PbrCBF6 gene related to low-temperature stress of pears and application of PbrCBF6 gene

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly relates to a PbrCBF6 gene related to low-temperature stress of pears and application of the PbrCBF6 gene. The nucleotide sequence of the PbrCBF6 gene is as shown in SEQ ID NO. 1. The invention discloses a nucleotide sequence of a PbrCBF6 gene for regulating and controlling the low-temperature stress resistance of pears and an amino acid sequence coded by the PbrCBF6 gene, and experiments show that the PbrCBF6 gene or a biological material containing the PbrCBF6 gene can be applied to regulating and controlling the low-temperature stress resistance of the pears. The invention provides a new gene resource for molecular breeding of pears.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of plant genetic engineering, and particularly relates to a PbrCBF6 gene related to low temperature stress of pear and application thereof. BACKGROUND

[0002] CBF (CRT / DRE-binding factor) belongs to a subfamily of AP2 / ERF transcription factor family members, and is mainly involved in response to abiotic stress (such as low temperature, drought, salt stress, etc.). CBF gene enhances the stress resistance of plants by regulating the expression of downstream stress resistance genes (REN et al., 2006). In Arabidopsis, the CBF family contains three members: CBF1, CBF2 and CBF3, which are arranged in tandem on chromosome 4 and are induced to express under low temperature conditions (Gilmour et al., 1998). In other plants, the number and distribution of CBF family members are different. For example, in grape, 18 CBF genes are identified, distributed on 10 chromosomes (Xiang et al., 2023); in cotton, 7 CBF genes are identified, distributed on different chromosomes (Guo et al., 2011); in tomato, 3 CBF genes (SPL1, SPL2, SPL3) are identified. CBF genes have been reported to have low temperature stress resistance function in Arabidopsis, tomato and apple.

[0003] However, the function of pear CBF gene in regulating plant resistance to low temperature stress has not been reported, and the transcription factor inhibiting the transcription of pear CBF gene has not been reported. SUMMARY

[0004] In order to solve the problems in the prior art, one of the purposes of the present application is to provide a PbrCBF6 gene related to low temperature stress of pear, the nucleotide sequence of the PbrCBF6 gene is shown as SEQ ID NO. 1; the amino acid sequence encoded by the PbrCBF6 gene is shown as SEQ ID NO. 2.

[0005] The second purpose of the present application is to provide an application of the PbrCBF6 gene in regulating the low temperature stress resistance of pear as described above.

[0006] Preferably, the application is to cultivate a new variety of pear with high low temperature stress resistance by using the PbrCBF6 gene.

[0007] Preferably, the application is to improve the ability of pear to resist low temperature stress by improving the expression or activity of the PbrCBF6 gene; or to reduce the ability of pear to resist low temperature stress by inhibiting the expression or activity of the PbrCBF6 gene.

[0008] Preferably, the expression of the PbrCBF6 gene is improved by a PbrCBF6 overexpression vector, the PbrCBF6 overexpression vector pCAMBIA1305-PbrCBF6, the PCR product of the PbrCBF6 gene is obtained by taking pear tissue culture seedling cDNA as a template, and the pCAMBIA1305 vector is connected to obtain.

[0009] Preferably, the primer sequence for obtaining the PCR product of the PbrCBF6 gene is as follows: the upstream primer sequence is shown in SEQ ID NO. 3, and the downstream primer sequence is shown in SEQ ID NO. 4.

[0010] The third object of the present application is to provide a construct for improving or inhibiting the expression amount of the PbrCBF6 gene in pear, wherein the construct contains the PbrCBF6 gene as described above.

[0011] The fourth object of the present application is to provide a host cell containing the construct as described above.

[0012] Preferably, the host cell is Agrobacterium.

[0013] The fifth object of the present application is to provide an application of the construct as described above or the host cell as described above in regulating the low-temperature stress resistance of pear.

[0014] The present application has the following beneficial effects:

[0015] 1) The present application discloses a pear CBF transcription factor gene PbrCBF6 and a protein encoded by the gene, which is reported for the first time in pear. The functional verification of the pear callus shows that the overexpression of the gene significantly promotes the low-temperature tolerance of the pear callus and Arabidopsis, and thus is expected to be introduced into plants as a target gene to improve the low-temperature tolerance of the plants, thereby improving the plant varieties.

[0016] 2) The present application uses biochemical and molecular biological and transgenic technical means to explore the molecular regulation mechanism of the PbrCBF6 gene in regulating the low-temperature stress resistance of pear, thereby providing a new gene resource for the molecular breeding of pear. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 is the relative expression amount change of the PbrCBF6 gene under low-temperature treatment in Example 2, wherein the pear plants are subjected to low-temperature treatment for 0 h, 1 h, 3 h, 6 h, 9 h and 12 h, and the expression amount of the PbrCBF6 gene at each time period under low-temperature treatment is analyzed.

