3D bio-printing bone marrow mesenchymal stem cell extravascular stent as well as preparation method and application of 3D bio-printing bone marrow mesenchymal stem cell extravascular stent

Abstract

The invention discloses a 3D bio-printing bone marrow mesenchymal stem cell extravascular stent as well as a preparation method and application of the 3D bio-printing bone marrow mesenchymal stem cell extravascular stent. The 3D bio-printing bone marrow mesenchymal stem cell extravascular stent is obtained by performing 3D bio-printing on bio-ink of bone marrow mesenchymal stem cells (BMSCs) containing SIRT3 overexpression, and the bio-ink contains methacrylated hyaluronic acid (HAMA) and methacrylated gelatin (GelMA). The invention further discloses a preparation method of the 3D bio-printing bone marrow mesenchymal stem cell extravascular stent, and the 3D bio-printing bone marrow mesenchymal stem cell extravascular stent has the advantages that the 3D bio-printing bone marrow mesenchymal stem cell extravascular stent is obtained by performing 3D bio-printing on the bio-ink; the effect of improving the long-term patency rate of the vein bridge is evaluated by establishing a rat artery-vein transplantation model. Experimental results show that the 3D bio-printing bone marrow mesenchymal stem cell extravascular stent not only has good structural stability and biocompatibility, but also can significantly improve the long-term patency rate of a venous bridge, promote repair of damaged tissues and enhance the vascular function recovery capability, and has potential application prospects in improving the treatment effect of cardiovascular diseases.

Description

TECHNICAL FIELD

[0001] The present application relates to a new 3D bioprinting technology for improving the treatment effect of cardiovascular diseases, in particular to a technology for constructing an extravascular scaffold using specific biomaterials and genetically modified stem cells to improve the long-term patency rate of venous bridges. BACKGROUND

[0002] In recent years, coronary artery bypass grafting (CABG) as one of the important means of treating coronary heart disease, through the reconstruction of the coronary blood supply of patients to improve their survival rate. However, although CABG surgery has achieved remarkable results in the short term, the long-term patency rate of venous bridge blood vessels after surgery is still not satisfactory, especially when using the great saphenous vein as a graft, the patency rate after 20 years is only 50%, which seriously affects the prognosis and quality of life of patients. At present, the application of stem cell transplantation, especially bone marrow mesenchymal stem cells (BMSCs), has become a research hotspot to improve this situation. BMSCs are of great concern due to their easy access and expansion, low immunogenicity, and stable biological characteristics. They not only have differentiation potential, but also can participate in immune regulation and inflammatory response through paracrine mechanism, and can deliver organelles such as mitochondria to damaged cells.

[0003] Although stem cell therapy shows great potential, it still faces many challenges in practical application. Traditional stem cell transplantation methods, such as intravenous injection or in situ injection, often result in low cell survival rate after transplantation, difficulty in colonization, and poor targeting, etc. These problems limit the effectiveness of stem cell therapy and hinder its clinical transformation. In addition, existing treatment methods are difficult to provide an ideal microenvironment for long-term survival and functional exertion of stem cells, thereby affecting the treatment effect. Therefore, it is particularly important to find a new technology that can effectively solve the above problems.

[0004] With the development of biological tissue engineering technology, 3D bioprinting technology provides a new way to overcome the limitations of existing technology. By combining stem cells with suitable biomaterials for printing, not only can the microenvironment for stem cell transplantation be optimized, but also the cell delivery efficiency can be improved, and the survival and colonization ability of cells can be enhanced. HAMA (methylacrylated hyaluronic acid) and GelMA (methylacrylated gelatin) as derivatives of natural materials have been widely used in the field of 3D bioprinting due to their good biocompatibility and controllable mechanical properties. By combining these two materials and carrying BMSCs to make bio-ink, an extravascular scaffold with good mechanical properties and biocompatibility can be prepared, which provides a possibility to solve the problem of venous bridge restenosis.

[0005] The 3D bioprinting technology and the well-matched matrix material update the existing stem cell transplantation technology, which is of great significance to improve the long-term patency rate of the vein bridge blood vessels. This not only can provide the necessary mechanical support for the vein bridge blood vessels to prevent the continuous stimulation of the arterial blood pressure on the vein blood vessels, but also can ensure that a sufficient number of stem cells act on the target area to exert their best therapeutic effect. More importantly, this method is expected to fundamentally improve the function of the endothelial cells of the vein bridge blood vessels and inhibit the formation of the neointima, thereby significantly improving the long-term patency rate of the vein bridge blood vessels. This innovative treatment method not only opens up a new path for the treatment of cardiovascular diseases, but also provides valuable reference for the research in other related fields. SUMMARY

[0006] The present application aims to provide a HAMA / GelMA vascular external stent rich in Sirtuin 3 (SIRT3) gene overexpressed bone marrow mesenchymal stem cells (BMSCs) prepared by 3D bioprinting technology and a preparation method thereof, and to explore its effect on improving the long-term patency rate of the vein bridge.

[0007] In order to achieve the above-mentioned purpose, the following technical means are adopted in the present application:

[0008] The 3D bioprinted bone marrow mesenchymal stem cell vascular external stent of the present application is obtained by 3D bioprinting of a biological ink containing SIRT3 overexpressed bone marrow mesenchymal stem cells (BMSCs), wherein the biological ink contains hyaluronic acid methacrylate (HAMA) and gelatin methacrylate (GelMA).

[0009] Preferably, the mass ratio of hyaluronic acid methacrylate (HAMA) and gelatin methacrylate (GelMA) is 0.5-1.5:5.

[0010] Preferably, the biological ink containing SIRT3 overexpressed bone marrow mesenchymal stem cells (BMSCs) is prepared by the following method:

[0011] ① Take 20ml PBS and add it to a brown bottle containing 0.05g initiator LAP (Lithium phenyl-2,4,6-trimethylbenzoylphosphinate). Dissolve in a 40-50℃ water bath for 15 minutes, shake several times during the process, and avoid light. After dissolution, wrap it with tin paper to prepare a 0.25%(w / v) initiator standard solution, and store it at 4℃.

