan-Mayer curves for survival time data of wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD.

[0040] Figure 15 .to use 10 4 (Square, dashed line) and 10 3 (Circle, dashed line) represents the mean value of quantitative cycling (Cq) values ​​from real-time PCR performed on wild boars orally inoculated with ASFV Lv17 / WB / Rie1, unimmunized (diamond, solid line), and control (cross, dashed line).

[0041] Figure 16 Use 10 4 (Solid line) and 10 2 (Dashed line) represents the mean value of real-time PCR quantitative cycling (Cq) values ​​for wild boars orally inoculated with ASFV Lv17 / WB / Rie1-ΔCD, expressed as viremia.

[0042] Figure 17 The mean of clinical scores observed daily in animals inoculated with the viral vaccine strain (Group 1: ΔCD) and the parental virus (Group 2).

[0043] Figure 18 The average severity of clinical signs observed in animals immunized with the viral vaccine strain (Group 1: ΔCD) and the parental virus (Group 2).

[0044] Figure 19 The average rectal temperature in animals immunized with the viral vaccine strain (Group 1: ΔCD) and the parental virus (Group 2) throughout the study.

[0045] Figure 20 Chart showing the survival of pigs immunized with viral vaccine strain (Group 1: ΔCD) and parental virus (Group 2) after vaccination.

[0046] Figure 21 . Viremia and viral load in the blood of pigs immunized with the viral vaccine strain (Group 1: ΔCD) and parental virus (Group 2) were measured by PCR before the challenge.

[0047] Figure 22Antibody response produced in pigs after immunization with viral vaccine strain (Group 1: ΔCD) and parental virus (Group 2).

[0048] Figure 23 Mean clinical scores of pigs vaccinated with the highly virulent Arm07 ASFV and pigs challenged. Control pigs that were challenged died 7 days after the challenge (data not shown).

[0049] Figure 24 The mean severity of various parameters used to determine the clinical score of pigs vaccinated with the mutant vaccine strain or the parent strain after challenge with highly virulent Arm07 virus. Control pigs died 7 days after challenge (this data is not shown).

[0050] Figure 25 The survival charts cover the entire study and represent animal survival rates after vaccination and challenge. All animals that survived at challenge had survived infection with highly virulent ASF Arm07 virus. Mild anorexia, fever, and recumbency were observed or not observed in any group.

[0051] Figure 26 Viremia and viral load in the blood were detected by PCR in animals immunized with Lv17 / WB / Rie1 (top panel) and Lv17 / WB / Rie1-ΔCD (bottom panel) after vaccination and challenge with highly virulent ASF Arm07 virus. Detailed Implementation

[0052] The inventors of this invention have discovered, as known from patent application WO2020 / 049194, that the EP153R and EP402R genes in the ASFV Lv17 / WB / Rie1 strain encode a C-type lectin-like protein and a CD2-like (CD2v) protein, respectively, and that inactivation of these genes produces an attenuated strain of the virus, which provides excellent protection in virus challenge tests when used as an immunogenic composition / vaccine. Furthermore, vaccine compositions containing the inactivated ASFV Lv17 / WB / Rie1 strain are expected to be safe for pregnant sows.

[0053] These results were unexpected, given the previous controversy surrounding the link between the EP402R and EP153R proteins and virulence. For example, deletion of the EP402R gene in the genomes of highly toxic viruses such as Malavi Lil20 / 1 (Borca et al., 1998, J Virol. 72:2881-9), Georgia / 07 (Borca et al., 2020, Sci Rep. 2020; 10:494), or Congo (Koltsov et al., 2023, Animals (Basel). 2023, 13:2002) has not reduced the virulence of these viruses in pigs. Similarly, comparative in vivo experiments using the BA71ΔCD2EP153R recombinant virus demonstrated that deletion of EP153R in BA71ΔCD2f reduced vaccine efficacy without improving safety (Lopez et al., 2021, Viruses, 13(9):1678). Furthermore, it has been shown that a single deletion of the EP153R gene in genotype I non-HAD and attenuated NH / P68 strains (Gallardo et al., 2017, Vaccine; 36:2694-2704) and virulent Malavi ASFV (Neilan et al., 1998 J. Gen. Viro. l 80:2693-2697) does not reduce the virus's virulence or render it ineffective in pigs.

[0054] Recombinant ASFV strain

[0055] In a first aspect, the present invention relates to a live attenuated African swine fever virus (ASFV), characterized by a modified form comprising the genome of the ASFV Lv17 / WB / Rie1 strain, wherein the EP153R and EP402R genes have been inactivated. This strain will be referred to herein as "the ASFV strain of the present invention".

[0056] As used herein, the term "African swine fever virus" and its acronym "ASFV" refer to the pathogen of African swine fever (ASF). ASFV is a large icosahedral double-stranded DNA virus with a linear genome containing at least 150 genes. The number of genes varies slightly between different viral isolates. ASFV shares similarities with other large DNA viruses, such as poxviruses, iridoviruses, and giant viruses. Like other viral hemorrhagic fevers, the primary target cells for replication are monocytes and macrophages. Based on sequence variations in the C-terminal region of the B646L gene encoding the major capsid protein p72, 24 ASFV genotypes (I-XXII) have been identified. All ASFV p72 genotypes circulate in East and Southern Africa, with only a few genotypes found outside these regions. Currently, genotype II is the only genotype present globally. In a preferred embodiment of the ASFV strain of the present invention, the genome of the ASFV strain of the present invention is a modified form of the genome of genotype II ASFV. The ASFV strain of the present invention comprises a modified form of the genome of the ASFV Lv17 / WB / Rie1 strain, defined as SEQ ID NO:1. In a preferred embodiment of the ASFV strain of the present invention, the ASFV genome is a modified form of the genome of the Lv17 / WB / Rie1 strain having the sequence according to SEQ ID NO:1, wherein the EP153R and EP402R genes have been inactivated. In another specific embodiment of the ASFV strain of the present invention, the genome of the recombinant ASFV Lv17 / WB / Rie1 strain comprises the sequence of SEQ ID NO:2.

[0057] It should be understood that the ASFV strains of the present invention, which contain a genome modified as defined in SEQ ID NO:1, are still characterized by the inactivation of the EP402R and EP153R genes.

[0058] As used herein, the term "live" refers to the ASFV of the present invention, which is a live virus capable of replicating in its natural host cells.

[0059] As used in this article, the term "attenuated" refers to a virus whose virulence is impaired or absent in the target receptor, i.e., pigs. The purpose of producing attenuated viruses is to generate viruses that do not produce infection symptoms or produce very mild infection symptoms, yet are still able to elicit an immune response when used as a vaccine, thus providing immunogenic protection when animals are infected with wild-type viruses. The term "wild-type" indicates that the virus is present (at a point) in the field and isolated from a natural host, such as domestic pigs, ticks, or warthogs.

[0060] The level of viral attenuation can be determined by a hemoadsorption assay. As used herein, "hemoadsorption" refers to the phenomenon where ASFV-infected cells adsorb red blood cells (erythrocytes) onto their surface. The degree of ASFV-induced hemoadsorption can be measured using, for example, the hemoadsorption assay described herein. For instance, cells can be transfected with proteins or infected with ASFV, followed by the addition of erythrocytes, and the degree of hemoadsorption can be detected by imaging.

[0061] In one specific embodiment, the attenuation level of the ASFV strain of the present invention is determined by blood adsorption, and the ASFV strain of the present invention has reduced blood adsorption compared to the wild-type Lv17 / WB / Rie1 strain. In one specific embodiment of the ASFV strain of the present invention, the blood adsorption capacity is reduced by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 100% compared to the wild-type Lv17 / WB / Rie1 strain.

[0062] The term "EP402R gene" used in this article refers to the ASFV gene encoding the CD2v protein, a glycoprotein with a relative molecular weight of approximately 105 kDa, responsible for the in vitro blood-adsorption phenotype of ASFV infection of cells. This ASFV protein is a viral homologue (CD2v) of the CD2 protein, the adhesion receptor on the surface of cellular T lymphocytes. Based on sequence data and hydrophilicity, the ASFV CD2v protein resembles a typical (CD2) III transmembrane protein. Typically, the full-length ASFV CD2v protein contains four distinct parts: (i) a hydrophobic leader region on the N-terminal side of the protein, (ii) a hydrophilic extracellular domain containing multiple potential N-linked glycosylation sites, (iii) a hydrophobic fragment of amino acids serving as the transmembrane domain, and (iv) a C-terminal hydrophilic cytoplasmic domain containing numerous incomplete repeats of a typical hexapeptide (PPPKPC).

[0063] The nucleotide sequence of the EP402R gene in Lv17 / WB / Rie1 corresponds to positions 74339 to 75420 of the Lv17 / WB / Rie1 strain genome having the sequence according to SEQ ID NO:1. In a particular embodiment, the EP402R gene comprises the sequence according to SEQ ID NO:3. In another particular embodiment, the EP402R gene comprises a sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:3.

[0064] In the context of two or more amino acid or nucleotide sequences, the terms "identity," "identity," or "percentage of identity" refer to two or more sequences or fragments of said sequences that are identical or have a specified percentage of identical nucleotide residues, without regard to any conserved substitutions as part of sequence identity when comparing and aligning (introducing gaps if necessary) to obtain maximum correspondence. Percentage identity can be measured using sequence comparison software or algorithms or by visual inspection. Various algorithms and software available for obtaining amino acid or nucleotide sequence alignments are known in the art. Publicly available software programs can be used to align sequences. Those skilled in the art can determine appropriate parameters for maximum calibration using specific calibration software. In some embodiments, default parameters of the alignment software are used. In some embodiments, the percentage identity "X" of the first nucleotide sequence to the second nucleotide sequence is calculated as 100 × (Y / Z), where Y is the number of nucleotide residues assessed as identical matches in the alignment of the first and second sequences (e.g., by visual inspection or a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the second sequence is longer than the first sequence, a global alignment that considers both sequences is used, thus requiring a comparison of all letters and gaps in each sequence. In this case, the same formula as above can be used, but with the length of the region where the first and second sequences overlap as the Z-value, the region having a length substantially the same as the first sequence.

[0065] For example, with 95% identity to the reference sequence according to the invention, parameters are set such that the percentage of identity is calculated over the full length of the reference nucleotide sequence, and a homology gap of up to 5% of the total number of nucleotides in the reference sequence is allowed.

[0066] The term “EP153R gene” used in this article refers to the ASFV gene, which downregulates MHC-I expression by weakening the appropriate conformation or presenting it to the latter’s plasma membrane (also known as lectin-like protein EP153R).

[0067] The nucleotide sequence of the EP153R gene corresponds to positions 73793 to 74269 of the genome of the Lv17 / WB / Rie1 strain having the sequence according to SEQ ID NO:1. In a particular embodiment, the EP153R gene comprises the sequence according to SEQ ID NO:4. In another particular embodiment, the EP153R gene comprises a sequence having at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% identity with SEQ ID NO:4.

[0068] As used herein, the term "inactivated" refers to a gene whose sequence, or a sequence related to its expression or regulation, is modified to not express a product or to express a nonfunctional product. In this invention, inactivation is the inactivation of genes EP153R and EP402R. To determine the inactivation of gene EP153R in the ASFV strain of this invention, several methods can be used, namely, hemocyte adsorption induced in ASF virus-infected cells, as previously described, and further detailed in Galindo et al., (2000, Virology 266, 2, 340-351), by measuring the elevated levels of Caspase-3 and the lack of downregulation of MHC-I expression in virus-sensitive cells, as detailed in Hurtado et al., (2004, Virology; 326(1): 160-70). Regarding the determination of the inactivation of the EP402R gene, the inactivation can be determined by determining the adsorption of the inactivated EP402R gene to the blood, since the product of the EP402R gene is the main cause of adsorption to red blood cells, as previously detailed.

