Pyrus betulaefolia lectin receptor-like kinase gene sequence and application of pyrus betulaefolia lectin receptor-like kinase gene sequence in improvement of apple and pear rot resistance
By introducing the PbeL-LecRK-S.4 gene into *Pyrus pyrifolia*, constructing overexpression and silencing vectors, and activating multiple immune signaling pathways, the problem of insufficient resistance to rot disease in *Pyrus pyrifolia* was solved, achieving a significant enhancement of disease resistance and supporting disease-resistant breeding.
Patent Information
- Application Number
- CN202511074973.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-01
- Publication Date
- 2025-11-07
AI Technical Summary
In the current technology, there is insufficient research on the resistance of apples and pears to rot disease. Traditional breeding is time-consuming and laborious, and there is a lack of effective genetic improvement methods, resulting in an unclear defense mechanism against rot disease, which affects the production efficiency of fruit trees.
A gene sequence of P. beta-L-LecRK-S.4, a lectin receptor kinase of pear, is provided. By constructing overexpression and silencing vectors, it is introduced into pear cells to enhance their resistance to rot disease, activate multiple immune signaling pathways, and strengthen the plant's defense response.
It significantly improved the resistance of pear to rot pathogens, enhanced the plant's immune response, provided a theoretical basis for disease-resistant breeding, and improved the disease resistance of fruit trees.
Smart Images

Figure CN120905266A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant disease resistance gene identification and genetic engineering technology, specifically to a pear lectin receptor kinase gene sequence and its application in improving resistance to apple and pear rot. Background Technology
[0002] Apples and pears, as important fruit tree species worldwide, have been cultivated in my country for over 3,000 years, and their production is frequently subject to various biological stresses. Among these, canker (Valsa canker) is caused by black rot of the genus *Valsa*. Valsa spp. Caused by infection with saprophytic pathogenic fungi, it is one of the most destructive fungal diseases. (Exploration of the Biocontrol Activity of Bacillus atrophaeus Strain HF1 against Pear) Valsa Canker Causedby Valsa pyri Int. J. Mol. Sci. 2023, 24, 15477), it invades through wounds or stomata, enters the phloem, and mainly causes disease by secreting proteases, amylases, polyphenol oxidases and toxins (Apple Valsa canker:insights into pathogenesis and disease control. Phytopathology Research,2023, 5(1): 45). At the same time, the hyphae further invade the xylem, further damaging the xylem tissue by decomposing lignin and cell wall polysaccharides, affecting water and nutrient transport. This causes plant death and causes significant losses to the apple and pear industries (Apple Valsa canker:insights into pathogenesis and disease control. Phytopathology Research,2023, 5(1): 45). Valsa canker : insights into pathogenesis and disease control. Phytopathology Research, 2023, 5(1): 45). Due to the time-consuming and laborious nature of traditional breeding, resistance molecular breeding has been widely welcomed and attracted attention as a new approach. Moreover, because pears have a long juvenile period and are self-incompatible (Acetylation of organic pyrophosphatase by S-RNase signaling induces pollen tube tipswelling by repressing pectin methylesterase. The Plant Cell, 2023, 35: 3544-3565), a clear understanding and research on resistance to rot disease is very important for breeding varieties with durable resistance.
[0003] Unlike animals, plants cannot avoid various stresses and microbial invasions in nature and must rely on their own immune system (Regulation of plant immune signaling by calcium-dependent proteinkinases. Molecular plant-microbe interactions, 2019, 32(1): 6-19). The long-term game between plants and pathogenic bacteria eventually formed a two-level immune system in plants (PTI and ETI: convergent pathways with diverse elicitors. Trends in Plant Science, 2022, 27(2): 113-115). Pattern recognition receptors (PRRs) located on the cell membrane of plants constitute a surveillance system that specifically identifies pathogen / microbe-associated molecular patterns (PAMP / MAMPs, such as toxins, cell wall-degrading enzymes, etc.), and the immune response triggered is called PTI (PAMP / pattern-triggered immunity) (Signaling mechanisms in pattern-triggered immunity (PTI). Molecular plant, 2015, 8(4): 521-539). The activation of PRRs triggers many key signaling modules, such as the production of reactive oxygen species (ROS), the expression of pathogenesis-related (PR) genes, and the activation of mitogen-activated protein kinases (MAPKs) and calcium-dependent proteins (CDPKs) (Functions of calcium-dependent proteinkinases in plant innate immunity. Plants, 2014, 3(1): 160-176).