[0012] ② Take GelMA and HAMA into a 50ml centrifuge tube, take the initiator standard solution and add it into the centrifuge tube, shake to fully infiltrate and swell; heat in a 60-70℃ water bath for 20-30 minutes in the dark, shake several times during the process, fully dissolve to obtain a solution containing HAMA and GelMA;

[0013] ③ Dissolve the solution containing HAMA and GelMA in PBS buffer, then immediately sterilize with a 0.22μm sterile filter, filter into a centrifuge tube, prepare a bio-ink containing HAMA and GelMA, wrap with tin paper and store at -20℃, for preparing a bio-ink containing SIRT3 overexpressed BMSCs;

[0014] ④ Preparation of a bio-ink containing SIRT3 overexpressed BMSCs:

[0015] a Take SIRT3 overexpressed BMSCs in a good growth state with a cell confluence of 80%-90%, digest with 0.25% trypsin digestion solution, terminate digestion, wash with PBS and resuspend, then use a Bio-Rat cell counter to count the collected cells;

[0016] b Distribute the SIRT3 overexpressed BMSCs suspension into new 15ml centrifuge tubes at 3×10 6 cells per tube, centrifuge at 800rpm for 5 minutes, then discard the supernatant;

[0017] c Add 3ml of bio-ink containing HAMA and GelMA into the centrifuge tube containing the SIRT3 overexpressed BMSCs cell precipitate, resuspend the cells, mix thoroughly, operate gently to avoid generating bubbles, finally obtain a bio-ink with a concentration of 1×10 6 BMSCs cells / mL, place in a 37℃, 5% CO2 cell incubator for the next step of 3D bioprinting.

[0018] Preferably, the SIRT3 overexpressed BMSCs are a stable infected cell strain obtained by screening after infecting BMSCs with a SIRT3 overexpressed lentivirus.

[0019] Preferably, the concentration of HAMA and GelMA in the bio-ink is 0.5% w / w HAMA+5% w / w GelMA, 1% w / w HAMA+5% w / w GelMA or 1.5% w / w HAMA+5% w / w GelMA.

[0020] Preferably, the bone marrow mesenchymal stem cell extravascular scaffold is manufactured by a 3D bioprinter, each layer has a thickness of 200 μm, and the final size is 1.5 cm x 1.5 cm; after printing, the glass sheet carrying the printed sample is placed on a blue light source with a wavelength of 405 nm for curing for 45 s.

[0021] Preferably, the extravascular scaffold has a good network scaffold structure and uniform porosity.

[0022] Further, the present application also provides a method for preparing the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold, comprising the following steps:

[0023] (1) Preparation of a biological ink containing SIRT3-overexpressing bone marrow mesenchymal stem cells (BMSCs):

[0024] ① Take 20 ml PBS and add it to a brown bottle containing 0.05 g initiator LAP (lithium phenyl-2,4,6-trimethylbenzoylphosphinate), heat to dissolve in a 40-50℃ water bath for 15 minutes, shake several times during the process, avoid light, wrap with tin paper after dissolving, prepare a 0.25% (w / v) initiator standard solution, store at 4℃;

[0025] ② Take GelMA and HAMA and put them in a 50 ml centrifuge tube, take the initiator standard solution and add it to the centrifuge tube, shake to fully soak and swell; heat to dissolve in a 60-70℃ water bath for 20-30 minutes, shake several times during the process, fully dissolve, obtain a solution containing HAMA and GelMA;

[0026] ③ Dissolve the solution containing HAMA and GelMA in PBS buffer, then immediately sterilize with a 0.22 μm sterile filter and filter into a centrifuge tube to prepare a biological ink containing HAMA and GelMA, wrap with tin paper and store at -20℃, which is used to prepare a biological ink containing SIRT3-overexpressing BMSCs;

[0027] ④ Preparation of a biological ink containing SIRT3-overexpressing BMSCs:

[0028] a Take SIRT3-overexpressing BMSCs with a cell confluence of 80%-90% and good growth state, digest with 0.25% trypsin digestion solution, terminate digestion, wash with PBS and resuspend, then use a Bio-Rat cell counter to count the collected cells;

[0029] b The SIRT3-overexpressing BMSCs suspension is prepared according to 3 x 10 6The cells are distributed into new 15ml centrifuge tubes, centrifuged at 800rpm for 5 minutes, and the supernatant is discarded;

[0030] c 3ml of the bio-ink containing HAMA and GelMA is added into the centrifuge tube containing the BMSCs cell precipitate with SIRT3 overexpression, the cells are resuspended, mixed thoroughly, and gently operated to avoid air bubbles, finally obtaining a bio-ink with a concentration of 1x10 6 BMSCs cells / mL, which is placed in a 37℃, 5% CO2 cell incubator for the next step of 3D bioprinting;

[0031] (2) 3D bioprinting: the bio-ink prepared in step (1) is used to manufacture a bone marrow mesenchymal stem cell extravascular scaffold by a 3D bioprinter, and the printing parameters are as follows: air pressure 0.2 MPa, printing speed 10 mm / s, interval 1 mm, thickness of each layer 200 μm, and 3 layers; the thickness of each layer of the 3D bioprinting is 200 μm, and the final size is 1.5 cm x 1.5 cm; after the printing is completed, the glass sheet carrying the printed sample is placed on a blue light source with a wavelength of 405 nm for curing for 45 s, and the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold is obtained.

[0032] Preferably, the concentration of HAMA and GelMA in the bio-ink is 0.5% w / w HAMA+5% w / w GelMA, 1% w / w HAMA+5% w / w GelMA or 1.5% w / w HAMA+5% w / w GelMA.

[0033] Further, the application also provides an application of the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold in preparing a medical device for improving the long-term patency rate of a vein bridge after a coronary artery bypass grafting.

[0034] Preferably, the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold has good structural stability and biocompatibility, can significantly improve the long-term patency rate of the vein bridge, promote the repair of damaged tissues, and enhance the recovery ability of the vascular function.

[0035] Compared with the prior art, the application has the following beneficial effects:

[0036] 1. The BMSCs with SIRT3 gene overexpression enhance the survival ability and repair efficiency of the cells in a harsh environment.

[0037] 2. The HAMA / GelMA composite material provides excellent mechanical properties and biocompatibility, and ensures the long-term stability of the scaffold.

[0038] 3、Through the 3D bioprinting technology, the scaffold structure design with precise control is realized, the cell microenvironment is optimized, and the treatment effect is improved, the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold can not only significantly improve the long-term patency rate of the venous bridge, but also promote the repair of damaged tissues and enhance the recovery ability of vascular function.

[0039] 4、The application combines advanced 3D bioprinting technology and stem cell therapy to open up a new treatment approach, which is expected to be widely used in future clinical practice.