[0018] Figure 2Figure 1 is a phenotype diagram of the PbrCBF6 transgenic Arabidopsis lines and wild type material in Example 4 after 1 h treatment at 25℃ and -10℃ and then 3 d culture at 25℃ in the medium, wherein PbrCBF6-OE1 and PbrCBF6-OE2 represent two overexpressed transgenic lines, and WT is the wild type.

[0019] Figure 3 Figure 2 is the survival rate of Arabidopsis under low temperature treatment of PbrCBF6 gene in Example 4 at 25℃ and -10℃, wherein PbrCBF6-OE1 and PbrCBF6-OE2 represent two overexpressed transgenic lines, and WT is the wild type.

[0020] Figure 4 Figure 3 is the electrolyte permeability of Arabidopsis under low temperature treatment of PbrCBF6 gene in Example 4 at 25℃ and -10℃, wherein PbrCBF6-OE1 and PbrCBF6-OE2 represent two overexpressed transgenic lines, and WT is the wild type.

[0021] Figure 5 Figure 4 is a phenotype diagram of the callus of the transgenic pear in Example 5 in MS medium under 25℃ and 4℃ treatment, wherein PbrCBF6-OE1 and PbrCBF6-OE2 represent two overexpressed transgenic lines, and WT is the wild type.

[0022] Figure 6 Figure 5 is the fresh weight of the callus of the transgenic pear in Example 5 in MS medium under 25℃ and 4℃ treatment, wherein PbrCBF6-OE1 and PbrCBF6-OE2 represent two overexpressed transgenic lines, and WT is the wild type.

[0023] Figure 7 Figure 6 is the relative expression of WT and transgenic callus PbrCBF6 under 4℃ treatment in Example 5, wherein PbrCBF6-OE represents an overexpressed transgenic line, and WT is the wild type. DETAILED DESCRIPTION

[0024] In order to facilitate understanding, the technical solutions of the present application are described in more detail below in combination with examples.

[0025] Example 1

[0026] Obtaining of PbrCBF6 gene

[0027] Young pear leaves were placed in a mortar and frozen and ground into powder using liquid nitrogen. RNA extraction was completed by following the operation of the RNA extraction kit. After obtaining the RNA sample, the cDNA was converted according to the instructions of the cDNA reverse transcription kit, and stored in an environment of -20℃ for subsequent use.

[0028] The applicant identified PbrCBF6 from pear and found the coding sequence of the gene. Specific primers were designed using Primer Premier 5 software:

[0029] PbrCBF6-F: ATGGCAAATTTAACCGATGATAG;

[0030] PbrCBF6-R: TTAAAAAACCTTTTGCAGGGAT.

[0031] The cDNA of pear was used as a template for PCR amplification using DNA polymerase. The reaction system was: DNA polymerase 25 μl, cDNA 2 μl, upstream primer 2 μl, downstream primer 2 μl, and sterile water 19 μl. The amplification parameters were set as follows: initial 95°C pre-denaturation for 1 min, followed by entering the cycle, including 95°C denaturation for 15 s, 60°C annealing for 15 s, and 72°C extension for 40 s, a total of 35 cycles; finally, 72°C extension for 1 min. The amplified product was verified by agarose gel electrophoresis. After verification, the target fragment was recovered by gel cutting. The recovered product was sent to a sequencing company for sequencing to obtain the complete gene sequence. The gene was named PbrCBF6, the amino acid sequence is shown as SEQ ID NO. 1, and the nucleotide sequence is shown as SEQ ID NO. 2.

[0032] Example 2

[0033] Expression analysis of PbrCBF6 gene

[0034] Rooted pear tissue culture seedlings were selected, and after the growth state was stable, the roots were subjected to low temperature treatment. After treatment, samples were taken at 0 h, 1 h, 3 h, 6 h, 9 h, and 12 h, and were quickly frozen in liquid nitrogen and stored in a -80°C refrigerator. Total RNA was extracted from the samples using an RNA extraction kit and was reverse transcribed into cDNA.

[0035] Quantitative primers were designed according to the PbrCBF6 sequence:

[0036] PbrCBF6-qPCR-F: ATATGGCTCGGAACTTTCACTA;

[0037] PbrCBF6-qPCR-R: AACTCCTCCTCATCCAAATACA.