[0004] To break through the blockade of the first layer of immunity, effectors secreted by host-specific pathogenic bacteria can interfere with PTI through a series of means such as inhibiting the translation of PRRs, inhibiting the activity of PRRs and their complexes, affecting the transmission of MAPK and its downstream signals, affecting vesicle transport and callose deposition, etc. It can effectively inhibit the host's PTI, and then be recognized by plant-specific receptors (mainly R proteins) and trigger host-specific defense response, called ETI (Effector Triggered Immunity) (Fungal effectors and plant susceptibility. Annual review of plant biology, 2015, 66: 513-545). A typical disease resistance reaction of rapid cell necrosis after incompatibility interaction between plants and pathogenic bacteria is called hypersensitive response (HR), accompanied by programmed cell death (PCD), which slows down the speed of pathogenic bacteria infection on plants (A layered defense strategy mediated by rice E3 ubiquitin ligases against diverse pathogens. Molecular Plant, 2016, 9(8): 1096-1098). Thereafter, a series of signal transduction activates the systemic resistance of the whole plant, i.e. systemic acquired resistance (SAR). Recent studies have found that the occurrence of PTI is essential for the activation of subsequent ETI (Mutual potentiation of plant immunity by cell-surface and intracellular receptors. Nature, 2021, 592: 110-115), indicating that the two are not independent of each other, but exist in a mutual amplification and synergistic effect, thereby ensuring that plants can output a persistent and strong immune response when responding to the invasion of pathogenic bacteria (Pattern-recognition receptors are required for NLR-mediated plant immunity. Nature, 2021, 592: 105-109).
[0005] As the front line of defense, PTI can effectively prevent most potential pathogen infections. PRRs are classified as receptor-like protein kinases (RLKs) or receptor-like proteins (RLPs) (Receptor kinases in plant-pathogen interactions: more than pattern recognition. The Plant Cell, 2017, 6: 618-637). A typical RLK consists of an N-terminal extracellular domain, a transmembrane region, and a C-terminal intracellular kinase domain. PRRs contain different extracellular domains, such as leucine-rich repeat (LRR) domains, lysine motif (LysM) domains, and lectin (Lec) domains, which determine the specificity of ligands, and thus have multiple responses and regulations in signal transduction, immune response, environmental stress, hormone signaling, and growth and development (Receptor kinases in plant-pathogen interactions: more than pattern recognition. The Plant Cell, 2017, 29: 618-637). Plants contain a large number of RLKs. According to previous laboratory identification, 1019 members were found in apple, 918 members in white pear, and 1061 members in pear. They play a prominent role in ligand perception and PTI activation. Arabidopsis flagellin SENSING 2 (FLS2) is the first RLK found in plants, and the bacterial flagellin epitope flg22 was found to activate plant immunity (Glycosidase and glycan polymorphism control hydrolytic release of immunogenic flagellin peptides. Science, 2019, 364: eaav0748).
[0006] L-type lectin receptor kinase (L-LecRKs) is a subfamily of the RLK family, which is composed of extracellular receptor domain, single-channel transmembrane domain and intracellular serine / threonine kinase domain. LecRLKs can recognize pathogens, respond to immunity, respond to external signals, regulate plant growth and development (FER and LecRK show haplotype-dependent cold-responsiveness and mediate freezing tolerance in Lotus japonicus. Plant Physiology, 2023, 191(2): 1138-1152), and can also bind to hydrophobic molecules such as sugars, plant hormones and cytokines, which are important RLKs. Through previous laboratory identification, it was found that there are 47 L types in pear. There are a large number of tandem repeats and whole genome duplication events in the L-LecRKs family, resulting in proteins with similar or different functions. The most typical L-LecRK is L-type lectin RLK Does not Respond to Nucleotides 1 (DORN1), which senses extracellular ATP and plays a role in damage-associated immune responses (Identification of a Plant Receptor for Extracellular ATP. Science, 2014, 343: 290-294). L-LecRKs are indispensable in plant immune responses and are involved in a large number of transduction pathways that perceive pathogens. However, so far there has been no comprehensive report on the resistance of pear to rot disease. The mechanism of action in the pear rot disease response is not yet known. Therefore, using pear callus, Huangguan pear and apple fruit as materials, the gene family was identified to analyze the resistance mechanism of the members of the anti-rot disease, and the susceptible varieties were improved through genetic transformation, which has important theoretical and practical significance for obtaining ideal varieties with excellent traits. SUMMARY
[0007] In view of the defects of the prior art, the present application provides a pear lectin receptor kinase gene sequence and its application in improving the resistance of apple and pear to rot disease, so as to solve the problems raised in the background art.