[0040] In summary, the application provides a new method to improve the treatment effect of cardiovascular diseases, especially an effective solution to the problem of bridge vessel restenosis after coronary artery bypass grafting. This not only brings new hope for clinical treatment, but also provides valuable reference for related research. BRIEF DESCRIPTION OF DRAWINGS

[0041] Figure 1 BMSCs acquisition and morphology;

[0042] (A) BMSCs acquisition and isolation culture;

[0043] (B) BMSCs microscopic morphology (scale bar = 200 μm);

[0044] Figure 2 BMSCs surface marker analysis;

[0045] (A) CD73 expression;

[0046] (B) CD90 expression;

[0047] (C) CD105 expression;

[0048] (D) CD34 and CD45 negative indicators expression;

[0049] Figure 3 SIRT3 expression of BMSCs after overexpression SIRT3 lentivirus infection;

[0050] (A) Western Blot detection of SIRT3 protein expression;

[0051] (B) Quantitative statistics of SIRT3 protein expression;

[0052] (C) qRT-PCR detection of SIRT3 gene expression;

[0053] Figure 4 HAMA / GelMA extravascular scaffold after freeze-drying with different proportions;

[0054] (A) 0.5% w / w HAMA + 5% w / w GelMA;

[0055] (B) 1% w / w HAMA + 5% w / w GelMA;

[0056] (C) 1.5% w / w HAMA + 5% w / w GelMA;

[0057] Figure 5 For scanning electron microscopy observation of HAMA / GelMA extravascular stent with different proportions; (A) 0.5% w / w HAMA + 5% w / w GelMA;

[0058] (B) 1% w / w HAMA + 5% w / w GelMA;

[0059] (C) 1.5% w / w HAMA + 5% w / w GelMA;

[0060] Figure 6 For the mechanical properties of HAMA / GelMA biomaterials with different proportions;

[0061] (A) Compression modulus detection;

[0062] (B) Stress-strain curves of three proportion mixed materials;

[0063] (C) Compression model of three proportion mixed materials;

[0064] Figure 7 For the swelling and degradation of extravascular stent;

[0065] (A) Swelling rate of three groups of concentration ratio;

[0066] (B) Degradation curve of three groups of concentration ratio;

[0067] Figure 8 For the cell survival of extravascular stent;

[0068] (A) PI staining to detect cell survival (scale = 200 μm);

[0069] (B) Comparison of the proportion of living cells in two groups at different times;

[0070] Figure 9 For the cell proliferation of extravascular stent;

[0071] Figure 10 For Doppler ultrasound examination of bridge blood vessel inner diameter;

[0072] (A) Postoperative vascular ultrasound detection of 4 experimental groups;

[0073] (B) Quantitative graph of blood vessel inner diameter of 4 experimental groups;

[0074] Figure 11 To measure the maximum blood flow velocity of the bridging vessels in systole;

[0075] (A) Postoperative vascular ultrasound detection of the 4 experimental groups;

[0076] (B) Quantitative analysis of the maximum blood flow velocity of the bridging vessels in systole of the 4 experimental groups;

[0077] Figure 12 To measure the cell proliferation in the neointima of the bridging vessels;

[0078] (A) Postoperative CD11b immunohistochemical staining of the 4 experimental groups (scale bar = 50 μm); (B) Quantitative analysis of CD11b immunohistochemical staining;

[0079] Figure 13 To measure the endothelial integrity of the bridging vessels;

[0080] (A) Postoperative CD31 immunohistochemical staining of the 4 experimental groups (scale bar = 50 μm);

[0081] (B) Quantitative analysis of CD31 immunohistochemical staining;

[0082] Figure 14 To measure the cell survival in the extravascular stent;

[0083] (A) In vivo imaging of the animals after implantation of the extravascular stent;

[0084] (B) Comparison of the bioluminescence intensity at different times;

[0085] Figure 15 To prepare histopathological sections of important organs;

[0086] HE staining of the important organs of the transplantation stem cell group and the simple surgery group after 8 weeks of postoperative (scale bar = 100 μm);

[0087] These figures show the whole process from cell isolation and identification to the preparation of the extravascular stent by 3D bioprinting technology, and then to the evaluation of the application effect in the animal model. Through these images and corresponding descriptions, the technical details of the application and its actual application effect can be more intuitively understood. DETAILED DESCRIPTION

[0088] The preferred examples of the application will be described in detail below. The examples are provided to better illustrate the application, and the application is not limited to the examples. Non-essential improvements and adjustments to the embodiments according to the application still belong to the scope of the application.

[0089] Example 13 Preparation of the extravascular stent of the bone marrow mesenchymal stem cells by 3D bioprinting

[0090] 1. Cell acquisition and isolation culture

[0091] Isolation of human BMSCs: BMSCs were isolated from the bone marrow blood of the sternum by gradient centrifugation. After centrifugation, from top to bottom, there were plasma layer, circular lymphocyte layer (red flocculent), separation liquid layer and red blood cell layer. After 2 hours of culture, the cells were basically adherent, and were continuously cultured and subcultured to the third generation.

[0092] Figure 1 The process of isolation and culture of BMSCs, and the third generation of BMSCs, were observed under a microscope, and the cells were long spindle-shaped and grew well.

[0093] Identification of human BMSCs: CD73, CD90 and CD105 were positively expressed (more than 95%) by flow cytometry, and CD34 and CD45 were negatively expressed (less than 0.3%), and the results are shown in Figure 2 .

[0094] 2. Construction, transfection and verification of lentiviral vector

[0095] (1) Construction of SIRT3 overexpression lentiviral vector:

[0096] ① The vector used was GV492 lentiviral expression vector plasmid, and the order of tool vector elements was: Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin.

[0097] ② The vector was digested, and the products were subjected to agarose gel electrophoresis, and the target band was recovered.

[0098] ③ Acquisition of target gene fragment: The sequence of human Sirt3 gene (NM_012239) was searched on GenBank, and specific primers for amplification of Sirt3 gene were designed accordingly; the reaction system was prepared to amplify the target gene, and the gene amplification fragment was obtained, and the sequence is shown in SEQ ID NO. 1.

[0099] ④ Using a homologous recombination kit, the PCR amplified target gene product was exchanged and connected into the linearized GV492 lentiviral expression vector plasmid, and was added to the competent E. coli for transformation.

[0100] ⑤ Colony PCR identification.

[0101] ⑥ The identified positive transformant was inoculated in LB liquid medium, and an appropriate amount was taken for sequencing. After correct sequencing, plasmid extraction (TIANGEN, DP117) was performed.

[0102] ⑦Ad-SIRT3 overexpression lentivirus was constructed by Shanghai Jikai Gene Medicine Technology Co., Ltd. The virus titer was 5 x 1010TU / ml.

[0103] ⑧Lentivirus concentration, purification and quality detection, collection of cell supernatant, collection of virus by ultra-high speed centrifuge, and titer analysis after dilution.