[0069] Gene inactivation can be achieved through several methods well known to those skilled in the art, such as random mutagenesis via transposon insertion and UV irradiation, as well as targeted mutagenesis with homologous recombination and CRISP / Cas9 technology (see the Examples section). Both of these techniques allow for gene inactivation by inserting additional nucleotide sequences into the coding sequence of a gene, or conversely, by deleting a segment or all of the gene. In both cases, the result can be non-functional gene or the absence of transcription, thus lacking gene product.

[0070] In a specific embodiment of the ASFV of the present invention, the inactivation of the EP402R and EP153R genes is caused by at least one mutation, such that the genes are not transcribed and / or translated. In one specific embodiment, the at least one mutation is selected from the group consisting of: partial or complete deletion of the genes, insertion of nucleotide sequences, one or more single or multiple nucleotide polymorphisms, replication events, or any combination thereof. In another specific embodiment of the ASFV of the present invention, the EP402R and EP153R genes are deleted and / or interrupted, such that the EP402R and EP153R genes are not transcribed and / or translated.

[0071] In a specific embodiment of the ASFV strain of the present invention, the inactivation of the EP402R gene and / or the EP153R gene is caused by the deletion of at least a portion of the EP402R and / or EP153R genes. In a more preferred embodiment, the deletion of the EP402R and / or EP153R genes is a deletion of at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 200, at least 300, at least 400, at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 base pairs.

[0072] In another specific embodiment of the ASFV strain of the present invention, deletion of the EP402R gene affects the intact EP402R gene. In another specific embodiment of the ASFV strain of the present invention, deletion of the EP153R gene affects the intact EP153R gene.

[0073] In a more specific embodiment of the ASFV strain of the present invention, the inactivation of the EP402R gene and the EP153R gene is caused by a single deletion in the genome of the ASFV Lv17 / WB / Rie1 strain.

[0074] As used herein, the term "interrupted" refers to a mutation in which the open reading frame of the problematic gene is interrupted such that no functional gene product is derived from the open reading frame. The interruption may result in the absence of a product or the presence of two or more smaller products within the open reading frame, wherein these two or more products are ineffective or unable to reconstruct the function of the original product obtained from an uninterrupted open reading frame.

[0075] In one embodiment, the live attenuated ASFV strain of the present invention carries the deletion of both the EP402R and EP153R genes due to a single deletion in the genome of the ASFV Lv17 / WB / Rie1 strain. In another specific embodiment of the ASFV strain of the present invention, the inactivation of the EP402R and / or EP153R genes is caused by a deletion of nucleotides 73812 to 75385 of the Lv17 / WB / Rie1 strain genome having the sequence according to SEQ ID NO:1.

[0076] The inactivation genes of the ASFV strain of the present invention can be replaced by heterologous genes, i.e., genes that are not naturally present in ASFV. Therefore, in a specific embodiment of the ASFV strain of the present invention, the EP402R gene and / or the EP153R gene are replaced by heterologous genes. In another specific embodiment of the ASFV strain of the present invention, it contains at least one or more heterologous genes. In another specific embodiment of the ASFV strain of the present invention, it contains at least two heterologous genes, wherein said heterologous genes are the same or different. In yet another specific embodiment, at least one heterologous gene is a reporter gene.

[0077] The term "reporter gene" refers to a polynucleotide that encodes a molecule that can be easily detected, either directly or through its effect on the host cell (phenotype). Exemplary reporter genes encode enzymes such as the products of the ADE2 or ADE3 genes, β-galactosidase and URA3, luminescent or fluorescent proteins such as green fluorescent protein (GFP) and its variants, antigenic epitopes (e.g., Glu-tags), mRNAs with different sequences, etc.

[0078] In another specific embodiment of the ASFV strain of the present invention, at least one heterologous gene is a fluorescent protein selected from the group consisting of: GFP, blue fluorescent protein (BFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), Venus, mOrange, dTomato, DsRed, red fluorescent protein (RFP), and mCherry.

[0079] In another specific embodiment of the ASFV strain of the present invention, both the EP402R and EP153R genes are replaced by the eGFP (enhanced GFP) gene. For reporter genes to be detected, they must express a product that can be detected when produced, such as a polypeptide or protein. For reporter genes to be expressed, they must be under the control of a promoter. As used herein, the term "promoter" refers to a DNA region upstream of a gene in which a related protein (e.g., RNA polymerase and transcription factor) binds to initiate transcription of that gene.

[0080] In one specific embodiment of the ASFV strain of the present invention, the live attenuated ASFV contains at least one heterologous gene, and said heterologous gene is under the control of a promoter of an ASFV gene. In another specific embodiment of the ASFV strain of the present invention, the attenuated ASFV contains at least one heterologous gene, and said heterologous gene is under the control of a promoter of a late ASFV gene. In one specific embodiment, the reporter gene is under the control of a promoter of an ASFV gene. In another specific embodiment, the reporter gene is under the control of a promoter of a late ASFV gene. The term "late ASFV gene" herein refers to a gene expressed at a later stage of viral gene expression during cell infection. Promoter sequences are typically short and A+T rich, and they are recognized by virus-encoded transcription factors that are specific to different stages of viral gene expression; early, intermediate, and late gene types have been defined. Using enzymes and other factors packaged in viral particles, these genes are expressed in a cascade manner, with early gene expression occurring in the partially uncoated core. In one specific embodiment of the ASFV strain of the present invention, the promoter is the promoter of the p72 gene. In another specific embodiment of the ASFV strain of the present invention, the promoter of the p72 gene contains SEQ ID NO:5.

[0081] As used in this article, the term "p72 gene," also known as the "B646L gene," refers to the gene that encodes the protein p72 (the major capsid protein), which is the most important structural component of the virion and constitutes approximately ~31%-33% of the total mass of the virion, making it one of the main antigens detected in infected pigs.

[0082] Apart from the modifications of the ASFV strains of the present invention mentioned in Table 1, the ASFV strains of the present invention do not have other mutations and / or modifications that alter gene function, particularly the functions of genes DP148R, 9GL / B119L, MGF_360-12L, MGF_360-13L, and MGF_360-14L. In a specific embodiment of the ASFV strains of the present invention, the starting strain has the functional form of one or more of the genes DP148R, 9GL / B119L, MGF_360-12L, MGF_360-13L, and MGF_360-14L.

[0083] As used herein, the term "starting strain" refers to the ASFV strain Lv17 / WB / Rie1, wherein no other mutations were introduced to obtain the ASFV strain of the present invention in which the genes EP420R and EP153R are inactivated.

[0084] As used in this article, the term "DP148R" refers to a gene of unknown function located between positions 183187 and 184012 of the genome of the ASFV Georgia 2007 / 1 strain (GenBank accession number NC044959, version 2, December 20, 2020). It is known that deletion of this gene does not affect viral replication, but it does affect viral infection.

[0085] As used herein, the term "9GL / B119L" refers to the gene encoding a FAD-linked thiol oxidase located between positions 95936 and 96295 of the genome of the ASFV Georgia2007 / 1 strain. It is known that deletion of this gene does not affect virion maturation, viral growth in macrophages, or viral virulence in pigs.

[0086] As used herein, the terms “MGF_360-12L,” “MGF_360-13L,” and “MGF_360-14L” refer to genes present in polygenic family 360, whose functions can affect the host’s immune response mechanisms and are host-specific. The genes MGF_360-12L, MGF_360-13L, and MGF_360-14L are located between positions 30355 and 33887 of the ASFV Georgia 2007 / 1 strain genome.

[0087] Use of recombinant ASFV strains in immunogenic compositions and vaccines

[0088] The recombinant ASFV strain of the present invention can be used to induce immunogenicity in pigs via immunogenic compositions or vaccine compositions. Therefore, another aspect of the invention relates to immunogenic compositions or vaccine compositions, wherein, from this point onward, the immunogenic compositions of the present invention comprise the attenuated ASFV strain of the present invention and a pharmaceutically suitable carrier or excipient.

[0089] In the context of this invention, the term "immunogenic composition" refers to a composition that can elicit a cellular and / or humoral immune response in mammals but does not necessarily confer complete or partial immune protection against African swine fever. However, to avoid confusion, such immunogenic compositions can confer complete or partial protection against African swine fever in mammals, and this is preferred. Conversely, in the context of this invention, a "vaccine" does indeed confer complete or partial (but at least partial) immune protection against African swine fever in mammals.

[0090] As used herein, the terms "protection against African swine fever," "protective immunity," "functional immunity," and similar phrases refer to the response against African swine fever (virus) induced by administration of the recombinant ASFV of the present invention, resulting in fewer harmful effects than expected in non-immunized mammals already exposed to African swine fever (virus). That is, the severity of the harmful effects of ASFV infection is reduced in vaccinated mammals. In vaccinated mammals, infection can be reduced, mitigated, or possibly completely prevented. Where complete prevention of infection is intended herein, it is specifically stated. Where complete prevention is not stated, the term includes partial prevention.

[0091] The term "enhanced protection" means, but is not limited to, a statistically significant reduction in one or more clinical symptoms associated with wild-type ASFV infection in the vaccinated mammalian group compared to an unvaccinated mammalian control group. As used herein, the term "statistically significant reduction in clinical symptoms" means, but is not limited to, an incidence of at least one clinical symptom in the vaccinated mammalian group that is at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% lower than that in the unvaccinated control group after challenge with wild-type ASFV. In the context of this invention, the term "durable protection" should refer to an improvement lasting at least 3 weeks, at least 3 months, at least 6 months, or at least 1 year. In the case of livestock, it is most preferred that the durable protection lasts until the average age of the animal for meat sale.

[0092] In the context of this invention, the term "immune response" or "immunological response" refers to the generation of a cell- and / or antibody-mediated immune response to the recombinant ASFV of this invention or the immunogenic composition of this invention. Typically, an immune or immunological response includes one or more of the following effects: the generation or activation of antibodies, B cells, helper T cells, suppressor T cells, and / or cytotoxic T cells, specifically targeting one or more antigens contained in the recombinant ASFV strain of this invention. Preferably, the host will exhibit a therapeutic or protective immune (memory) response, resulting in enhanced resistance to new infections and / or reduced clinical severity of disease. Such protection can be demonstrated by a reduction in the number of symptoms, the severity of symptoms, or the absence of one or more symptoms associated with wild-type ASFV infection, a delay in the onset of viremia, a reduction in viral persistence, a reduction in total viral load, and / or a reduction in viral shedding.