[0008] To achieve the above-mentioned purpose, the present application provides the following technical scheme: A pear rot disease resistance gene sequence, characterized in that the gene sequence consists of the nucleotide sequence shown in SEQ ID NO: 1, i.e. PbeL-LecRK-S.4 Gene, said PbeL-LecRK-S.4The sequence of the gene is as follows:
[0009] A vector, characterized in that the vector contains all of the above-mentioned nucleotide sequences.
[0010] Preferably, the carrier is pFGC5941- PbeL-LecRK-S.4 .
[0011] A vector, characterized in that the vector contains the aforementioned partial nucleotide sequence, wherein the specific fragment is as follows: ATGGCATACCAAATGTTCATTCTTACTGGGTTTTCCTCCTCTTCCTCGCAAACCCAGCAAAAACCCAGCTCGACCAAGAGCTCTACTTCAATGACTTCTATGACGTAGCCCACAGCAGCAACTTGAGCTTAAACGGCGTCGCAGCAATCACGTCCAACGGCATGCTCAAGCTCACAGACGACACTCCCAGAGTCCTCGGCCACGCCTTCTACTC.
[0012] Preferably, the carrier is PTRV2- PbeL-LecRK-S.4 .
[0013] Application of a pear rot resistance gene sequence in the preparation of reagents or drugs to enhance resistance to apple and pear rot pathogens.
[0014] Compared with the prior art, the beneficial effects of the present invention are: 1. The present invention provides a gene sequence for resisting rot in pear trees to improve their resistance to saprophytic fungal rot.
[0015] 2. The disease-resistant gene in *Pyrus pyrifolia* presented in this invention is the first time that it has been found in *Pyrus pyrifolia* (…). Pyrus betulifolia The disease resistance gene was cloned from the L-LecRKs family and further studied. PbeL-LecRK-S.4 The study explores the disease resistance function and its possible mechanisms of action, providing a theoretical basis for disease-resistant breeding of Pyrus pyrifolia.
[0016] 3. This invention is the first to construct pFGC5941- PbeL-LecRK-S.4 Overexpression vector and PTRV2- PbeL- LecRK-S.4 The silencing vector was introduced into *Pyrus pyrifolia* ('Duli-G03') cells via transient expression in *Pyrus pyrifolia* and Fuji apple fruits, and the expression was validated by Agrobacterium-mediated transformation. Disease resistance genes in *Pyrus pyrifolia* were investigated. PbeL-LecRK-S.4 Disease resistance response of overexpression suspension cell lines and wild-type pear suspension cells after inoculation with rot disease.
[0017] 4. The disease resistance gene for pear provided by this inventionPbeL-LecRK-S.4 It can significantly improve the resistance of pear to rot bacteria. Attached Figure Description
[0018] Figure 1 The target gene in this invention PbeL-LecRK-S.4 Full-length CDS sequence size and specific fragment size 。
[0019] Figure 2 20% is used in this invention Vp M treatment in wild-type cells PbeL-LecRK-S.4 Measurement of expression levels.
[0020] Figure 3 The target gene in this invention PbeL-LecRK-S.4 Gene structure and conserved domains.
[0021] Figure 4 The target gene in this invention PbeL-LecRK-S.4 Transient overexpression and ViGS-mediated silencing in 'Huangguan' pear and Fuji apple fruits. Vp Resistance identification.
[0022] Figure 5 The target gene in this invention PbeL-LecRK-S.4 Expression level determination after stable overexpression in *Pyrus pyrifolia* suspension cells, wild-type *Pyrus pyrifolia* cells, PbeL-LecRK-S.4 overexpression cell line inoculation Vp The subsequent onset of the disease and the determination of lesions.