[0104] The above SIRT3 overexpression lentivirus was constructed by Shanghai Jikai Gene Medicine Technology Co., Ltd. The virus titer was 5 x 1010TU / ml. 8 TU / ml.

[0105] (2) SIRT3 overexpression lentivirus infection of BMSCs:

[0106] ① Take the third generation BMSCs in good growth state, digest with 0.25% trypsin cell digestion solution, count the cells, and inoculate 5 x 105cells per well into a 12-well plate, gently tap to distribute the cells evenly, and place in a 37℃, 5% CO2 cell incubator. 4

[0107] ② After 24 hours of culture, when the cell density reaches about 60%, SIRT3 overexpression lentivirus infection is performed.

[0108] ③ Replace fresh culture medium 460μl per well, and according to the instructions for using lentivirus, add 25 x HiTransGA infection enhancer 20μl per well to increase the infection efficiency.

[0109] ④ Add SIRT3 overexpression lentivirus in an amount of 20μl per well, gently shake the plate to distribute the liquid evenly, and continue to culture in a 37℃, 5% CO2 cell incubator.

[0110] ⑤ After 12 hours of culture, observe the cell state under an inverted optical microscope, and replace fresh culture medium 1ml per well.

[0111] ⑥ The next day, add puromycin with a final concentration of 5μg / mL to the plate to eliminate cells that have not been infected with lentivirus.

[0112] ⑦ Replace fresh culture medium 1ml per well every other day, and use the same concentration of puromycin to select adherent cells after 24 hours, which are the stably infected cell strain.

[0113] ⑧ Amplify the cell strain for subsequent experiments.

[0114] ​(3) Western Blot detection of the expression of the target gene SIRT3 in BMSCs:

[0115] ① After digestion of BMSCs cells, add lysis buffer (RIPA lysis buffer containing 1 mM PMSF).

[0116] ② Ultrasonic disruption of the cell suspension on ice at a power of 50 W, triggering once every 1 second for 1 minute.

[0117] ③ After lysis, place in a pre-cooled high-speed centrifuge at 4°C, 13,000 rpm, centrifuge for 30 minutes, and collect the supernatant.

[0118] ④ BCA (Beyotime, P0012) method for measuring protein concentration.

[0119] ⑤ Add RIPA lysis buffer to adjust the protein concentration of each sample to 10 μg / mL.

[0120] ⑥ Use each protein sample to dilute 5x SDS-PAGE Loading Buffer to 1x SDS-PAGE Loading Buffer, then place in a preheated metal bath at 100°C, heat at 100°C for 10 minutes, and store in a -20°C refrigerator.

[0121] ⑦ Preparation of SDS-PAGE gel

[0122] As shown in Table 1:

[0123] Table 1 Preparation of SDS-PAGE gel

[0124]

[0125] ⑧ SDS-PAGE gel electrophoresis and PVDF membrane transfer.

[0126] PVDF blotting membrane was blocked with 5% skim milk for 2 hours; after TBST rinsing 3 times, the diluted antibody (SIRT3 Proteintech 10099-1-AP, β-tubulin Proteintech 80713-1-RR) was added and incubated at room temperature for 2 hours; after TBST rinsing, the corresponding secondary antibody was added for incubation.

[0127] ⑨ Development and data analysis

[0128] The results are shown in Figure 3 A, 3B.

[0129] (4) qRT-PCR detection of the expression of the target gene SIRT3 in BMSCs:

[0130] RNA extraction and reverse transcription: RNA was extracted using The cells were lysed by lysis solution and ultrasonic cell disruptor, and then the RNA was purified by adsorption column. The cDNA was synthesized by mixing system in Takara reverse transcription kit.

[0131] The primer sequences are as follows:

[0132] Human SIRT3-F: GAAGTGGAGGCAGCAGTGACAAG

[0133] Human SIRT3-R: CGGCGATCTGAAGTCTGGAATGC

[0134] β-Tublin-F: CAACGCCACCTGTCATCC

[0135] β-Tublin-R: GCGGAAGCAGATGCTGTAGAGC

[0136] qRT-PCR detection: SYBR Green I (Roche FS Universal SYBR Green Master)

[0137] dye was used for qRT-PCR to evaluate the expression level of SIRT3 in BMSCs, and the results are shown in FIG. C. Figure 3

[0138] 3. Bio-ink preparation and 3D printing

[0139] (1) Preparation of HAMA / GelMA (methylacrylated hyaluronic acid (HAMA) / methylacrylated gelatin (GelMA)) bio-ink: Different proportions of HAMA and GelMA were prepared as bio-ink, including 0.5% w / w HAMA + 5% w / w GelMA, 1% w / w HAMA + 5% w / w GelMA, and 1.5% w / w HAMA + 5% w / w GelMA. The specific process is as follows:

[0140] ① Take 20 ml PBS and add it to a brown bottle containing initiator LAP (Lithium phenyl-2,4,6-trimethylbenzoylphosphinate) (containing 0.05 g LAP).

[0141] ② Heat to dissolve for 15 minutes in a 40-50°C water bath, shake several times during the process, and pay attention to avoid light. After dissolution, wrap it with tin foil, and prepare 0.25% (w / v) initiator standard solution, which is stored at 4°C.

[0142] ​③ Take the required mass of GelMA and HAMA into a 50ml centrifuge tube, take the initiator standard solution and add it to the centrifuge tube, shake it to fully infiltrate and swell.

[0143] ④ Heat in a 60-70℃ water bath for 20-30 minutes, avoid light, shake several times during the process, fully dissolve, get a solution containing HAMA and GelMA.

[0144] ⑤ Dissolve the solution containing HAMA and GelMA in PBS buffer, then immediately sterilize it with a 0.22μm sterile filter (to prevent low-temperature gelation), filter it into a 15ml centrifuge tube, prepare the required concentration of bio-ink containing HAMA and GelMA, wrap it with tin paper and store it at -20℃, part of it is used to prepare bio-ink containing SIRT3 overexpressed BMSCs, and part of it is directly used for 3D bioprinting;

[0145] ⑥ Preparation of cell bio-ink:

[0146] a Take SIRT3 overexpressed BMSCs with a growth state of 80%-90% cell confluence, digest them with 0.25% trypsin digestion solution, terminate digestion, wash with PBS and resuspend, then use a Bio-Rat cell counter to count the collected cells.

[0147] b Distribute the SIRT3 overexpressed BMSCs cell suspension into new 15ml centrifuge tubes at 3×10 6 cells per tube, centrifuge at 800rpm for 5 minutes, then discard the supernatant.