[0093] The immunogenic compositions of the present invention further comprise pharmaceutically acceptable carriers or excipients. In the context of this invention, the term "pharmaceutically acceptable carrier" includes any solvent, dispersion medium, coating, adjuvant, stabilizer, diluent, preservative, antimicrobial and antifungal agent, isotonic agent, etc. In one specific embodiment, the immunogenic compositions of the present invention comprise a stabilizer for lyophilizing or storing viral suspensions in liquid form. In another specific embodiment, the immunogenic compositions of the present invention contain an adjuvant. As used herein, "adjuvant" may include aluminum hydroxide and aluminum phosphate, saponins (e.g., QuilA, QS-21 (Cambridge Biotech Inc., Cambridge MA), GPI-0100 (Galenica Pharmaceuticals, Inc., Birmingham, AL)), water-in-oil emulsions, oil-in-water emulsions, and water-in-oil-in-water emulsions. The emulsion may be based, in particular, on light liquid paraffin oil (European Pharmacopoeia type); isoprene oils such as squalane or squalene; α-tocopheryl acetate; oils derived from the oligomerization of olefins, particularly isobutylene or decene; esters of acids or alcohols containing straight-chain alkyl groups, more specifically vegetable oils, ethyl oleate, propylene glycol di-(octanoate / decanoate), glyceryl tri-(octanoate / decanoate), or propylene glycol dioleate; esters of branched fatty acids or alcohols, particularly isostearates. The oil is used in combination with an emulsifier to form the emulsion. The emulsifier is preferably a nonionic surfactant, particularly sorbitol esters, mannitol esters (e.g., anhydromannitol oleate), glycol esters, polyglycerol esters, propylene glycol esters, and oleates, isostearates, castor oil esters, or hydroxystearates, optionally ethoxylated, and polyoxypropylene-polyoxyethylene copolymer blocks, particularly Pluronic products, especially L 121. Another example of an adjuvant is a compound selected from polymers of acrylic acid or methacrylic acid, as well as copolymers of maleic anhydride and alkenyl derivatives. Advantageous adjuvant compounds are cross-linked polymers of acrylic acid or methacrylic acid, particularly polymers of acrylic acid or methacrylic acid cross-linked with polyolefin ethers of sugars or polyols. These compounds are known by the term carbomer (Phameuropa Vol. 8, No. 2, June 1996). Adjuvants can also be acrylic polymers cross-linked with polyhydroxylated compounds having at least three hydroxyl groups, preferably no more than eight hydroxyl groups, wherein the hydrogen atoms of the at least three hydroxyl groups are replaced by unsaturated aliphatic groups having at least two carbon atoms. Preferred groups are those containing 2-4 carbon atoms, such as vinyl, allyl, and other olefinically unsaturated groups. The unsaturated group itself may contain other substituents, such as methyl. Products sold under the name Carbopol (BF Goodrich, Ohio, USA) are particularly suitable. They are crosslinked with allyl sucrose or allyl pentaerythritol, among which Carbopol 974P, 934P and 971P can be mentioned.The preferred choice is Cabopol 971P. In copolymers of maleic anhydride and alkenyl derivatives, the preferred choice is copolymer EMA (Monsanto), which is a copolymer of maleic anhydride and ethylene. Other suitable adjuvants include, but are not limited to, the RIBI adjuvant system (Ribi Inc.), block copolymers (CytRx, Atlanta GA), SAF-M (Chiron, Emeryville CA), monophospholipid A, Avridine lipid amine adjuvant, heat-sensitive enterotoxins from *E. coli* (recombinant or other), cholera toxin, IMS1314 or muramyl dipeptide, or naturally occurring or recombinant cytokines or their analogues, or stimulants of endogenous cytokine release, etc.

[0094] In the context of this invention, the term "diluent" may include water, saline solution, glucose, ethanol, glycerol, etc. Isotonic agents may include sodium chloride, dextran, mannitol, sorbitol, and lactose, etc. Stabilizers include albumin and alkali metal salts of ethylenediaminetetraacetic acid, etc.

[0095] In one specific embodiment of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for intranasal, oral, subcutaneous, intradermal, or intramuscular administration, preferably intramuscular administration. In a more specific embodiment of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for oral administration, preferably via a beta-formula. In an even more specific embodiment of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for intradermal administration.

[0096] In another specific embodiment of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for administration to pigs via intramuscular vaccination, intradermal vaccination, or oral vaccination (preferably via a dermograph).

[0097] In another specific embodiment of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for administration to pigs via intramuscular vaccination, intradermal vaccination, or oral vaccination, preferably via a dermographizing agent. In one or even more specific embodiments of the immunogenic composition of the present invention, the immunogenic composition of the present invention is formulated for administration to wild boars via oral vaccination, preferably via a dermographizing agent.

[0098] The ASFV strains of the present invention can be used for the prevention or treatment of diseases directly caused by ASFV. Therefore, another aspect of the invention relates to the ASFV strains of the present invention or the immunogenic compositions of the present invention for the prevention or treatment of diseases caused by ASFV infection, and from this point forward, the therapeutic use of the invention.

[0099] As used in this article, the term “prevention” refers to the ability to prevent, minimize, or prevent the onset or development of a disease or condition before it occurs.

[0100] As used herein, the terms “treat,” “treatment,” “treatment,” or “amelioration” refer to therapeutic treatment aimed at reversing, reducing, inhibiting, delaying, or stopping the progression or severity of a symptom associated with a disease or condition. The term “treatment” includes the reduction or alleviation of at least one side effect or symptom of a disease or condition (e.g., an infection). Treatment is generally “effective” when one or more symptoms or clinical markers are reduced. Alternatively, treatment is “effective” if disease progression is delayed or stopped. That is, “treatment” includes not only improvement of symptoms or markers but also interruption of at least one symptom indicating the expected progression or worsening of symptoms without treatment. Beneficial or desired clinical outcomes, whether detectable or not, include the reduction of one or more symptoms, a reduction in the severity of the disease, or a stable (i.e., non-worsening) state of the disease. These include, but are not limited to, delayed or slowed progression, improvement or remission of the disease state, and remission (partial or complete). The term “treatment” for a disease also includes the relief of symptoms or side effects of the disease (including symptomatic treatment).

[0101] In one particular embodiment of the therapeutic use of the invention, recombinant ASFV is used to treat ASFV infection in pigs, wild boars, or any other pigs that may be affected by ASF. As used herein, the term "swine" refers to a domestic pig (domesticated pig), also known as a castrated pig or domestic pig when distinguished from other members of the genus *Sus*. Pigs are omnivorous, domesticated, occasional, hoofed mammals.

[0102] As used in this article, the term "wild boar" refers to a species of the genus *Sus scrofa*, also known as wild boar, common wild boar, Eurasian wild boar, or simply wild boar. Wild boars are native to much of Eurasia and North Africa and have been introduced to the Americas and Oceania.

[0103] In one specific embodiment of the therapeutic use of the present invention, the ASFV strain of the present invention in the immunogenic composition of the present invention is formulated for intranasal, oral, subcutaneous, intradermal, or intramuscular administration, preferably intramuscular administration. In a more specific embodiment of the therapeutic use of the present invention, the ASFV strain of the present invention in the immunogenic composition of the present invention is formulated for oral administration, preferably via a topical dermatological agent. In an even more specific embodiment of the therapeutic use of the present invention, the ASFV strain of the present invention in the immunogenic composition of the present invention is formulated for intradermal administration.

[0104] In another therapeutic use of the invention, the ASFV strain of the invention in the immunogenic composition of the invention is formulated for administration to pigs via intramuscular vaccination, intradermal vaccination or oral vaccination (preferably via dermograph).

[0105] In another specific embodiment of the therapeutic use of the invention, the ASFV strain of the invention comprising the immunogenic composition of the invention is formulated for administration to wild boars via intramuscular, intradermal, or oral vaccination, preferably via a dermograph. In one or even more specific embodiments of the therapeutic use of the invention, the ASFV strain of the invention comprising the immunogenic composition of the invention is formulated for administration to wild boars via oral vaccination, preferably via a dermograph. Those skilled in the art will recognize that the ASFV of the invention or the immunogenic composition of the invention can also be administered in one, two, or more doses and via other routes of administration. For example, these other routes include intradermal, intravenous, intravascular, intraarterial, intraperitoneal, intrathecal, intracardiac, intralobular, intramedullary, intrapulmonary, and intravaginal administration. Depending on the desired duration and effectiveness of treatment, the ASFV strain of the invention or the immunogenic composition of the invention can be administered once or multiple times at different doses, or intermittently, for example, daily, for several days, several weeks, or several months.

[0106] In one specific embodiment of the use of the invention, the ASFV strain of the invention or the immunogenic composition of the invention is administered at a therapeutically effective dose. As used herein, "therapeutically effective dose" means an amount of active agent (i.e., ingredient, such as the ASFV of the invention) high enough to deliver the desired benefit, i.e., treatment or prevention of disease, but low enough to avoid serious side effects within the scope of medical / veterinary judgment. The specific dose administered according to the invention will, of course, be determined by the specific circumstances surrounding the case, such as the route of administration, animal age, and similar considerations. In one specific embodiment of the use of the invention, the therapeutically effective dose is about 10 half-maximal tissue culture infection doses (TCID). 50 ) to about 10 5 TCID 50 .

[0107] In one specific embodiment of the use of the invention, the therapeutically effective dose in pigs is approximately 50 half-maximum tissue culture infection doses (TCID50). 50 ) to approximately 200 TCID 50 Preferred 100 TCID 50 In another specific embodiment of the invention, the therapeutically effective dose of wild boar is about 10. 2 TCID 50 To about 10 4 TCID 50In a more specific embodiment of the use of the invention, the therapeutically effective dose is about 50 TCID. 50 Approximately 200 TCID 50 Furthermore, the effective therapeutic dose in wild boar is approximately 10. 2 TCID 50 To about 10 4 TCID 50 .

[0108] In the context of this invention, "half-maximal tissue culture infectious dose" or its acronym "TCID" refers to a measure of the infectious viral titer. It is an endpoint dilution assay that quantifies the amount of virus required to kill 50% of the infected host or produce a cytopathic effect in 50% inoculated tissue culture cells. This assay is likely more common in clinical research applications, where the lethal dose of virus must be determined or if the virus does not form plaques. When used for tissue culture, host cells are plated and serial dilutions of the virus are added. After incubation, the percentage of cell death (i.e., infected cells) at each viral dilution is manually observed and recorded, and the results are used to mathematically calculate the TCID. 50 Result. Commonly used to calculate TCID. 50 The two methods are the Spearman-Karber method and the Reed-Muench method.

[0109] Those skilled in the art will understand that therapeutic effects can be achieved with several types of dosages, with multiple doses administered over periods ranging from one day to several days, weeks, months, or a year. The effects are preferably obtained by administering a single dose of the recombinant ASFV strain of the present invention. Therefore, in one specific embodiment of the use of the invention, recombinant ASFV is administered in 1, 2, 3, 4, or 5 doses, preferably one dose. In another specific embodiment of the use of the invention, recombinant ASFV is administered in a single dose.

[0110] Methods and reagents for obtaining the ASFV of the present invention

[0111] Where applicable, all prior aspects and their embodiments are also included in the following aspects and their embodiments. The definitions of all foregoing terms and expressions also apply to the present aspects and embodiments, unless otherwise specifically stated.

[0112] One aspect of the invention relates to a polynucleotide comprising first, second, and third regions, wherein the first region comprises an expression cassette containing an ASFV heterologous gene, wherein the first region is adjacent to the second and third regions, and wherein the second and third regions are regions of the ASFV Lv17 / WB / Rie1 strain genome, which are naturally adjacent to regions of the ASFV genome containing the EP402R and EP153R genes.

[0113] As used herein, the term “expression cassette” refers to a different component of DNA that contains genes and regulatory sequences, such as promoters, which, when present in the desired host cell, allow the expression cassette to produce RNA and proteins.

[0114] In a specific embodiment of the polynucleotide of the present invention, the heterologous gene encodes a fluorescent protein. In another specific embodiment of the polynucleotide of the present invention, the heterologous gene is a fluorescent protein selected from the group consisting of: GFP, BFP, CFP, YFP, Venus, mOrange, dTomato, DsRed, RFP, mCherry, and any variant thereof. In a more specific embodiment of the polynucleotide of the present invention, the heterologous gene is eGFP.

[0115] In another specific embodiment of the polynucleotide of the present invention, the heterologous gene preferably comprises the ASFV p72 promoter according to the sequence of SEQ ID NO:5, under the control of a constitutive promoter.

[0116] The statement in the polynucleotide of the present invention that "the second and third regions are regions of the ASFV Lv17 / WB / Rie1 strain genome, naturally flanked by regions of the ASFV genome containing the EP402R and EP153R genes" refers to the nucleotide sequence preceding position 73793 (second region) and following position 75420 (third region) of the Lv17 / WB / Rie1 strain genome according to the sequence of SEQ ID NO:1. In a more specific embodiment of the first polynucleotide of the present invention, the second region comprises a nucleotide sequence or fragment thereof between positions 71793 and 73793 of the Lv17 / WB / Rie1 strain genome according to the sequence of SEQ ID NO:1. In another specific embodiment of the polynucleotide of the present invention, the third region comprises a nucleotide sequence or fragment thereof between positions 75420 and 77420 of the Lv17 / WB / Rie1 strain genome according to the sequence of SEQ ID NO:1. In another specific embodiment of the polynucleotide of the present invention, the second and third regions are composed of about 2000 bp, about 1900 bp, about 1800 bp, about 1700 bp, about 1600 bp, about 1500 bp, about 1400 bp, about 1300 bp, about 1200 bp, about 1100 bp, about 1000 bp, about 900 bp, about 800 bp, about 700 bp, about 600 bp, or about 500 bp, preferably 1000 bp.