[0038] Using the Actin gene of pear as an internal reference, the reaction system was prepared according to the instructions of the kit, and each reaction was repeated 3 times. On the fluorescence quantitative PCR instrument, the reaction program was set as: 95℃ pre-denaturation for 2min, 95℃ denaturation for 15s, 58℃ annealing for 30s, 40 cycles; finally, the melting curve analysis was carried out, and the temperature was set to 72℃. Each time node sample was set with 3 biological repeats. Finally, the data of each sample was processed and analyzed by 2 -ΔΔCT Method. See Figure 1 The experimental results show that the expression of PbrCBF6 is significantly increased after low temperature treatment for 3h and 12h.

[0039] Example 3

[0040] Construction of the overexpression vector of PbrCBF6 gene

[0041] PbrCBF6 was constructed into the overexpression vector, and KpnI and BamHI two enzyme digestion sites were selected on the overexpression vector pCAMBIA1305. Then, PbrCBF6 primers were designed, and the vector homologous sequences corresponding to the enzyme digestion sites were added before and after the primers. The primers are as follows:

[0042] P5: gagaacacgggggactctaga ATGGCAAATTTAACCGATGATAG (SEQ ID NO. 3);

[0043] P6: gcccttgctcaccatggatcc TTAAAAAACCTTTTGCAGGGAT (SEQ ID NO. 4).

[0044] The pCAMBIA1305 vector was double-digested by KpnI and BamHI two restriction endonucleases to obtain the linearized vector.

[0045] The cDNA extracted from the leaves of pear was used as a template to amplify PbrCBF6 by primers. The amplified product was recovered by a kit, and then was connected to a vector and transformed into E. coli (DH5a) competent cells. The transformation procedure included: the product was put in an ice bath for 30 min, treated in a 42°C metal bath for 45 s, and then put in an ice bath for 5 min. The tube was put in a 37°C shaker with LB liquid medium without antibiotics, and cultured for 1 h. The bacteria were collected and spread on a plate medium containing the corresponding antibiotic. After 12 h, single colonies were selected and inoculated in LB liquid medium containing the same concentration of kanamycin. Whether the colonies containing the target band were successfully obtained was confirmed by PCR amplification and agarose gel electrophoresis detection. After sequencing verification, 50% glycerol was added in proportion, and the strain was stored in a -80°C refrigerator for subsequent use.

[0046] Example 4

[0047] Arabidopsis transformation and screening

[0048] The transgenic Arabidopsis was obtained by using the Agrobacterium-mediated inflorescence infection method. The Arabidopsis plants at the flowering stage were selected, and the excess flowers and pods were removed to leave the flower buds. Then, the infection liquid was prepared, and the MS liquid medium was added with sucrose (the final concentration was 30 g / L) and Silwet L-77 (the final concentration was 200 μl / L). The Agrobacterium carrying the PbrCBF6 overexpression vector was activated, and the bacteria were shaken to OD 600 = 0.8-1.0. The Agrobacterium was centrifuged, and the supernatant was discarded. Then, the Agrobacterium precipitate was resuspended with the infection liquid. Then, the Arabidopsis inflorescences were completely immersed in the infection liquid for 60 s, and the flowers were completely wrapped with plastic wrap after the infection to keep moist, and were cultured in the dark for 1 d. The next day, the plastic wrap was opened, and the flowers could be re-infected after 5-6 d. The seeds were washed and dried, and then were uniformly sowed on the screening medium containing hygromycin, and were cultured in a light incubator. After 2-3 true leaves grew out of the seedlings, the leaf DNA of the seedlings with normal growth and developed root system was extracted for identification, and the positive plants were T0 plants. The T0 generation seeds were harvested, and the positive lines obtained were continuously planted, and the seeds of single plant were harvested.

[0049] An appropriate amount of transgenic Arabidopsis and wild-type Arabidopsis seeds were washed and dried, and then were sowed on normal MS medium. After 1 week of normal culture in a 25°C light incubator, the plants were transplanted into soil and grown in a greenhouse. After 20 d, the plants were treated at a low temperature of -10°C for 1 h, and then were cultured at 25°C for 3 d.

[0050] As shown in Figure 2 , Figure 3 , PbrCBF6-OE1 and PbrCBF6-OE2 represent two parallel repeated overexpression transgenic lines. The differences in plant phenotypes were compared, as shown in Figure 2As shown, there is no significant difference between wild type and transgenic plants in terms of leaf condition and survival rate at 25℃. The leaves of plants after low temperature treatment and then normal temperature become yellow, and the survival rate decreases significantly, but the survival rate of transgenic plants overexpressing PbrCBF6 is significantly higher than that of wild type.