[0023] Figure 6 for PbeL-LecRK-S.4-1 Overexpression cell lines at 20% Vp Determination of expression levels of marker genes in different pathways under M treatment. Detailed Implementation
[0024] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0025] This invention utilizes reverse transcription-polymerase chain reaction (RT-PCR) to synthesize the first strand of cDNA from total RNA of *Pyrus pyrifolia* cells as a template. Using homologous cloning technology, primers were designed based on the *Pyrus pyrifolia* genome sequence to amplify the disease-resistant gene from *Pyrus pyrifolia*. PbeL-LecRK-S.4The complete open reading frame sequence is 2082 bp in length, and the specific silence fragment is 215 bp. Figure 1 ).
[0026] For further research PbeL-LecRK-S.4 The role of pFGC5941- in resistance to rot disease: This invention constructs pFGC5941- PbeL-LecRK-S.4 ( PbeL-LecRK-S.4 -OE) overexpression vector and TRV2- PbeL-LecRK-S.4 The silencing vector was overexpressed in the fruits of 'Huangguan' pear, Fuji apple, and wild pear cells. It was found... PbeL-LecRK-S.4 Overexpression of this substance significantly enhances resistance to putrefactive bacteria.
[0027] In this invention, for PbeL-LecRK-S.4 Transgenic cell lines and wild-type cells were inoculated with *Pyrus pyrifolia*, and the disease incidence in the cells was measured. The results indicated the presence of a disease-resistant gene in *Pyrus pyrifolia*. PbeL-LecRK-S.4 It is positively regulating resistance to rot disease.
[0028] The following is PbeL-LecRK-S.4 The coding region sequence and the specific steps for verifying the anti-biological stress function.
[0029] Example 1 uses 20% Vp M treatment in wild-type cells PbeL-LecRK-S.4 Measurement of expression levels 1. Materials and Methods for Vp Wild-type (DL) cells treated with M for 1, 3, and 6 h were subjected to RNA extraction using a plant RNA extraction kit (160906-50, Tianjin, Beijing, China). Total RNA was analyzed using a microspectrophotometer (NarnoDorp 2000) and quality was assessed by gel electrophoresis. qRT-PCR was performed using a Light Cycler® 96 real-time PCR system (Roche, Switzerland). Two [units / items / etc.] were used. -△△CT The method calculates the average multiple change.
[0030] 2. Results and Analysis To verify PbeL-LecRK-S.4 To determine whether resistance to rot disease was observed, we tested the expression of target genes in the wild-type secondary metabolites and found... PbeL-LecRK-S.4 The expression level was significantly upregulated ( Figure 2 The above results indicate that multiple immune signals are involved. PbeL-LecRK-S.4 Regulatory role in resistance to rot disease.
[0031] Example 2 PbeL-LecRK-S.4 Structural analysis 1. Test Methods Gene sequence data were sourced from the GDR and NCBI databases. Gene structure diagrams were generated using GSDS 2.0. Conserved protein domains were analyzed using SMART and DOG 2.0.
[0032] 2. Results and Analysis right PbeLecRK-S.4 Structural analysis revealed it to be a single-exon gene with a UTR domain at the 3' end. It encodes 693 amino acids, containing a signal peptide (SP), a lectin extracellular domain, a transmembrane region, and an intracellular kinase domain, characteristic of typical L-LecRK (LecRK) genes. Figure 3 ).
[0033] Example 3 PbeL-LecRK-S.4 PCR amplification of genes and construction of cloning vectors 1. PCR amplification Total RNA was extracted from *Pyracantha fortuneana* suspension cells using a plant RNA extraction kit (160906-50, Tian Enze, Beijing) and reverse transcribed into cDNA. Specific primers for full-length amplification and silencing fragments were designed based on the CDS sequence (full-length amplification upstream primer F1 with Asc I restriction enzyme site and protective base, downstream primer R1 with Avr II restriction enzyme site and protective base; silencing fragment upstream primer F2 with Mlu I restriction enzyme site and protective base, downstream primer R2 with Xho I restriction enzyme site and protective base). The primer sequences are shown in Table 1. Using the reverse-transcribed cDNA as a template, PCR amplification was performed using high-fidelity LA Taq (TaKaRa, DRR100B) polymerase, as shown in Table 2.