[0148] c Add 3ml of bio-ink containing HAMA and GelMA to the centrifuge tube containing the SIRT3 overexpressed BMSCs cell pellet, resuspend the cells and mix thoroughly, handle gently to avoid air bubbles, finally get a bio-ink with a concentration of 1×10 6 cells / mL, place it in a 37℃, 5% CO2 cell incubator for the next step of 3D bioprinting.

[0149] (2) 3D bioprinting: prepare the bio-ink according to the above formula, and use a 3D bioprinter to manufacture a vascular extracorporeal stent suitable for the human environment. The specific operation is as follows:

[0150] ① Turn on the water chiller POWER switch, wait for the initial state of the water chiller to stabilize, then turn on the water chiller circulation switch PUMP, and finally turn on the water chiller COOL switch to start the temperature control function of the water chiller.

[0151] ② Turn on the power switch of the 3D bioprinter, wipe the printing platform with 75% alcohol, and sterilize it with UV light for 30 minutes. After sterilization, turn on the EFU dust removal button, start the computer, open the 3D-Architect software, and click "Connect Device" to connect to the 3D printer.

[0152] ③ New or import project, set print parameters: air pressure 0.2 MPa, print speed 10 mm / s, spacing 1 mm, thickness per layer 200 μm, 3 layers, click "Path Generation" to generate print path.

[0153] ④ Click "Manual Load Nozzle" in "Device Control", install the low-temperature nozzle, and perform 23℃ temperature control processing and 5℃ platform temperature control.

[0154] ⑤ After temperature control, take out the biological ink and place it in a 37℃ water bath until the temperature of the biological ink is constant. Add the biological ink containing SIRT3 overexpressed BMSCs to the light-proof cartridge and place it in a 4℃ pre-cooling for 5 minutes. Install a 27G steel needle and adapter, remove the low-temperature nozzle, and install the above-mentioned cartridge into the low-temperature nozzle.

[0155] ⑥ Reinstall the nozzle and continue the same temperature control processing. Set the manual air pressure to 0.2 MPa and move the X and Y axes to ensure smooth printing in the future.

[0156] ⑦ After placing a sterile glass sheet on the platform, perform device calibration and platform height measurement. After calibration, input the height compensation value -0.35 (glass sheet thickness).

[0157] ⑧ Click "Start Printing" to start printing. The thickness of each layer is 200 μm and the final size is 1.5 cm x 1.5 cm. After printing, place the glass sheet carrying the printed sample under a wavelength of 405 nm blue light source for 45 seconds.

[0158] ⑨ Further observe the structure and morphological characteristics under a scanning electron microscope to ensure good network scaffold structure and uniformity of pores.

[0159] The printed extravascular scaffold is first frozen in a -80℃ refrigerator for 24 hours, then placed in a freeze dryer for 48 hours, Figure 4 The network structure is more compact as the concentration of HAMA increases.

[0160] Figure 5 Further observe the structure and morphological characteristics under a scanning electron microscope. The network scaffold structure has similar and stable three-dimensional scaffold structure, uniform pores, which is conducive to cell growth in the scaffold and communication between cells.

[0161] 4. Physical property testing

[0162] Mechanical property, swelling property and degradation property test: A series of physical property tests were performed on the printed patch (patch without SIRT3 overexpressed BMSCs) to ensure its structural stability.

[0163] ① Since the printed mixed material patch is thin, only 600 μm thick, the general biomechanical tester cannot measure its compression modulus. In order to match the mechanical tester range, at the same time better and more accurate detection of the mechanical properties of the mixed material, the material is added to the standard cylindrical mold with an inner diameter of 10 mm and a height of 8 mm. The biomechanical tester is connected to the computer, the software is opened and the device is connected; the motor is zeroed, the sample is placed on the test platform center and weighed, the skin is removed; new test, set test parameters: sample cross-sectional area 78.54 mm2, sampling frequency 500 point / minute, measurement speed 1 mm / minute, compression mode single compression, i.e. fixed load 2N, holding time 10 seconds; start test, after the test is completed, collect measurement data, draw stress-strain curve with origin drawing software, calculate compression modulus according to the initial end of the curve. The calculation formula is: compression modulus = stress / strain.

[0164] ② The mixed material patch prepared above is placed in a 6-well plate containing PBS, and placed in a 37℃, 5% CO2 cell incubator for swelling for 24 hours. After wiping the surface moisture with sterile absorbent paper, the weight is measured and recorded as W(wet); after weighing, it is immediately placed in a-80℃ refrigerator, frozen for 24 hours, then freeze-dried, and then weighed again, recorded as W(dry); the swelling rate is calculated according to the ratio of wet weight to dry weight, i.e. swelling rate = W(wet) / W(dry).

[0165] ③ After swelling for 24 hours as described above, wipe and weigh, record as the first day weight W1; replace PBS every 2 days, then take out the patch on the 3rd, 7th, 10th, 14th, 21st day, wipe and weigh, record as W3, W7, W10, W14, W21 respectively; W1 weight is the reference to calculate the degradation rate. That is, degradation rate = (W1-W3, 7, 10, 14, 21) / W1 x 100%.

[0166] Figure 6For the mechanical property test results, it can be seen that with the increase of HAMA concentration, the compression modulus is improved, and there is a significant statistical significance. In this study, the mechanical properties of the mixed material need to meet the rat arterial blood pressure of 85-115 mmHg (about 11.3-15.3 kPa) and the normal human arterial blood pressure of 80-120 mmHg (about 10.7-16.0 kPa), among which 1% HAMA+5% GelMA and 1.5% HAMA+5% GelMA meet the requirements, but considering the deviation between the compression modulus of the cylinder and the compression modulus of the prepared extra-vessel stent, 1.5% HAMA+5% GelMA with higher material compression modulus is selected for subsequent experiments.

[0167] Figure 7 For the swelling and degradation of the extra-vessel stent, the weight of the extra-vessel stent with three different concentration ratios was detected by hydrolysis method at 1, 3, 7, 10, 14, 21, and 28 days after printing, to analyze the degradation of the stent with different concentrations of HAMA. The three groups of extra-vessel stents all have different degrees of degradation, and the original 35% is not lost after 4 weeks of degradation, and there is no statistical difference, but overall, the high concentration HAMA degrades relatively slowly.

[0168] 5. Cell compatibility evaluation: SIRT3 overexpressed BMSCs were added to the bio-ink to make 3D bio-printed HAMA / GelMA-BMSCs biological patches, and the cell compatibility was evaluated.