[0117] The polynucleotides of the present invention can be contained in a vector. Therefore, another aspect of the present invention relates to a vector containing the polynucleotides of the present invention, and from this point forward, the vectors of the present invention.

[0118] As used herein, the term "vector" refers to a means by which polynucleotides or DNA molecules can be manipulated or introduced into cells. A vector can be a linear or circular polynucleotide, or it can be a larger polynucleotide or any other type of construct, such as the DNA or RNA of a viral genome, a virion, or any other biological construct that allows DNA manipulation or its introduction into cells. It should be understood that the terms "recombinant vector" and "recombinant system" are used interchangeably with the term vector. Those skilled in the art will understand that there is no limitation on the type of vector that can be used, as the vector can be a cloning vector suitable for propagation and obtaining polynucleotides or suitable gene constructs or expression vectors in different heterologous organisms suitable for purifying the polynucleotides of the present invention. Therefore, suitable vectors according to the present invention include expression vectors in prokaryotes, such as pET (e.g., pET14b), pUC18, pUC19, Bluescript and its derivatives, mp18, mp19, pBR322, pMB9, CoIEl, pCRl, RP4; bacteriophages and shuttle vectors, such as pSA3 and pAT28; expression vectors in yeast, such as 2μm plasmids, integrative plasmids, YEP vectors, centromere plasmids, etc.; expression vectors in insect cells, such as pAC series and pVL series vectors; expression vectors in plants, such as pIBI, pEarleyGate, pAVA, pCAMBIA, pGSA, pGWB, pMDC, pMY, pORE series vectors, etc.; and viral vectors (adenovirus, viruses associated with adenovirus and retroviruses and lentiviruses), and non-viral vectors, such as pSilencer. 4.1-CMV(Ambion), pcDNA3, pcDNA3.1 / hygpHCMV / Zeo, pCR3.1, pEF1 / His, pIND / GS, pRc / HCMV2, pSV 40 / Zeo2, pTRACER-HCMV, pUB6 / V5-His, pVAXl, pZeoSV2, pCI, pSVL and pKSV-10, pBPV-1, pML2d and pTDTl.

[0119] The vector of the present invention can be used to transform, transfect, or infect cells that can be transformed, transfected, or infected by the vector. The cells can be prokaryotic or eukaryotic cells. The vector can be obtained by conventional methods known to those skilled in the art (Sambrook et al., 2001, “Molecular cloning, to Laboratory Manual”, 2nd ed., ColdSpring Harbor Laboratory Press, NY Vol 1-3a).

[0120] Another aspect of the invention relates to a host cell comprising the polynucleotide of the invention or the vector of the invention, which, from this point onward, is the host cell of the invention.

[0121] The host cells of the present invention can be obtained by transforming, transfecting, or infecting cells using conventional methods known to those skilled in the art (Sambrook et al., 2001, ibid.). In a particular embodiment, the host cells are animal cells transfected or infected with a suitable vector.

[0122] Suitable host cells for containing the first polynucleotide of the invention or the vector of the invention include, but are not limited to, mammalian, plant, insect, fungal, and bacterial cells. Bacterial cells include, but are not limited to, Gram-positive bacterial cells, such as *Bacillus*, *Streptomyces*, *Listeria*, and *Staphylococcus*, and Gram-negative bacterial cells, such as *Escherichia*, *Salmonella*, and *Pseudomonas*. Fungal cells preferably include yeast cells, such as *Saccharomyces cerevisiae*, *Pichia pastoris*, and *Hansenula polymorpha*. Insect cells include, but are not limited to, fruit fly and Sf9 cells. Plant cells particularly include cells of crop plants, such as cereal plants, medicinal plants, ornamental plants, or bulbous plants. Suitable mammalian cells in this invention include epithelial cell lines (human, sheep, pig, etc.), osteosarcoma cell lines (human, etc.), neuroblastoma cell lines (human, etc.), epithelial carcinoma (human, etc.), glial cells (mouse, etc.), hepatocyte cell lines (from monkey, etc.), CHO (Chinese hamster ovary) cells, COS cells, BHK cells, HeLa cells, 911, AT1080, A549, 293 or PER.C6, NTERA-2 human ECC cells, mESC line D3 cells, human embryonic stem cells such as HS293, BGV01, SHEF1, SHEF2, HS181, NIH3T3 cells, 293T, REH and MCF-7 and hMSC cells.

[0123] The ASFV strain of the present invention can be obtained by several methods known to those skilled in the art, such as CRISPR / Cas, TALEN, and zinc finger nucleases.

[0124] Another aspect of the invention relates to a method for producing recombinant ASFV according to the invention, wherein the method of the invention, beginning herein, comprises:

[0125] (i) Modifying target cells

[0126] -Introducing the polynucleotide of the present invention,

[0127] - Infect cells with Lv17 / WB / Rie1 strain

[0128] - An introduction device capable of generating double-strand DNA breaks in or near the genome of the attenuated ASFV strain within or near the region containing the EP402R and EP153R genes.

[0129] (ii) Maintaining target cells under conditions sufficient to induce double-strand DNA breaks in the ASFV genome and allow homologous recombination between the ASFV genome containing DNA breaks and the second and third regions of the polynucleotide, thereby causing the first region within the polynucleotide introduced in step (i) to replace the regions encoding the EP402R and EP153R genes, and

[0130] (iii) Recover recombinant ASFV from the supernatant and / or from the whole cell extract, and select ASFV virions containing the reporter gene.

[0131] Step (i)

[0132] Step (i) of the method of the present invention refers to the process of introducing all components required to produce an ASFV viral strain in which the EP402R and EP153R genes are inactivated into target cells. Target cells are cells naturally infected with ASFV. In one specific embodiment of the method of the present invention, the target cells in step (i) are mammalian cells, such as macrophages, COS cells, BHK cells, helA cells, 911, AT1080, A549, 293, or PER.C6, NTERA-2 human ECC cells. In a more specific embodiment, the target cells are macrophages.

[0133] Polynucleotides can be introduced into target cells using several methods well known to those skilled in the art, such as conventional methods known to them (Sambrook et al., 2001, ibid.), cell transformation, transfection, or cell infection. In one specific embodiment of the method of the present invention, the introduction of the polypeptide of the present invention in step (i) is performed by transfection. In another specific embodiment of the method of the present invention, the expression cassette forming part of the first region contains a heterologous gene encoding a fluorescent protein. In a more specific embodiment, the heterologous gene is under the control of a constitutive promoter.

[0134] The statement in step (i) of the method of the present invention, "meaning capable of generating double-strand DNA breaks in or near the region containing the EP402R and EP153R genes in the genome of the attenuated ASFV strain," refers to a technique that allows the cleavage of the bonds between adjacent nucleotides in the DNA double strand. One such method for generating double-strand DNA breaks is CRISPR / Cas9 technology. In a specific embodiment of the method of the present invention, the means by which double-strand breaks are generated in or near the region encoding the EP402R and EP153R genes in the genome of the ASFV strain includes a CRISPR / Cas system.

[0135] As used herein, the term "CRISPR / Cas9 system" refers to two types of clustered, regularly spaced short palindromic repeat (CRISPR) systems that form the adaptive immune system in bacteria and have been modified for genome engineering. The engineered CRISPR system contains two components: a guide RNA (gRNA or sgRNA) and a CRISPR-associated endonuclease (Cas protein). The gRNA is a short synthetic RNA consisting of a scaffold sequence necessary for Cas binding and a user-defined ~20 nucleotide spacer region that defines the genomic target to be modified. Therefore, the genomic target of the Cas protein can be altered simply by changing the target sequence present in the gRNA.

[0136] CRISPR was initially used to knock out target genes in various cell types and organisms, but modifications to various Cas enzymes have expanded CRISPR to selectively activate / repress target genes, purify specific regions of DNA, image DNA in living cells, and precisely edit DNA and RNA. Furthermore, the ease with which gRNA is generated makes CRISPR one of the most scalable genome editing technologies. This advantage makes CRISPR perfect for whole-genome screening. Fully functional CRISPR / Cas enzymes introduce double-strand breaks (DSBs) at specific locations based on gRNA-defined target sequences. DSBs are preferentially repaired in cells via non-homologous end joining (NHEJ), a mechanism that often results in insertions or deletions (indels) in DNA. Indene often leads to frameshifts, resulting in the loss of functional alleles.

[0137] To introduce specific genomic changes, researchers used ssDNA or dsDNA repair templates, which have 1) homology with the DNA flanking the DSB and 2) specific editing near the gRNAPAM site.

[0138] Step (ii)

[0139] Step (ii) of the method of the present invention involves maintaining target cells at ideal temperature, cell number, and carbon dioxide (CO2) concentration, such that the double-stranded system can function properly and generate double strands at the desired locations. In a preferred embodiment of the method of the present invention, the cells in step (ii) are maintained in a culture medium containing 2 mL of glutamine, non-essential amino acids, antibiotics such as gentamicin, and supplements such as fetal bovine serum.

[0140] In another specific embodiment of the method of the present invention, after transfection, the target cells are maintained at about 32°C to 40°C, preferably 37°C, and saturated with water vapor in an atmosphere of about 3% to about 10% CO2, preferably 5% CO2, for about 12 to 36 hours, preferably 24 hours.

[0141] Step (iii)

[0142] Step (iii) of the method of the present invention relates to a method for obtaining the recombinant ASFV of the present invention, i.e., a strain in which the EP402R gene is inactivated. The selection of the virion utilizes a first heterologous gene present in the ASFV of the present invention. In a particular embodiment of the method of the present invention, the heterologous gene forming part of the first polynucleotide of the present invention is a reporter gene.

[0143] Methods for recovering recombinant strains and selecting virions are well known in the art and are illustrated by examples in the Examples section of this specification.

[0144] ***

[0145] The present invention will be described through the following embodiments, which are considered to be merely illustrative and not to limit the scope of the invention.

[0146] Example

[0147] Example 1: Generation of Lv17 / WB / Rie1-ΔCD ASFV mutant

[0148] To evaluate whether the wild-type Lv17 / WB / Rie1 strain could revert to the HAD phenotype, the in vitro stability of the strain was analyzed by subsequently passaged in primary cell cultures using porcine blood mononuclear cells (PBM) targeting ASFV. Through successive passages of Lv17 / WB / Rie1 in PBM, atypical and unstable HAD was observed to occur randomly between passages 6 and 9. Deep sequencing (using an amplicon-based NGS strategy) of the EP402R and EP153R genes, both involved in the HAD phenomenon, was performed to identify potential changes in sequences that might be associated with the instability of the non-HAD phenotype observed when Lv17 / WB / Rie1 was passaged in cell cultures. No findings were found that could explain this behavior. All sequenced passages (including HAD) showed an adenosine deletion at position 393 of the EP402R gene identified in the original isolate. The non-HAD phenotype and the recovered HAD virus were simultaneously tested for virulence in pigs. HAD isolates exhibited high virulence and high infectivity; 10 TCID 50 Infections at doses that are partially lethal and cause acute or subacute illness are less than 10 TCID. 50 Non-HAD doses cause non-lethal, subclinical, or chronic disease, as previously described in D1.

[0149] Based on these findings, the Lv17 / WB / Rie1-ACD ASFV mutant was generated by deleting the EP153R and EP402R genes (73812-75385 nts; all numbers in this example correspond to the Lv17 / WB / Rie1 sequence) in Lv17 / WB / Rie1 and replacing them with eGFP (enhanced green fluorescent protein gene) under the control of the ASFV p72 promoter. This virus expresses the fluorescent eGFP reporter gene in infected cells but does not express the C-type lectin-like and CD2-like (CD2v) protein products of the deleted viral genes (EP153R and EP402R, respectively).