[0034] Table 1 Primers for full-length and specific fragment amplification of the target gene Name Primer F1 CA GGCGCGCC ATGGCATACCAAATGTTCATTCTTTA]]> R1 GA CCTAGG CTAGCTTGGGTACCTGTCACTACCA <!-- 5 -->]]> F2 CA ACGCGT ATGGCATACCAAATGTTCATTCTTTA]]> R2 GA CTCGAG GAGTAGAAGGCGTGGCCGAGGACTC]]> Table 2 PCR system for target gene amplification Component Amount / μL cDNA 1 Primer F 1 Primer R 1 LA taq 10 ddH2O To total volume 20 μL The PCR amplification program was as follows: pre-denaturation at 94℃ for 30 s, followed by denaturation at 98℃ for 10 s, annealing at 56℃ for 1 min 30 s, extension at 72℃ for 30 s, for 40 reaction cycles, and finally extension at 72℃ for 5 min.
[0035] The PCR amplification products were separated by 1.0% agarose gel electrophoresis and then purified and recovered using the GeneJET Gel Extraction Kit agarose gel DNA recovery kit.
[0036] 2. Connection and transformation of expression carriers The PCR amplification products obtained above were respectively connected with the expression vectors after corresponding enzyme digestion, E. coli was transformed, positive clones were picked for sequencing, and it was proved to be accurate. The connection conditions were as follows: Component Amount / μL 5 x C Ell Buffer 2 Exnase Il 1 PCR amplified product 7 The recombinant plasmid was obtained after 30 min of connection at 37℃, and then E. coli was transformed: 100 μl of competent cells DH5α was taken out from the-80℃ refrigerator, melted on ice, 10 μl of the connection product obtained above was added, mixed, ice-bathed for 5 min, 42℃ heat-shocked for 90 s, ice-bathed for 3 min, 500 μl of LB medium without antibiotics was added, 100 μl was taken, and LB (containing kanamycin) plate was coated, and 37℃ was inverted and cultured for 16-24 h. The recombinant plasmid was obtained, and it was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing. The accurate recombinant plasmid was used for subsequent experiments.
[0037] Example 4: Transformation of Agrobacterium tumefaciens competent with recombinant plasmid The Agrobacterium tumefaciens competent cells GV3101 were taken out from the ultra-low temperature refrigerator, and thawed on ice. After melting, 5 μl of the above-mentioned recombinant plasmid was added, mixed gently, ice-bathed for 5 min, frozen in liquid nitrogen for 5 min, 37℃ water-bathed for 5 min, and ice-bathed for 5 min. 800 μl of normal temperature LB liquid medium was added, 28℃ 160 rpm was recovered for 4 h, 8000 rpm was centrifuged for 1 min, the supernatant was sucked off, 300 μl was left and mixed, and was coated on LB medium plate containing Kana-Rif (kanamycin-rifampicin). 28℃ was inverted and cultured for 2-3 d. Finally, F1 / R1 and F2 / R2 primers were used for PCR identification and screening of positive clones.
[0038] In the present application, the Agrobacterium obtained by the above method with the recombinant plasmid OE- PbeL-LecRK-S.4 and TRV2- PbeL- LecRK-S.4 The Agrobacterium with empty vector pFGC5941 and PTRV2 was also obtained, which was used for subsequent experiments.
[0039] Example 5 PbeL-LecRK-S.4 Fruit transient expression and anti-rot disease phenotype analysis 1. Materials and methods The above-mentioned 4 kinds of Agrobacterium bacterial liquid were recovered after shock culture, centrifuged at 8000 r / min for 10 min, resuspended with MES-KOH buffer, and then 4℃ was placed for 4 h. 0.2 mL of 4 kinds of bacterial liquid was respectively taken with a disposable sterile needle and injected into pear fruits, and then the injection position was punched with a punch (Φ=7 mm) after 3 d of 25℃ culture. The disease bacteria were inoculated and the size of the disease spot was observed.
[0040] 2. Results and analysis As shown in Figure 4 Figure 2, compared with the control (empty vector carrying Agrobacterium), the lesion of apple and pear fruits injected with Agrobacterium containing OE-1 was significantly smaller than the control at 3 d after inoculation, while the lesion of silenced OE-2 was found to be significantly larger than the control. The above results show that the overexpression of OE-1 significantly enhances the resistance of pear fruit to rot disease. PbeL-LecRK-S.4 PbeL-LecRK-S.4 PbeL-LecRK-S.4
[0041] Example 6 Transformation of Du Li pear callus The Du Li pear suspension cells were transformed with Agrobacterium containing the recombinant plasmid of OE-1 according to the following steps. PbeL-LecRK-S.4 1. The small cell groups of Du Li pear suspension cells were collected by filtering with a cell filter (40 mesh pore size) and cultured for 3 d for standby. The Agrobacterium containing the target gene expression vector constructed above was activated and inoculated into LB medium, and cultured by shaking until the OD value was 0.4. The bacterial cells were collected by centrifugation, suspended in an equal volume of MS medium, and then 1.5 mL of compact volume of Du Li pear suspension cells was added. After 5 min of infection, the Du Li cells containing a small amount of Agrobacterium were plated on solid plates.