[0169] 5.1 Cell survival:

[0170] In this experiment, Calcein / PI live and dead cell staining kit was used to detect cell survival at 1, 4, and 7 days, and the steps were as follows:

[0171] ① The detected patch was cut into 4 equal parts according to the size of 0.75 cm x 0.75 cm, and then transferred to a 12-well plate for subsequent detection.

[0172] ② According to the reagent kit, Calcein / PI staining working solution was prepared, that is, CalceinAM (1000x) and PI (1000x) were diluted 1000 times with detection buffer to prepare the working solution. The working solution cannot be stored, and it must be prepared fresh.

[0173] ③ After rinsing the patch with PBS for 3 times, 500 μl of the above detection working solution was added to each well, and incubated at 37°C in the dark for 30 minutes.

[0174] ④ After incubation, the cell survival was observed under a laser confocal microscope.

[0175] 5.2 Cell proliferation:

[0176] The CCK-8 kit was used to detect the cell proliferation of the patch at 1, 4, and 7 days, and the steps were as follows:

[0177] ①Similarly, the patch was divided into four parts and transferred to a 12-well plate for subsequent detection.

[0178] ②The CCK-8 solution was added to the fresh cell culture medium to prepare 10% detection solution.

[0179] ③Add 1 ml of detection solution to each detection well. Add an equal amount of detection solution without a patch as a blank control.

[0180] ④Incubate at 37°C in a 5% CO2 cell incubator for 2 hours, then remove the detection solution from the wells and transfer 100 μl of the system to a 96-well plate for absorbance detection.

[0181] ⑤Finally, measure the absorbance at 450 nm using a microplate reader.

[0182] Figure 8 With Figure 9 PI cell staining and CCK-8 method were used to detect cell survival and proliferation at 1, 4, and 7 days, respectively, and comparative analysis was performed. At 1 day, there was no significant difference in cell survival between the two groups; at 4 days, there was a significant statistical difference, and the survival rate of SIRT3-infected BMSCs was slightly higher than that of normal BMSCs; at 7 days, the survival rate of SIRT3-infected BMSCs was higher than that of normal BMSCs, and the difference was extremely statistically significant (P<0.05).

[0183] 6, Animal model establishment and effect evaluation:

[0184] ①Establishment of rat arteriovenous graft model:

[0185] A rat arteriovenous graft model was established, and the above-mentioned biological patch was used to observe its effect on the long-term patency rate of the venous bridge. The specific operation was as follows:

[0186] The rat operation area was prepared for skin, iodophor was used to disinfect the operation area for 3 times, and sterile drape was laid; the skin was cut with scissors along the median longitudinal line of the neck, about 2 cm long, and the subcutaneous tissue and muscle were bluntly separated; the right jugular vein was isolated, the 6-0 suture was divided into 3 strands, and the corresponding branches of the vein were ligated with a single strand, the jugular vein about 6 mm was cut off as a vein bridge, and the lumen was repeatedly flushed with heparin saline until no blood remained in the bridge vessel; the left common carotid artery was isolated, the proximal and distal ends were clamped with hemostatic clips, the common carotid artery was cut, and the bridge vessel was anastomosed to the cut common carotid artery with 11-0 suture, it is worth noting that the two ends of the vascular cross section are anastomosed first, then 2 stitches are sutured on each side, a total of 6 stitches are anastomosed; the distal end hemostatic clip is loosened, and the anastomotic stoma is checked for bleeding, if there is bleeding, use a cotton swab to press, try not to add a stitch, so as to prevent the anastomotic stoma from being narrowed. Open the proximal end hemostatic clip and repeat the above check and operation; print the external vascular stent according to the experimental grouping in advance and perform blue light curing, it is worth noting that the total light curing time is 45 seconds, first perform 15 seconds of light curing, then curl the patch and perform 30 seconds of light curing, in order to facilitate the implantation of the external vascular stent; implant the external vascular stent according to the experimental grouping, and suture the neck incision with 4-0 suture. Subcutaneous injection of 160,000 U of penicillin, and supplement 2 ml of normal saline.

[0187] ②Effect evaluation method: The state of the bridge vessel was evaluated by Doppler color ultrasound, and the pathological morphology, extracellular matrix deposition and expression of target protein were evaluated by HE staining, Masson staining and immunohistochemical staining. The specific operation is as follows:

[0188] Color Doppler ultrasound detection:

[0189] After the above anesthesia, the diameter and maximum blood flow velocity in systole of the bridge vessel were detected by vascular ultrasound at 2, 4, 6 and 8 weeks after operation to evaluate the effect of 3D bioprinted cardiovascular stent on long-term patency of the vein bridge.

[0190] Vessel sampling:

[0191] At 2, 4, 6 and 8 weeks after operation, the rats were sacrificed and the implanted bridge vessels were taken out, the specific operation was as follows:

[0192] (1) Anesthesia, skin preparation

[0193] (2) Open chest and fully expose the heart, apply cardioplegia (containing 10% KCl) to the aortic root for perfusion, insert a disposable infusion needle of 0.55 mm x 20 mm size into the apex of the heart, cut open the right atrial appendage, then slowly inject 20 ml of 0.9% normal saline into the heart until the lungs turn white.

[0194] (3) After the graft vein and other organs are removed, they are washed with physiological saline and fixed with 4% PFA solution for subsequent experiments.

[0195] (4) The tissue sample is fixed in 4% PFA and should not be left for more than 24 hours. If it is left for more than 24 hours, the tissue sample should be transferred to 75% alcohol in time.

[0196] Preparation of paraffin sections:

[0197] (1) The required sample is washed with PBS to remove the residual fixative.

[0198] (2) Dehydration: Place each tissue sample in a paraffin embedding box and dehydrate it in a gradient ethanol solution. The gradient sequence is shown in Table 2 below:

[0199] Table 2

[0200]

[0201] (3) Transparency: Further dehydration and xylene transparency treatment, the order is shown in Table 3 below:

[0202] Table 3

[0203]

[0204] (4) Wax immersion: Remove the residual xylene and perform wax immersion treatment, the order is shown in Table 4 below:

[0205] Table 4

[0206]

[0207] (5) Embedding: After the above-mentioned treatment, the tissue is embedded with liquid paraffin, placed on a cooling table, and after solidification, the wax block is removed for subsequent experiments.

[0208] (6) Sectioning: Load the paraffin block onto a paraffin sectioning machine, section after trimming, thickness is 4 μm, fully expand in a 42℃ water bath, use a glass slide to lift it onto the sectioning rack, and then place it in a 60℃ oven for 2 hours.

[0209] (7) Sectioning and hydration: In order to make the tissue sample section react with the staining agent in a hydrophilic environment, deparaffinization and hydration treatment are required, the order is shown in Table 5:

[0210] Table 5

[0211]

[0212] (8) The section is used for subsequent experiments.