[0150] To generate Lv17 / WB / Rie1-ΔCD mutant virus, CRISPR / Cas9-mediated homologous recombination was used, as described in the literature (Borca et al., 2018, Sci Rep. Feb 16; 8(1):3154; Hübner et al., 2018, Sci Rep. Jan 23; 8(1):1449).

[0151] First, we constructed the recombinant transfer vector plasmid (pDel-cd2v-eGFP) and two gRNA expression vector plasmids (pXCD2v / 1 and pXCD2v / 2).

[0152] Linearized pUC19 vector was used as the backbone for pDel-cd2v-eGFP (Thermo Fischer Scientific, Waltham MA, USA). The recombination cassette contains a 969 bp (72843-73811) left recombination arm upstream of the target ORF, followed by the p72 promoter (TATTTAATAAAAACAATAAATTATTTTTATAACATTATATA) (SEQ ID NO:5), the GFP gene, and a 989 bp (75386-76374) long right recombination arm downstream of the target ORF. GeneArt was used to... TM The Seamless PLUS Cloning and Assembly Kit (Thermo Fischer Scientific, Waltham MA, USA) assembles pDel-cd2v-eGFP from three overlapping PCR fragments (Table 2) and a linearized pUC19 vector.

[0153] Table 2: PCR fragments

[0154]

[0155] One upstream and one downstream double-stranded protospacer oligonucleotide, gRNAins1 and gRNAins2, were cloned into the pX330-DNLS1_2-NeoR plasmid digested with BbsI, resulting in the pXCD2v / 1 and pXCD2v / 2 vectors, respectively, thus producing two gRNA plasmids (Hübner et al. 2018, Sci Rep. Jan 23; 8(1):1449).

[0156] After plasmid generation, the following infection / transfection protocol was followed to generate and isolate mutants:

[0157] 1. Preparing Pog macrophages at 5 × 10⁻⁶ 6 The wells were seeded at a density that allowed them to adhere to the walls overnight.

[0158] 2. Inoculate each well with 2 ml of Lv17 / WB / Rie1ASFV (MOI 1) in RPMI and incubate at 37°C and 5% CO2 for 1 hour.

[0159] 3. Carefully mix 1.5 μg of donor plasmid (pDel-cd2v-eGFP) and 0.75–0.75 μg of gRNA plasmid (pXCD2v / 1 and pXCD2v / 2) into 150 μl of serum and antibiotic-free RPMI in an Eppendorf tube. Then, add 10 μl of Fugene HD transfection reagent (Promega Corporation, Madison, Wisconsin, USA) and mix immediately. Incubate at room temperature for 10 minutes.

[0160] 4. Add the above mixture dropwise to the seeded macrophages. Incubate the cells at 37°C in 5% CO2 for 24 hours.

[0161] 5. After determining the percentage of fluorescent cells, freeze the plate (including cells and supernatant) to -70°C and store it until ready for use.

[0162] 6. After thawing, remove cell debris by centrifugation at 5000x g for 10 minutes.

[0163] 7. Serially dilute the supernatant 10-fold in 100 μl of complete RPMI and plate it onto plates containing macrophages (102). 4 In a 96-well plate (with holes).

[0164] 8. Monitor the presence of eGFP-expressing cells in the plate under a fluorescence microscope every 24 hours for 3 days. Isolate fluorescent cells using a pipette and collect them in RPMI.

[0165] 9. Repeat steps 7 and 8 5 times until the resulting Lv17 / WB / Rie1-ΔCD virus stock solution is considered homogeneous and free of parent virus.

[0166] 10. The homogeneity of the Lv17 / WB / Rie1-ΔCD virus stock solution was confirmed by NGS sequencing as described in the literature (Olasz et al. 2019, Viruses Dec 6; 11(12):1129).

[0167] Example 2: In vivo testing of live African swine fever (ASF) virus vaccine strain Lv17 / WB / Rie1-ΔCD in wild boars Internal safety studies; and efficacy studies against the challenge of ARMENIA07 (ARM07) toxic ASF virus.

[0168] 2.1. Research Design

[0169] Twenty-five 3-4 month old wild boar piglets, lacking ASFV and antibodies, were used in this study. Four groups were established: Groups 1 and 2 evaluated the mutant vaccine strain, while Groups 3 and 4 evaluated the parent virus.

[0170] In group 1, 6 animals were orally injected with 10 mg of the drug using a single-dose model. 4 TCID 50 The dose of Lv17 / WB / Rie1-ΔCD mutant was administered via the IM pathway with 10 HAD at 30 days post-inoculation (dpv). 50 The Armenia / 07 (Arm07) challenge. The experimental period lasted 62 days.

[0171] Group 2 (6 animals) used 10 2 TCID 50 Lv17 / WB / Rie1-ΔCD was administered orally and administered at 30 dpv with 10 4 TCID 50 Re-vaccination was performed, followed by a challenge with Arm07 via the IM route at 44 dpv. The experimental period lasted 62 days.

[0172] Group 3 (7 animals) and Group 4 (6 animals) were respectively treated with the parent strain Lv17 / WB / Rie1 at 10 3 TCID 50 and 10 4 TCID 50 Animals were orally immunized at the specified dose and then re-immunized at 18 dpv. Animals in groups 3 and 4 were challenged with Arm07 at 42 dpv via the IM route. The experimental period lasted 74 days.

[0173] An overview of the grouping and processing is shown in Table 3.

[0174] Table 3: Overview of experimental groups, time periods, and treatments

[0175]

[0176] Serum samples were tested for specific antibodies against ASFV-p72 using a commercial ELISA assay, following the manufacturer's description (INGEZIMPPA Compac K3, Ingenasa, Madrid, Spain). DNA was extracted from EDTA blood samples using a high-purity PCR template preparation kit (Roche DiagnostiCS GmbH, Roche Applied Science, Mannheim, Germany). The ASF virus genome obtained from blood (viremia) was amplified using undiluted extracted DNA for each sample via a Universal Probe Library (UPL) real-time PCR protocol (Fernández-Pinero et al., 2012). Results were expressed as Cq values ​​(equivalent to the cycle threshold, CT), with a positive result considered when Cq < 40.0. Clinical signs were recorded daily, and a quantitative clinical score was generated by summing the values ​​of nine clinical signs recorded daily (Cadenas-Fernández et al., 2020).

[0177] 2.2. Materials and Methods

[0178] 2.2.1. Test products and challenge materials

[0179] 2.2.1.1. Live ASFV vaccine strain

[0180] Name of strain 1: Lv17 / WB / Rie1-ΔCD

[0181] Batch number or reference: Obtained from Dr. Z. Zadori, Veterinary Medical Research Institute (VMRI), Budapest, Hungary

[0182] Titer: 4.8 x 10 7 TCID 50 / ml

[0183] Storage conditions: -80℃

[0184] Name of strain 2: Lv17 / WB / Rie1

[0185] Titer: 2.82 x 10 6 TCID 50 / ml

[0186] Storage conditions: -80℃

[0187] 2.2.2. Preparation of inoculum

[0188] Dosage format: Each 1 ml PBS dose contains 10 2 / 10 3 / 10 4 TCID 50 The computational load.

[0189] Preparation: The vaccine strain was diluted in PBS shortly before administration and kept at room temperature until use. The vaccine was administered at room temperature.

[0190] 2.2.3. ASFV Challenge Strain

[0191] Name: Armenia / 07 (Arm07)

[0192] Batch number: Arm07, batch L12

[0193] Titer: 2.11 x 10 6 HAD 50 / ml

[0194] Storage conditions: -80℃

[0195] 2.2.4. Preparation of challenge materials

[0196] Dosage form: Each 1ml dose of the challenge material contains 10 HAD. 50 The computational load.

[0197] Preparation: Arm07 was diluted to 10 HAD shortly before the challenge. 50 / ml. Apply the challenge material at ambient temperature.

[0198] 2.2.5. Test System

[0199] 2.2.5.1. Animals

[0200] Species: Wild boar (Sus scrofa)

[0201] Sex: Female

[0202] Vaccination age: 3-5 months

[0203] Propagation: Farming Iberian wild boars

[0204] Quantity: 25

[0205] Microbiological status: Free from ASFV, pseudorabies virus, bovine mycobacterium, classical swine fever virus, swine vesicular disease virus, mycoplasma hyopneumoniae, porcine reproductive and respiratory syndrome virus, and porcine circovirus type 2.

[0206] Pigs originate from a certified farm in Seville, Spain.

[0207] Table 4. Clinical signs and scoring parameters of ASFV infection in wild boars (Cadenas-Fernández et al., 2020).

[0208]

[0209] 2.2.5.2. Adaptation Period

[0210] The wild boars acclimatized for two weeks between being transported to the animal facility and receiving vaccinations.

[0211] 2.2.5.3. Selection and Exclusion Criteria

[0212] Before introducing animals to the BSL3 facility, a veterinary examination is performed to verify appropriate sanitary conditions. Then, a thorough veterinary investigation is conducted to identify any clinical signs and / or injuries (e.g., due to transport). After the acclimatization period, only healthy animals are included in the study.

[0213] 2.2.5.4. Identification and Allocation of Processing Groups

[0214] Animals were evenly distributed into experimental groups based on graded behavior and veterinary criteria. Animals were then randomly identified using individually numbered ear tags.

[0215] 2.2.5.5. Feeding

[0216] The wild boars are kept in individual enclosures. Drinking water and a maintenance feed formula (commercial animal feed for piglets) are readily available. For animal welfare purposes, each enclosure is equipped with several toys specifically designed for wild boars, such as balls and bite chains. The enclosures are cleaned three times a week.

[0217] 2.3. Processing

[0218] Upon arrival, the animals received protective treatment with ivermectin (Ivomec S, Merial GmbH) to eliminate parasites.

[0219] Animals in groups 1, 2, 3 and 4 were orally vaccinated with the appropriate dose of the corresponding vaccine (see Table 3).

[0220] All animals were administered 10 HAD via the IM pathway. 50 Challenges with strain Arm07 (see Table 3).

[0221] 2.4. Animal Experiment Procedures

[0222] 2.4.1. Daily observation, rectal temperature measurement, and clinical signs.

[0223] To examine any clinical signs that develop during vaccination and challenge, daily clinical evaluations were performed to assess the corresponding attenuation and efficacy of the prototype vaccine. Animals were observed daily using 24-hour video recording and in-situ visits by in-situ wildlife specialist veterinarians to document their daily clinical signs.

[0224] Following the specific guidelines for clinical assessment of ASF in wild boars previously described in Cadenas-Fernández et al. (2020. Pathogens; 9(3):171), these clinical signs were expressed according to quantitative CS. The CS included rectal temperature, behavior, physical condition, skin changes, ocular / nasal discharge, joint swelling, respiratory signs, digestive signs, and neurological signs. The only clinical parameter not collected daily was rectal temperature; to minimize animal management, it was measured only twice a week, and only in animals exhibiting any severe signs. Fever was defined as a rectal temperature above 40.0°C.

[0225] 2.4.2. blood sampling

[0226] Blood EDTA and serum samples were collected from each animal. Samples were taken before vaccination and twice weekly during vaccination and challenge.

[0227] 2.4.3. The animals' destination at the end of the study

[0228] Between 30 and 32 days after the challenge, teldamine-zoprazepam was administered via intramuscular injection. 100 mg / ml, Virbac, France, target dose 3 mg / kg) and metoprolol ( Virbac, France, target dose 0.05 mg / kg; full protocol described in Barasona et al., 2013 BMC Vet Res. 9:107) The anesthetic combination was used to anesthetize surviving animals, followed by intravenous administration of an overdose of anesthetic substance (Virbac, France, target dose 0.05 mg / kg; full protocol described in Barasona et al., 2013 BMC Vet Res. 9 The Laboratorios Intervet SA, Salamanca, Spain) practiced euthanasia.