[0051] The WT and transgenic Arabidopsis leaves were punched with a puncher to 8 small leaves, placed in a 15 ml light bottom screw tube, centrifuged at 25℃, 100 rpm for 1 h, measured; after measurement, the sample was boiled at 100℃ for 10 min, cooled to room temperature, measured, and the electrolyte permeability was calculated. As shown in Figure 4 , the electrolyte permeability of WT and transgenic plants at 25℃ has no significant difference, and the electrolyte permeability of WT at -10℃ is significantly higher than that of transgenic Arabidopsis.

[0052] Example 5

[0053] Verification of transformation of pear callus

[0054] PbrCBF6 was constructed into the overexpression vector pCAMBIA1305 according to the method of Example 3. The PbrCBF6 overexpression vector plasmid was transformed into Agrobacterium GV3101, and after plating, it was cultured in a 28℃ incubator for 2-3 days, and single colonies were picked and PCR detection was performed using corresponding primers. The Agrobacterium single colony with positive PCR detection was plated for 2-3 days, and the bacterial cells were resuspended in a super-clean bench, and the OD 600 was adjusted to 0.6-0.8. The callus was taken, crushed, and placed in a conical flask with bacterial solution, shaken for 20 min, and protected from light. After the bacterial solution in the callus was dried, it was grown on MS co-culture medium for 2 days at 25℃ in the dark. Then it was transferred to MS selection medium, cultured in the dark at 25℃, and identified after a period of time to obtain transgenic pear callus PbrCBF6-OE, as shown in Figure 5 .

[0055] WT and transgenic pear callus were cultured on the same MS medium at 25℃ and 4℃, respectively, and the fresh weight of each group of callus was measured after one month. As shown in Figure 6 , there is no significant difference between WT and transgenic callus in fresh weight at 25℃, and the fresh weight of WT callus is significantly lower than that of transgenic callus at 4℃.

[0056] The relative expression amount of PbrCBF6 in WT and PbrCBF6-OE callus was detected after 4℃ cold treatment, and the results are shown in Figure 7 , the relative expression amount of PbrCBF6 in transgenic pear callus is significantly higher than that in WT.

[0057] The above experiments show that the freezing tolerance of the callus of Arabidopsis and pear overexpressing PbrCBF6 is significantly stronger than that of the wild type plant, and the survival rate of Arabidopsis overexpressing PbrCBF6 is significantly higher than that of the wild type plant after low temperature treatment, and the fresh weight of the callus of pear overexpressing PbrCBF6 is significantly higher than that of the wild type. Therefore, PbrCBF6 can be introduced into plants as a target gene to alleviate the inhibition of low temperature stress on plant growth and significantly improve the resistance of plants to low temperature stress.

[0058] The above embodiments are only used to illustrate the technical solutions of the present application, and are not intended to limit the present application; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that any modifications, equivalent replacements and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. A PbrCBF6 gene related to low temperature stress in Pyrus bretschneideri Rehd, characterized in that, The nucleotide sequence of the PbrCBF6 gene is shown as SEQ ID NO.

1.

2. The PbrCBF6 gene associated with low temperature stress in pear according to claim 1, characterized in that, The amino acid sequence encoded by the PbrCBF6 gene is shown as SEQ ID NO.

2.

3. The PbrCBF6 gene of claim 1 is applied to regulate the low temperature stress resistance of pear.

4. The use according to claim 3, wherein the compound is ###0002### The application is to cultivate new pear varieties with high low temperature stress resistance by using the PbrCBF6 gene.

5. The use according to claim 3, wherein the compound is ###0002### The application is to improve the ability of pear to resist low temperature stress by increasing the expression or activity of the PbrCBF6 gene, or to reduce the ability of pear to resist low temperature stress by inhibiting the expression or activity of the PbrCBF6 gene.

6. Use according to claim 5, wherein The expression of the PbrCBF6 gene is increased by a PbrCBF6 overexpression vector, the PbrCBF6 overexpression vector pCAMBIA1305-PbrCBF6, the PCR product of the PbrCBF6 gene is obtained using pear tissue culture seedling cDNA as a template, and the pCAMBIA1305 vector is connected to obtain the PbrCBF6 overexpression vector.

7. Use according to claim 6, wherein The primer sequence for obtaining the PCR product of the PbrCBF6 gene is shown, the upstream primer sequence is shown as SEQ ID NO. 3, and the downstream primer sequence is shown as SEQ ID NO.

4.

8. A construct for increasing or decreasing the expression of PbrCBF6 gene in pear, characterized in that, The PbrCBF6 gene of claim 1.

9. A host cell, characterized in that, The construct of claim 8.

10. The construct of claim 8 or the host cell of claim 9 is applied to regulate the low temperature stress resistance of pear.

Images