[0213] Evaluation of pathological morphology by HE staining:

[0214] (1) After staining the tissue sample section with hematoxylin for 2 minutes, remove the excess liquid with distilled water and absorb the remaining liquid with a paper towel.

[0215] (2) Then, add the differentiation solution dropwise to cover the tissue area, differentiate at room temperature for 1 minute, and then wash with tap water for 2 times, 5 minutes each time, and absorb the excess water stains with a paper towel.

[0216] (3) Stain the tissue section with eosin for 2 minutes, tilt the slide to remove the excess water stains, and then dehydrate and transparentize in the following order according to Table 6:

[0217] Table 6

[0218]

[0219] (4) Place the section in a fume hood to volatilize the residual xylene, and after drying, add an appropriate amount of neutral balsam to seal the section, and then store or observe under an optical microscope.

[0220] Masson staining is used to evaluate the deposition of extracellular matrix:

[0221] In this study, Masson's trichrome staining kit is used for detection, and the specific steps are as follows in Table 7:

[0222] Table 7

[0223]

[0224] Observe and take pictures using an inverted optical microscope.

[0225] Immunohistochemical staining is used to evaluate the expression of target proteins:

[0226] (1) Antigen retrieval: Use sodium citrate-EDTA antigen retrieval solution to perform antigen retrieval on the tissue sample section, and soak in PBS for 3 times, 5 minutes each time.

[0227] (2) Endogenous peroxidase inactivation: Hydrate the tissue sample section for 5 minutes, add 3% H2O2 solution for 10 minutes, and soak in PBS for 3 times, 5 minutes each time.

[0228] (3) Antigen blocking: Add 2% BSA and incubate at room temperature for 15 minutes, and then spin dry.

[0229] (4) Incubate the primary antibody: After dilution, add the target protein primary antibody, incubate at 4°C overnight, and then soak in PBS for 3 times, 5 minutes each time.

[0230] (5) Incubate the secondary antibody: After dilution, add the secondary antibody, incubate at room temperature for 15 minutes, and then soak in PBS for 3 times, 5 minutes each time.

[0231] (6) Biotin-streptavidin reaction: streptavidin working solution was added dropwise, incubated at room temperature for 15 minutes, and soaked in PBS for 3 times, 5 minutes each time.

[0232] (7) DAB color development: DAB color development working solution was added dropwise to the tissue position of the section, and the staining was terminated immediately when yellow appeared in the target position.

[0233] (8) Counterstaining: stained with hematoxylin for 3 minutes, observed under a microscope, the cell nucleus showed red color, the cytoplasm was lightly stained, differentiated with hydrochloric acid alcohol for 1 second, soaked in tap water for 3 minutes, and observed under a microscope again.

[0234] (9) Routine dehydration, transparency, mounting, observation under a microscope and photography.

[0235] Live imaging analysis: animal live imaging analysis was performed at 1, 2 and 4 weeks after operation to evaluate the survival of transplanted stem cells. A 15 mg / ml D-fluorescein salt solution was prepared, and the signal reached a stable plateau 20 minutes after intraperitoneal injection of D-fluorescein. The fluorescence intensity was analyzed using Living Image software version 4.4.

[0236] Data analysis:

[0237] All data are expressed as mean ± standard deviation, and statistical analysis was performed using GraphPad Prism 10 statistical software. Paired Student's t-test was used for comparison between two groups, and one-way ANOVA was used for comparison among three or more groups. P<0.05 was considered statistically significant.

[0238] Results:

[0239] Figure 10 With Figure 11 The diameter of the bridge blood vessel and the maximum blood flow velocity in the systolic phase were compared with the simple operation group, and the other three groups were improved to different degrees, which could inhibit the decrease of the diameter of the bridge blood vessel and reduce the maximum blood flow velocity in the systolic phase. Among them, the SIRT3 stem cell stent group had the best patency rate of the venous bridge blood vessel, i.e. the largest diameter of the venous bridge blood vessel and the smallest maximum blood flow velocity in the systolic phase at 8 weeks, followed by the stem cell stent group and the stent group, and the difference was statistically significant. The results showed that the SIRT3 stem cell stent group could significantly improve the long-term patency rate of the venous bridge blood vessel in the arteriovenous transplantation model of rats.

[0240] Figure 12 PCNA immunohistochemical staining was used to evaluate the cell proliferation of the neointima of the transplanted venous bridge blood vessel. The three stent experimental groups inhibited the cell proliferation in the neointima of the venous bridge after arteriovenous transplantation, and the SIRT3 stem cell stent group had the strongest effect on cell proliferation inhibition.

[0241] Figure 13 The condition of re-endothelialization of the venous bridge vessels was evaluated by CD31 immunohistochemical staining. The re-endothelialization condition of the bridge vessels was observed at 14 days after the operation, and the re-endothelialization condition of the three experimental groups was improved, and the condition of the stem cell scaffold group and the SIRT3 stem cell scaffold group was better than that of the scaffold group, and the re-endothelialization of the SIRT3 stem cell scaffold group was the best.

[0242] Figure 14 The BMSCs were labeled with fluorescein by using cell tracing technology, the extravascular scaffold was prepared by 3D bioprinting technology and applied to the venous bridge vessels, and the survival condition of the cells was observed by animal live imaging technology at 1, 2 and 4 weeks after the operation, and the survival amount of the BMSCs was quantified by the bioluminescence signal intensity. It can be concluded that the BMSCs still have considerable survival amount in the animal body at 4 weeks.

[0243] Figure 15 The HE staining method was used to observe whether there were obvious pathological manifestations such as hemorrhage, inflammatory infiltration and necrosis in important organs (heart, liver, spleen, lung and kidney) in vivo. At 8 weeks after the operation, the important organs of the normal rats were compared and no above-mentioned pathological manifestations were found. The results show that the use of the stem cell extravascular scaffold does not cause damage to the important organs.

[0244] Through the above specific embodiments, the present application provides an innovative method to improve the treatment effect of cardiovascular diseases, especially an effective solution to the problem of bridge vessel restenosis after coronary artery bypass grafting. Combined with advanced 3D bioprinting technology and stem cell therapy, a new treatment approach is opened up, which is expected to be widely used in future clinical practice.

Claims

1. A 3D bioprinted extravascular scaffold of mesenchymal stem cells for bone, characterized in that, The 3D bioprinted BMSCs extravascular scaffold is obtained by 3D bioprinting from a biological ink containing SIRT3-overexpressed BMSCs (BMSCs), wherein the biological ink contains hyaluronic acid methacrylate (HAMA) and gelatin methacrylate (GelMA).