[0229] Blood EDTA, serum, and 21 different types of tissues and organs were obtained from each cadaveric animal. Tissues included the liver, spleen, tonsils, heart, lungs, kidneys, mandible, retropharyngeal region, groin, popliteal fossa, mesentery, mediastinum, stomach, liver, spleen, kidney lymph nodes, bone marrow, diaphragm, and intra-articular tissues of the joints. The carcasses of the deceased animals were disposed of according to standard procedures for domesticated animals at the biosafety levels required for this experiment.

[0230] 2.5. Humane End Point

[0231] The evolution of disease was represented by a quantitative clinical score (CS) specific to ASFV infection in wild boars (Table 4). The CS was established according to the clinical evaluation guidelines for domestic pigs established by Gallardo et al. (2017. Transbound Emerg Dis. 2019; 66:1399-1404) and Galindo-Cardiel et al. (2013. Virus Res. 173:180-190), but with minor modifications by four wildlife veterinarians based on previous and current research (Cadenas-Fernández et al. 2020. Pathogens. 9(3):171) to obtain more accurate and sensitive clinical observations of the course of ASFV infection in wild boars. The CS considered nine parameters (rectal temperature, behavior, body condition, skin changes, ocular / nasal discharge, joint swelling, respiratory symptoms, digestive symptoms, and neurological symptoms), measured in severity from 0 to 4 (most severe). All clinical observations, except for temperature, were recorded daily to minimize animal handling and stress.

[0232] Clinical evaluation is also important to ensure animal welfare. The humane endpoint is pre-defined as animals with a CS > 18, which also includes animals exhibiting severe clinical symptoms (Grade 4) for more than two consecutive days, including fever, behavioral, physical condition, and respiratory and digestive symptoms, meeting the stated criteria (Cadenas-Fernández et al. 2020 Pathogens.; 9(3):171). In addition, any animal that has not reached the predetermined humane endpoint but is suffering unacceptable pain is euthanized according to veterinary criteria.

[0233] 2.6. Laboratory Experiment Procedure

[0234] 2.6.1. Sample handling

[0235] The sample was handled according to the PE / 002 / SUAT-7 standard operating procedure (VISAVET Intranet, UCM).

[0236] 2.6.2. Real-time PCR detection of ASFV

[0237] DNA was extracted from blood and tissue samples according to FE-002-SUAT / 04-4 (Standard Operating Procedure; VISAVET, UCM) using a high-purity PCR template preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany).

[0238] Using the Universal Probe Library (UPL) real-time PCR contained in Chapter 3.9.1 of the Terrestrial Animal Diagnostic Testing and Vaccine Manual (OIE 2021), ASFV genomic DNA was amplified in each sample using undiluted extracted DNA, and the procedure was performed as described in FE-002-SUAT / 05-7 (Standard Operating Procedure; VISAVET, UCM).

[0239] 2.6.3. Antibodies were detected by enzyme-linked immunosorbent assay (ELISA).

[0240] ASFV-specific antibodies were detected in serum using commercial ELISA assays to detect antibodies specific to ASFV-p72 (INGEZIMPPA Compac K3, Ingenasa, Madrid, Spain).

[0241] 2.7. Results Evaluation and Interpretation

[0242] Descriptive statistics (mean, standard deviation) are used to summarize data.

[0243] Therefore, exploratory analyses were performed on temperature, clinical signs (CS) values, antibody responses, and ASF viral load in the blood (viremia; Cq value) to calculate the mean range and 95% confidence intervals for each group and sampling period. The Mann-Whitney U test and Kruskal-Wallis test were used to investigate the changes in these parameters between groups and at different time points. Spearman's rank correlations were used to statistically analyze the relationships between continuous parameters, temperature, CS, and Cq values. A p-value < 0.05 was considered statistically significant.

[0244] To assess the safety of candidate vaccines, post-vaccination and up to the challenge CS score, survival rate, and viremia were used as key parameters.

[0245] To evaluate the efficacy of candidate vaccines, CS score, survival rate, and viremia from the challenge were used as key parameters.

[0246] 2.8. Test Validity

[0247] The test is valid because:

[0248] - None of the animals had ASFV-specific antibodies on the day of vaccination.

[0249] - Animals in the control group exhibited ASFV-related clinical signs and died after the challenge.

[0250] 2.9. Results

[0251] 2.9.1. Security

[0252] 2.9.1.1. Clinical signs

[0253] Significant differences in clinical sign scores were observed in groups 1, 2, 3, and 4 of the study group, such as Figure 1 As shown. Low-grade / mild clinical signs were observed in animals inoculated with the parental strain Lv17 / WB / Rie1 (groups 3 and 4). Specifically, in group 3 (inoculated with 10... 3 In animals inoculated with the parent virus, two out of seven animals (28.6%) developed mild fever (40.45±0.35℃) and mild lethargy, respectively, starting at 11 and 18 dpv, after the initial vaccination. Following revaccination, these two animals, along with three other animals from the group, subsequently developed mild fever (40.50±0.29℃) 12 days after revaccination (25-39 dpv). Two of these animals exhibited mild fever on two consecutive sampling days, during which time mild lethargy was also observed in addition to fever. In group 4 (using 10... 4 In animals inoculated with the parent virus, three out of six animals (50%) developed mild fever (40.15 ± 0.10 °C) starting at 11 dpv after the initial vaccination, observed on two consecutive sampling days. Following re-vaccination, one and another of these animals developed mild fever (40.10 ± 0.14 °C) 10 days after re-vaccination (25–32 dpv), and one of the animals also exhibited mild lethargy. Figure 1 In addition, one wild boar from the group developed a high fever (41.5°C) 14 days after re-inoculation (32 dpv) and had to be euthanized during the inoculation period, although the animal’s death was triggered by a highly aggressive fight within the enclosure (as detailed in the next section).

[0254] In the two groups vaccinated with the mutant vaccine strain, no clinical signs were observed in the animals except for a slight fever (40.15±0.10℃) on the scheduled day. Figure 2 and 4 ).

[0255] The CS considered nine parameters (rectal temperature, behavior, physical condition, skin changes, ocular / nasal discharge, joint swelling, respiratory symptoms, digestive symptoms, and neurological symptoms), measured on a severity scale from 0 to 4 (most severe). Groups 3 and 4 (parental virus) showed higher values ​​for these parameters compared to those in groups 1 and 2 (mutant vaccine strains).

[0256] 2.9.1.2. Rectal temperature

[0257] Figure 3 and Figure 4 This represents the average rectal temperature of each group of animals during the study period. Although animals inoculated with the parental virus showed a slightly elevated rectal temperature (values ​​above 40.5°C), animals inoculated with the mutant vaccine strain exhibited a more stable temperature.

[0258] 2.9.1.3. Survival after vaccination

[0259] In Group 1, Group 2 (inoculated with the mutant vaccine strain), and Group 3 (inoculated with the parental strain at a low dose of 10... 3 In group 4 (using parent virus at a high dose of 10), all animals survived the vaccination period. 4 During the inoculation process, one of the six animals died due to highly aggressive fighting within the enclosure. This fighting resulted in multiple external injuries and dislocations of the animal's right hip joint. Following this fight, the animal was treated in the enclosure to aid its recovery but began showing signs of fever, followed by lethargy, and finally anorexia, until it was euthanized 21 days (39 dpv) after re-inoculation, with an ASF CS value of 10. Analysis of the resulting samples revealed the presence of ASFV viral DNA in the blood and tissues.

[0260] 2.9.1.4. Viremia

[0261] For animals from groups 3 and 4 (inoculated with the parental virus), two transient peaks in the ASF viral genome detection in the blood were typically observed in all animals. The first peak was observed in 5 of the 13 animals (38.5%) after the initial inoculation, while a second peak was observed in 11 animals after re-inoculation, with 84.6% of these ( Figure 5 Furthermore, a direct correlation was observed between peak viremia and elevated rectal temperature (Spearman rank, p < 0.05, r = -0.37).

[0262] For group 1 animals (using the mutant vaccine strain at 10...) 4 (Vaccination), four out of six animals showed viremia, peaking at 12 dpv. Of all animals that developed viremia during vaccination, the virus was cleared by 26 dpv. Figure 6 ).

[0263] In animals from group 2 (using mutant strains at 10...) 2 Vaccination and use 10 4 Following revaccination, 3 out of 6 animals exhibited timely viremia with a high Cq value (39.05±0.5) after the initial vaccination. Five days after revaccination, 3 out of 6 animals developed viremia with a Cq value of 37.6±2.3, which persisted until challenge. Another animal also showed viremia during this sampling process. Figure 6 ).

[0264] 2.9.1.5. Antibody Response

[0265] For animals inoculated with the parental virus, antibody production appears to depend on re-vaccination in most cases. Prior to re-vaccination, only 2 out of 7 animals in group 3 and 4 out of 1 animals had antibodies in their blood. In group 3 (inoculated with the parental virus at 10... 3 In the vaccination group, all animals developed antibodies in their blood prior to the challenge, while group 4 (using the parent virus at 10...) 4 Of the 6 animals that were vaccinated, only 4 developed antibodies. Figure 7 A clear direct correlation was found between the initiation of a positive antibody response and the first detection of the ASF viral genome (Spearman rank, r = 0.99; p < 0.05). In fact, the animals in group 4 that did not show viremia were consistent with the two animals in that group that did not show an antibody response.

[0266] For animals from group 1 (using the mutant vaccine strain at 10...) 4 (Vaccination), five out of six animals showed an antibody response before the challenge, ranging from 9 to 16 dpv. The animal without antibodies was the only one that did not survive after the challenge.

[0267] In animals from group 2 (using mutant strains at 10...) 2 Vaccination and at 10 4 (Re-vaccination), before which only one animal showed antibodies (starting at 12 dpv). Eleven days after re-vaccination with a higher dose, all animals from that group showed antibodies. Figure 8 ).

[0268] 2.10. Validity (Post-Challenge)

[0269] 2.10.1. Clinical signs

[0270] During the challenge, the mean clinical scores and temperatures were similar across all compared groups. Figure 9 , 10 (11 and 12), although 5-7 days after the challenge, in most animals from group 1 (using mutant strains in groups of 10) 4 A slight increase in temperature was observed during vaccination. Significant increases in clinical signs were observed in challenge infections in animals that did not develop vaccine immunization, and these increases gradually decreased later in the study.

[0271] 2.10.2. Post-challenge mortality rate

[0272] All animals from group 3 (using parent virus at 10) 3 (vaccination) was fully protected and in 32 days with Arm0710 HAD50 Survival after the challenge (100% protective efficacy). However, two animals from group 4 (using the parent virus at 10...) 4 Those who did not have a positive antibody response during vaccination and did not survive after challenge (60% protective efficacy in this group) and had signs of ASF compatibility. The overall protection outcome for wild boars in both groups, who were orally vaccinated and revaccinated with parental Lv17 / WB / Rie1 ASFV, was 83.3%.

[0273] Conversely, Group 1 (using a mutant vaccine strain at 10) 4 Of the 6 animals vaccinated, 5 were in group 2 (using a mutant vaccine strain at 10...). 2 Vaccination and at 10 4 All animals in the re-vaccination group survived the 30 / 44 dpv challenge, achieving 83.3% protective efficacy in group 1 and 100% protective efficacy in group 2. The overall protective efficacy of the two groups vaccinated with the mutant vaccine strain was 91.66%. Survival percentages are depicted on... Figure 13 and Figure 14 middle.

[0274] 2.10.3. Viremia

[0275] Within the research group, there were differences in the detectable viral levels in the blood after the challenge.

[0276] The results for each group are shown below. Figure 15 and 16 middle.