[0042] 2. After washing the Agrobacterium in the above transformed cells with cefotaxime, they were plated on Du Li medium plates containing antibiotics (herbicide + cefotaxime) and cultured in the dark for about 30 d to obtain positive transformant lines. After PCR identification and qRT-PCR verification, the transgenic cell line with the most ideal target gene expression effect (OE-1) was obtained.
[0043] Figure 5
[0044] Example 7 Overexpression cell lines PbeL-LecRK-S.4 Analysis of resistance to rot disease phenotype 1. Materials and methods The above wild type ('Duli-G03') suspension cells and PbeL-LecRK-S.4 overexpression cells were grown for 3 d under the same conditions, and then plated on plates, inoculated Vp and observed for disease incidence.
[0045] 2. Results and analysis After inoculation Vp 3 d, compared with the control (DL), the pathogen lesion on the overexpression cells was significantly smaller than that on the wild type after 72 h of inoculation, and the growth rate was significantly inhibited. Among them, PbeL-LecRK-S.4 the (OE-1) cell line showed the highest resistance and almost no disease, and the above results show that PbeL-LecRK-S.4 the overexpression of OE-1 significantly enhances the resistance of Du Li pear to rot disease. PbeL-LecRK-S.4 Overexpression of [a substance] significantly increased the resistance of "Duli-G03" cells to rot disease. Figure 5 ).
[0046] Example 8: Multiple signaling pathways involved PbeL-LecRK-S.4 Regulated defense response 1. Materials and Methods for Vp Control (DL) and treated samples treated with M for 1, 3, and 6 h ( PbeL-LecRK-S.4 Total RNA (-1) was extracted using a plant RNA extraction kit (160906-50, Tianjin, Beijing, China). The extracted total RNA was detected using a microspectrophotometer (NarnoDorp 2000), and quality was assessed by gel electrophoresis. qRT-PCR was performed using a Light Cycler® 96 real-time PCR system (Roche, Switzerland). 2 -△△CT The method calculates the average multiple change.
[0047] 2. Results and Analysis In order to study PbeL-LecRK-S.4 Activated signaling pathways were investigated, and the expression of key genes related to PTI, ROS, JA, and SA signaling, which are directly related to plant immunity, was examined. Figure 6 Compared to the wild type, PbeL-LecRK-S.4 Overexpression of PTI leads to the PTI pathway PbeFRK1 In overexpression cell lines, the expression increased by 27-84% compared to wild-type WT. PbeWRKY22 Expression of SAR pathway increased by 20-57% compared to WT. PbePR4 Expression of SA pathway increased by 10-66% compared to WT. PbeCHN50 Its expression increased by 19-92% compared to WT. In addition, it also regulated the JA pathway. PbePR1B and ROS pathway PbeROOHD In summary , PbeLecRK- S.4 Overexpression of [the substance] can activate multiple immune signaling pathways, thereby enhancing immunity. Vp Resistance.
[0048] The above-described embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included within the protection scope of the present invention.
Claims
1. A Pyrus x bretschneider Rehder lectin-like receptor kinase gene sequence, characterized in that, The gene sequence consists of the nucleotide sequence shown in SEQ ID NO:
1.
2. A vector, characterized in that, The vector comprises the entire nucleotide sequence of claim 1.
3. The carrier of claim 2, wherein: The vector is pFGC5941 PbeL-LecRK- S.4。 4. A vector, characterized by, The vector comprises the partial nucleotide sequence of claim 1.
5. The carrier of claim 4, wherein: The vector is TRV2 PbeL-LecRK-S.4 .
6. Use of a Pyrus x bretschneider Rehd agglutinin-like receptor kinase gene sequence in the preparation of a reagent or drug for improving resistance of apple and pear to Valsa mali.