2. The 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold of claim 1, wherein, The mass ratio of hyaluronic acid methacrylate (HAMA) and gelatin methacrylate (GelMA) is 0.5-1.5:

5.

3. The 3D bioprinted mesenchymal stem cell extravascular scaffold of claim 1, wherein, The biological ink containing SIRT3-overexpressed BMSCs (BMSCs) is prepared by the following method: ①Take 20ml PBS, add 0.05g initiator LAP (Lithium phenyl-2,4,6-trimethylbenzoylphosphinate) into a brown bottle, heat to dissolve for 15 minutes in a 40-50℃ water bath, shake several times during the period, avoid light, after dissolving, wrap with tin paper, prepare 0.25%(w / v) initiator standard solution, store at 4℃; ②Take GelMA and HAMA into a 50ml centrifuge tube, take the initiator standard solution and add it to the centrifuge tube, shake to fully infiltrate and swell; heat at 60-70℃ water bath in the dark for 20-30 minutes, shake several times during the period, fully dissolve, obtain a solution containing HAMA and GelMA; ③Dissolve the solution containing HAMA and GelMA in PBS buffer, then immediately sterilize with a 0.22μm sterile filter, filter into a centrifuge tube, prepare a biological ink containing HAMA and GelMA, wrap with tin paper, store at -20℃, for preparing a biological ink containing SIRT3-overexpressed BMSCs; ④Preparation of a biological ink containing SIRT3-overexpressed BMSCs: aTake SIRT3-overexpressed BMSCs in good growth state with a cell confluence of 80%-90%, digest with 0.25% trypsin digestion solution, terminate digestion, wash with PBS and resuspend, then use a Bio-Rat cell counter to count the collected cells; bSIRT3 overexpressed BMSCs suspension was distributed into new 15 ml centrifuge tubes at 3 x 10 6 cells per tube, centrifuged at 800 rpm for 5 minutes, and the supernatant was discarded. c Add 3 ml of bio-ink containing HAMA and GelMA into the centrifuge tube containing SIRT3 overexpressed BMSCs cell pellet, resuspend the cells, mix well, and avoid generating bubbles, finally get the bio-ink with the concentration of 1 x 10 6 BMSCs cells / mL, and place in a 37 °C, 5% CO2 cell incubator for the next step of 3D bio-printing.

4. The 3D bioprinted mesenchymal stem cell extravascular scaffold of claim 1, wherein, The concentration of HAMA and GelMA in the biological ink is 0.5%w / w HAMA+5%w / w GelMA, 1%w / w HAMA+5%w / w GelMA or 1.5%w / w HAMA+5%w / w GelMA.

5. The 3D bioprinted mesenchymal stem cell extravascular scaffold of claim 1, wherein, A BMSCs extravascular scaffold is manufactured by a 3D bioprinter, with a thickness of 200μm per layer and a final size of 1.5cm×1.5cm, after printing, the glass sheet carrying the printed sample is placed on a wavelength 405nm blue light source for curing for 45s.

6. The 3D bioprinted mesenchymal stem cell extravascular scaffold of claim 1, wherein, The extravascular scaffold has a good network scaffold structure and uniform porosity.

7. A method of preparing the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold of any one of claims 1-6, characterized in that, The method comprises the following steps: (1) Preparation of a biological ink containing SIRT3-overexpressed BMSCs (BMSCs): ①Take 20 ml PBS, add 0.05 g initiator LAP (Lithium phenyl-2,4,6-trimethylbenzoylphosphinate) to a brown bottle, heat to dissolve for 15 minutes in a 40-50℃ water bath, shake several times during the process, avoid light, after dissolution, wrap with tin paper, prepare 0.25% (w / v) initiator standard solution, store at 4℃; ②Take GelMA and HAMA into a 50 ml centrifuge tube, take the initiator standard solution and add it to the centrifuge tube, shake to fully infiltrate and swell; heat to dissolve for 20-30 minutes in a 60-70℃ water bath, shake several times during the process, fully dissolve, obtain a solution containing HAMA and GelMA; ③Dissolve the solution containing HAMA and GelMA in PBS buffer, then immediately sterilize with a 0.22μm sterile filter, filter into a centrifuge tube, prepare a bio-ink containing HAMA and GelMA, wrap with tin paper, store at -20℃, for preparing a bio-ink containing SIRT3 overexpressed BMSCs; ④Preparation of a bio-ink containing SIRT3 overexpressed BMSCs: aTake SIRT3 overexpressed BMSCs in good growth condition with a cell confluence of 80%-90%, digest with 0.25% trypsin digestion solution, terminate digestion, wash with PBS and resuspend, then count the collected cells using a Bio-Rat cell counter; bSIRT3 overexpressed BMSCs suspension was distributed into new 15 ml centrifuge tubes at 3 x 10 6 cells per tube, centrifuged at 800 rpm for 5 minutes, and the supernatant was discarded. c Add 3 ml of bio-ink containing HAMA and GelMA into the centrifuge tube containing SIRT3 overexpressed BMSCs cell pellet, resuspend the cells, mix well, and avoid generating bubbles, finally obtain the bio-ink with the concentration of 1 x 10 6 BMSCs cells / mL, and place in a 37°C, 5% CO2 cell incubator for the next step of 3D bio-printing; (2) 3D bioprinting: prepare a bone marrow mesenchymal stem cell extravascular scaffold by 3D bioprinting the bio-ink prepared in step (1), printing parameters: air pressure 0.2 MPa, printing speed 10 mm / s, interval 1 mm, thickness per layer 200μm, 3 layers; the thickness of each layer of 3D bioprinting is 200μm, the final size is 1.5cm×1.5cm, after printing, place the glass sheet carrying the printed sample under a wavelength 405nm blue light source for curing for 45s, obtain the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold.

8. The method of claim 7, wherein, The concentration of HAMA and GelMA in the bio-ink is 0.5% w / w HAMA+5% w / w GelMA, 1% w / w HAMA+5% w / w GelMA or 1.5% w / w HAMA+5% w / w GelMA.

9. Use of the 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold of any one of claims 1-6 in the preparation of a medical device for improving the long-term patency rate of a vein bridge after coronary artery bypass grafting.

10. Use according to claim 9, wherein The 3D bioprinted bone marrow mesenchymal stem cell extravascular scaffold has good structural stability and biocompatibility, can significantly improve the long-term patency rate of a vein bridge, promote the repair of damaged tissues and enhance the recovery ability of vascular function.

Images