[0277] Transient viremia was detected in surviving animals (groups 3 and 4) inoculated with the parental Lv17 / WB / Rie1 strain after the challenge (mean Cq value 36.4 ± 2.0 for group 3 and 37.4 ± 2.0 for group 4). From 4 dpc until the end of the experiment, only one animal in group 3 maintained constant viremia with a mean Cq value of 25.5 ± 0.8. The two animals in group 4 that did not survive the challenge had lower Cq values ​​(19.3 ± 2.3).

[0278] For those from Group 1 (using the mutant vaccine strain at 10) 4 Animals vaccinated with the mutant vaccine strain showed constant viremia with low Cq values ​​(mean Cq value 24.06 ± 1.6) in all surviving animals after the challenge, while Group 2 (vaccinated with the mutant vaccine strain at 10...) showed... 2 Vaccination and 10 4 In the re-vaccination group, only two animals showed viremia after the challenge. In this group, one of them had viremia for only one day (Cq value of 35.91), while the other had constant viremia (mean Cq of 31.76 ± 4.9).

[0279] 2.11. Conclusion

[0280] This study draws the following conclusions.

[0281] 1. The mutant strain Lv17 / WB / Rie1-ΔCD is safe for use in wild boars and is safer than the wild-type parental strain Lv17 / WB / Rie1 because the clinical signs observed during vaccination in animals vaccinated with the mutant strain were milder than those observed in the group vaccinated with the parental virus.

[0282] 2. In animals vaccinated with the mutant vaccine strain, overall protection against Arm07 challenge was slightly higher, although compared with other groups, including animals vaccinated with the parental virus, the protection was lower with a single dose of 10... 4 Animals inoculated with the mutant exhibited constant viremia with low Cq values.

[0283] 3. In summary, among the two different vaccination models evaluated using mutant vaccine strains, low-dose vaccination followed by a higher dose appears to be the most promising. However, further research using different vaccination models is warranted.

[0284] Example 3: Use of live African swine fever (ASF) virus vaccine strain LV17 / WB / RIE1-ΔEP402R-ΔEP153R Safety study in pigs 3.1. Research Design

[0285] Thirteen 12-week-old pigs that were neither ASFV-free nor antibody-free were selected for this study. Five animals from each of groups 1 and 2 received 100 TCID via intramuscular (IM) administration. 50 Animal vaccines. Group 1 was immunized with Lv17 / WB / Rie1-ΔCD, and Group 2 was immunized with the parental strain Lv17 / WB / Rie1. Three animals in Group 3 served as unvaccinated controls. At 30 dpi, all animals in all three groups were vaccinated with 100 HAD via the IM route. 50 The Armenia / 07 (Arm07) challenge. An overview of each group and its treatment is shown in Table 5.

[0286] Blood samples were collected before vaccination and at 7, 12, 14, 19, 21, and 28 days post-vaccination, and before and at 3, 6, 10, 13, 17, 20, 24, 27, and 31 days post-challenge. The presence of ASFV in the blood samples was detected by qPCR, and the presence of ASFV-specific antibodies was detected by indirect immunoperoxidase assay (IPT). Clinical signs were recorded daily, and a quantitative clinical score was calculated by summing the values ​​of eight clinical signs recorded each day.

[0287] Table 5: Overview of each group and its treatment

[0288]

[0289] 3.2. Materials and Methods

[0290] 3.2.1. Test artifacts and challenge materials

[0291] 3.2.1.1. Live ASFV vaccine strain

[0292] Name of strain 1: Lv17 / WB / Rie1-ΔCD

[0293] Titer: 4.8 x 10 7 TCID 50 / ml

[0294] Storage conditions: -80℃

[0295] Name of strain 2: Lv17 / WB / Rie1

[0296] Batch number or reference: N a 15-F-20.B 2P PAM

[0297] Information: Barasona et al., 2019; Gallardo et al., 2019

[0298] Titer: 2.8 x 10⁶ TCID 50 / ml

[0299] Storage conditions: -80℃

[0300] 3.2.1.2. Preparation of inoculum

[0301] Dosage form: Each 1ml dose of the challenge substance contains 100 HAD. 50 The computational load.

[0302] Preparation: Arm07 was diluted to 100 HAD shortly before the challenge. 50 / ml. Apply the challenging material at ambient temperature.

[0303] 3.2.2. Testing System

[0304] 3.2.2.1. Animals

[0305] Species: Pig

[0306] Sex: Female

[0307] Vaccination age: 12 weeks

[0308] Propagation: European hybrid pigs

[0309] Quantity: 13

[0310] Microbiological status: Free of ASFV, porcine reproductive and respiratory syndrome virus (PRRSV), and pseudorabies virus. Free of ASFV antibodies. Animals were vaccinated against Mycoplasma hyopneumoniae and porcine circovirus (PCV2) 30 days after birth.

[0311] Pig origin: Agropecuaria Divina Pastora Sat, Madrid, Spain

[0312] 3.2.2.2. Adaptation period

[0313] Pigs have seven days to acclimatize between being transported to the animal facility and receiving vaccinations.

[0314] 3.2.2.3. Inclusion and Exclusion Criteria

[0315] According to the internal SOP (SSB / 02 / ANIMALARIO / NCB3 and “Procedimiento animalariorecepción animales”), a veterinary examination is performed before animals are introduced into the NCB3 facility to verify appropriate sanitary conditions. Subsequently, another veterinary investigation is carefully conducted to identify any clinical signs and / or injuries (e.g., due to transport). Only healthy animals are included in the study.

[0316] 3.2.2.4. Identification and Allocation of Processing Groups

[0317] Animals were evenly distributed into experimental groups based on size and veterinary criteria. Animals were then randomly identified using individually numbered ear tags.

[0318] 3.2.2.5. Feeding

[0319] The pigs were housed in three separate boxes, five pigs per enclosure. An additional box contained three unvaccinated pigs. Water was readily available, and a growing-finishing pig feed formula (commercial animal feed) was provided once daily, at a rate of 1.20 kg of feed per animal. This feeding program was implemented to quantify feed consumption for each group after vaccination and challenge. For animal welfare purposes, each enclosure was equipped with several toys specifically designed for pigs, such as gumballs and chew chains. The enclosures were cleaned daily according to the internal SOP ("Procedimiento de cuidado delos animales, limpieza y desinfección de boxes").

[0320] 3.2.3. Processing

[0321] Upon arrival, the animals were treated with a single intramuscular (IM) injection of mabofloxacin at a dose of 8 mg / kg body weight.

[0322] Animals in groups 1 and 2 were injected with 100 TCID via intramuscular injection on the right side of the neck. 50 The corresponding vaccines (see Table 1).

[0323] Thirty days after vaccination, all animals were administered 100 HAD via the IM route (see Table 1) on the left side of the neck. 50 Challenge with strain Arm07.

[0324] During the experiment and relative to clinical symptoms, animals were given nonsteroidal anti-inflammatory drugs (NSAIDs), such as meloxicam, 0.4 mg / kg, via the intramural route (MEL), diclofenac, 70 mg / animal, via the dermal route (DFN), or flunixin meglumine, 2.2 mg / kg, via the intramural route (FM). The most common types of analgesics were administered to food-producing animals to relieve pain caused by joint inflammation and to treat fever. Table 6 summarizes the treatment in pigs.

[0325] Table 6: Processing Schedule

[0326]

[0327] 3.2.4. Animal Experiment Procedures

[0328] 3.2.4.1. Daily observation, rectal temperature measurement, and clinical signs.

[0329] From one day before vaccination until the end of the animal trial, the general health status and ASFV-specific clinical signs of each animal were observed daily. Clinical signs were recorded daily and represented by a quantitative clinical score obtained by summing the values ​​of eight clinical signs recorded each day; fever parameters, anorexia, recumbency, skin bleeding or cyanosis, joint swelling, dyspnea, ocular discharge, and gastrointestinal symptoms were scored on a severity scale of 0-3 (most severe). The sum of the scores was recorded as the clinical score (CS), which was also used to define the humanitarian endpoint (see Table 7).

[0330] Table 7. Clinical signs table used to create ASF clinical scores

[0331]

[0332]

[0333] 3.2.4.2. Blood Sampling

[0334] Blood EDTA and serum samples were collected from each animal. Sampling was performed before vaccination and at 7, 12, 14, 19, 21, and 28 days post-vaccination, and before and after challenge at 3, 6, 10, 13, 17, 20, 24, 27, and 31 days post-challenge. Samples were collected according to the SOP of the EU Reference Laboratory (EURL) for ASF: SOP / CISA / ASF / SAMPLES / 1 / (https: / / asf-referencelab.info / asf / images / ficherosasf / PROTOCOLOS-EN / SOP-ASF-SAMPLES-1_REV5_2021.pdf).

[0335] 3.2.4.3. Animal destination at the end of the study

[0336] As described in Table 8, surviving animals were euthanized between 31 and 38 days after a challenge with sodium pentobarbital (300 mg / mL). Blood EDTA, serum, and 21 different types of tissues and organs were obtained from each cadaver. Tissues included the liver, spleen, tonsils, heart, lungs, kidneys, mandible, retropharyngeal region, groin, popliteal fossa, mesentery, mediastinum, stomach, liver, spleen, kidney lymph nodes, bone marrow, diaphragm, and intra-articular tissues of the joints. The carcasses of the deceased animals were disposed of according to standard procedures for domesticated animals at the biosafety levels required for this experiment.

[0337] Table 8: Euthanasia Timeline

[0338]

[0339]

[0340] 3.2.5. Humane End Point

[0341] Based on the severity of clinical signs, each parameter described in Table 7 is scored from 0 to 3. The total score is recorded as the Clinical Score (CS). Animals are euthanized if they have severe fever or anorexia, collapse, dyspnea or gastrointestinal symptoms, or the sum of the eight CSs is >18, or if they do not reach the endpoint score but suffer unacceptable distress for three days afterward, thus reaching the humane endpoint.

[0342] 3.2.6. Laboratory Experiment Procedure

[0343] 3.2.6.1. Sample Preparation

[0344] The samples were processed according to EURL-SOP / CISA / ASF / SAMPLES / 1 (https: / / asf-referencelab.info / asf / images / ficherosasf / PROTOCOLOS-EN / SOP-A SF-SAMPLES-1_REV5_2021.pdf).

[0345] 3.2.6.2. Real-time PCR detection of ASFV

[0346] DNA was extracted from blood and tissue samples using a high-purity PCR template preparation kit (Roche Diagnostics GmbH, Roche Applied Science, Mannheim, Germany) according to EURL-SOP / CISA / ASF / DNA EXTRACTION / 1 (https: / / asf referencelab.info / asf / images / ficherosasf / PROTOCOLOS-EN / 2021_UPD ATE / SOP-ASF-DNA-EXTRACTION-1_REV52021.pdf).

[0347] ASFV genomic DNA was amplified in each sample using real-time PCR with the Universal Probe Library (UPL) described in Chapter 3.9.1 of the Terrestrial Animal Diagnostic Testing and Vaccine Manual (OIE 2021) and in EURL-SOP / CISA / ASF / PCR3 (https: / / asf-referencelab.info / asf / images / ficherosasf / PROTOCOLOS-EN / 2021_UPDATE / SOP-ASF-PCR-3-2021.pdf), using undiluted extracted DNA.

[0348] 3.2.6.3. Antibody detection by indirect immunoperoxidase test (IPT)

[0349] The detection of ASFV-specific antibodies in serum was performed using the IPT method described in Chapter 3.9.1 of the Terrestrial Animal Diagnostic Tests and Vaccines Manual (OIE 2021) and in EURL-SOP / CISA / ASF / lPT1 (https: / / asf-referencelab.info / asf / images / ficherosasf / PROTOCOLOS-EN / SOP-IP T-PLATES-1_rev2018.pdf).

[0350] The ASFV antibody titer in all positive samples was determined by endpoint dilution.

[0351] 3.2.7. Results Evaluation and Interpretation

[0352] Descriptive statistics (mean, standard deviation) are used to summarize data.

[0353] To assess vaccine safety, clinical signs scores, survival rate, and ASFV viremia were used as parameters after vaccination and before challenge.

[0354] To assess the efficacy of the vaccine, clinical signs scores, survival rate, and ASFV viremia from the challenge were used as parameters.

[0355] 3.2.8. Validity of the experiment

[0356] The experiment was effective because:

[0357] - No animals had ASFV-specific antibodies on the day of vaccination.

[0358] - Animals in the control group exhibited ASFV-related clinical signs and died after the challenge.

[0359] 3.3. Results

[0360] 3.3.1. Security (Before the Challenge)

[0361] 3.3.1.1. Clinical signs

[0362] Significant differences in clinical signs and scores were observed between study groups 1 and 2, such as Figure 17 As shown. For animals vaccinated with the parental strain Lv17 / WB / Rie1 (Group 2), clinical symptoms appeared at 5 dpi and increased to 13 points by day 12 post-vaccination, after which they gradually decreased. For the mutant vaccine strain, animals showed no clinical symptoms until 7 dpi, after which they began to show a gradual but slow increase in clinical symptoms, but at 12 dpi, the score with Lv17 / WB / Rie1-ΔCD (Group 1) only reached 3. Although the mean daily clinical score for the parental strain was 5.2, the mean clinical score for the mutant vaccine strain Lv17 / WB / Rie1-ΔCD was 2.46, suggesting that it was safer than the parental strain.

[0363] The severity of clinical signs for each parameter is as follows: Figure 18 As shown in the figure. 1 point indicates mild discomfort, 2 points indicate moderate discomfort, and 3 points indicate severe discomfort. Animals in Group 2 showed greater severity of discomfort compared to those in Group 1 in terms of fever, anorexia, recumbency, joint swelling, and respiratory distress.

[0364] 3.3.1.2. Rectal temperature

[0365] Figure 19 This represents the mean rectal temperature for each group of animals at each time point during the study period. It can be seen that although animals inoculated with the parental strain Lv17 / WB / Rie1 (Group 2) showed an increase in rectal temperature starting at 2 dpv, animals inoculated with the mutant strain did not show this increase. For animals inoculated with the parental strain, the temperature gradually decreased after 14 dpv and remained within the normal range thereafter, even after the challenge. After the challenge, only the uninoculated animals had temperature readings exceeding normal values. These animals did not survive the study.

[0366] 3.3.1.3. Survival after vaccination

[0367] In Group 2, of the five animals inoculated with the parent strain, one pig died at 10 dpi and another at 18 dpi, resulting in a survival rate of 60%. Conversely, all animals in Group 1 survived until they were challenged at 30 dpi. Survival percentages are as follows: Figure 20 As shown.

[0368] 3.3.1.4. Viremia

[0369] In group 2, all five animals inoculated with the parental strain Lv17 / WB / Rie1 had the virus in their blood at 7 days post-infection (dpi). Viremia peaked at 7 dpi, and the virus was gradually cleared from the animals, resulting in no viremia at 28 dpi. Figure 21 a).

[0370] In group 1 animals vaccinated with the mutant vaccine strain Lv17 / WB / Rie1-ΔCD, only 2 out of 5 animals showed viremia, peaking at 14 dpi. The reduction in viral load after 14 dpi corresponded to the onset of ASFV-specific antibodies in the blood. In two animals, viral clearance was achieved by 28 dpi. Figure 21 b).

[0371] 3.3.1.5. Antibody Response

[0372] All domestic pigs underwent seroconversion on day 7 (parents) and day 14 (mutants). Figure 22 (a and 22b).

[0373] 3.3.2. Validity (Post-Challenge)

[0374] 3.3.2.1. Clinical signs

[0375] At the challenge, group 2, inoculated with the parental strain Lv17 / WB / Rie1, had a lower mean clinical score compared to animals inoculated with the mutant strain. Figure 23Challenge infection did not lead to a significant increase in clinical signs scores, and clinical signs scores gradually decreased at the end of the study.

[0376] It was also found that the severity of various parameters used to determine clinical scores varied between the mutant vaccine strain and the parent strain, such as Figure 24 As shown. Mild anorexia, fever, and recumbency were observed or not observed in any of the groups. Gastrointestinal symptoms were observed only in the group vaccinated with the mutant vaccine strain (Group 1). In animals vaccinated with Lv17 / WB / Rie1-ΔCD (Group 1), followed by animals vaccinated with Lv17 / WB / Rie1 (Group 2), skin redness, joint swelling, dyspnea, and eye discharge were more pronounced. The most significant distress was caused by joint swelling, with stress levels ranging from mild to moderate in the case of the mutant vaccine strain. In summary, the severity of symptoms was found to be lower in animals vaccinated with Lv17 / WB / Rie1 than in animals vaccinated with the mutant vaccine strain.

[0377] 3.3.2.2. Post-challenge mortality rate

[0378] In group 2, inoculated with the parent strain, only 3 animals underwent the challenge, while in groups inoculated with the mutant vaccine strain, all 5 animals underwent the challenge. All challenged animals in these groups survived until the end of the study. Figure 25 In the control group (Group 3), all animals died within 7 days.

[0379] 3.3.2.3. Viremia

[0380] Within the study groups, there were differences in the viral levels detected in the blood after the challenge. Results for each group are shown below. Figure 26 In contrast, no virus was detected in animals inoculated with the parent strain after challenge. In the group inoculated with Lv17 / WB / Rie1-ΔCD, 4 out of 5 vaccinated animals showed viremia after Arm07 challenge.

[0381] 3.4. Conclusion

[0382] This study draws the following conclusions.

[0383] 1. The mutant vaccine strain Lv17 / WB / Rie1-ΔCD is safe for administration to domestic pigs and is safer than the wild-type parent strain Lv17 / WB / Rie1. Compared with the wild-type parent strain, and even in overdose compared with the parent attenuated strain, the mutant vaccine shows a significant reduction in side effects after vaccination.

[0384] 2. Both strains provided 100% protection after the Arm07 challenge, but animals inoculated with the mutant strain showed more (chronic) clinical signs (mild to mild) and a peak Arm07 viremia (1 out of 5 pigs) after the challenge compared to animals inoculated with the parent strain.

Claims

1. A live attenuated African swine fever virus (ASFV), characterized in that... The genome of the ASFV Lv17 / WB / Rie1 strain is modified, in which the EP153R and EP402R genes have been inactivated.

2. The attenuated ASFV according to claim 1, wherein the inactivation of the EP402R gene is caused by the deletion of at least a portion of the EP402R gene.

3. The attenuated ASFV according to claim 2, wherein the deletion of the EP402R gene affects the intact EP402R gene.

4. The attenuated ASFV according to any one of claims 1 to 3, wherein the inactivation of the EP153R gene is caused by the deletion of at least a portion of the EP153R gene.

5. The attenuated ASFV according to claim 4, wherein the deletion of the EP153R gene affects the intact EP153R gene.

6. The attenuated ASFV according to any one of claims 1 to 5, wherein the inactivation of the EP402R gene and the inactivation of the EP153R gene are caused by a single deletion in the genome of the ASFV Lv17 / WB / Rie1 strain.

7. The attenuated ASFV according to claim 6, wherein the inactivation of the EP402R gene and the inactivation of the EP153R gene are caused by the deletion of positions 73812 to 75385 of SEQ ID NO:

1.

8. The attenuated ASFV according to any one of claims 1 to 7, wherein the EP153R gene and / or the EP402R gene are replaced by at least one heterologous gene.

9. The attenuated ASFV according to any one of the preceding claims, wherein the attenuated ASFV contains at least one or more heterologous genes, and wherein the at least one or more heterologous genes are under the control of the promoter of the ASFV gene.

10. The attenuated ASFV according to claim 9, wherein the promoter is the promoter of the p72 gene.

11. The attenuated ASFV according to any one of claims 1 to 10, wherein the genomic sequence of the ASFV Lv17 / WB / Rie1 strain comprises the sequence of SEQ ID NO:

1.

12. The attenuated ASFV according to any one of claims 1 to 11, wherein the genome of the recombinant ASFV comprises the sequence of SEQ ID NO:

2.

13. An immunogenic composition or vaccine composition comprising attenuated ASFV according to any one of claims 1 to 12 and a pharmaceutically suitable carrier or excipient.

14. The immunogenic composition of claim 13, wherein the immunogenic composition is formulated for intranasal, oral, subcutaneous, intradermal or intramuscular administration, preferably intramuscular administration.

15. The recombinant ASFV according to any one of claims 1 to 14, for the prevention or treatment of diseases caused by ASFV infection.

16. The recombinant ASFV used according to claim 15, wherein the recombinant ASFV is used to treat ASFV infection in pigs or wild boars.

17. The recombinant ASFV used according to claim 15 or 16, wherein the recombinant ASFV is administered in a single dose.

18. The recombinant ASFV used according to any one of claims 15 to 17, wherein the effective dose is about 10 half-maximum tissue culture infection doses (TCID). 50 ) to about 10 5 TCID 50 .

19. The recombinant ASFV used according to any one of claims 15 to 18, wherein the effective dose in wild boar is about 10 2 TCID 50 To about 10 4 TCID 50 .

20. The recombinant ASFV used according to any one of claims 15 to 18, wherein the effective dose in pigs is about 50 TCID. 50 Approximately 200 TCID 50 Preferred 100 TCID 50 .

21. The recombinant ASFV used according to any one of claims 15-20, wherein the recombinant ASFV is administered intranasally, orally, subcutaneously, intradermally, or intramuscularly.

22. A polynucleotide comprising first, second, and third regions, wherein the first region comprises an expression cassette containing an ASFV heterologous gene, wherein the first region is laterally connected to the second and third regions, and wherein the second and third regions are regions of the ASFV Lv17 / WB / Rie1 strain genome, which are naturally laterally connected to regions of the ASFV genome containing the EP402R and EP153R genes.

23. The polynucleotide of claim 22, wherein the second and / or third region consists of about 1000 bp.

24. The polynucleotide according to claim 22 or 23, wherein the heterologous gene is the eGFP gene.

25. The polynucleotide according to any one of claims 22-24, wherein the heterologous gene is under the control of the ASFV p72 promoter.

26. A vector comprising a polynucleotide according to any one of claims 22 to 25.

27. A host cell comprising a polynucleotide according to any one of claims 22 to 25 or a vector according to claim 26.

28. A method for generating recombinant African swine fever virus (ASFV) according to any one of claims 1 to 14, the method comprising: (i) Modifying target cells in the following ways -Introducing a polynucleotide as defined in any one of claims 22 to 25, - Infect the cells with Lv17 / WB / Rie1 strain, and - Introduce means to generate double-strand DNA breaks in the genome of the attenuated ASFV strain within or near the regions containing the EP402R and EP153R genes. (ii) The target cells are maintained under conditions sufficient to allow double-strand DNA breaks to occur in the ASFV genome and to permit homologous recombination between the ASFV genome containing the DNA breaks and the second and third regions of the polynucleotide, thereby causing the first region within the polynucleotide introduced in step (i) to replace the regions encoding the EP402R and EP153R genes, and (iii) The recombinant ASFV is recovered from the supernatant and / or from the whole cell extract, and ASFV virions containing the reporter gene are selected.

29. The method of claim 28, wherein the target cell is a mammalian cell line.

30. The method of claim 29, wherein the mammalian cell line is a macrophage.

31. The method according to any one of claims 28 to 30, wherein the means capable of generating double-strand breaks in the genome of the ASFV strain in or near the region containing the EP402R and EP153R genes comprises a CRISPR / Cas system.

32. The method according to any one of claims 28-31, wherein the expression cassette forming the portion of the first region comprises a reporter gene encoding a fluorescent protein.

33. The method of claim 32, wherein the reporter gene is under the control of a constitutive promoter.

Images