High-yield O-succinyl-L-homoserine engineering bacterium as well as construction method and application thereof

Abstract

The invention provides a high-yield O-succinyl-L-homoserine engineering bacterium as well as a construction method and application of the high-yield O-succinyl-L-homoserine engineering bacterium. According to the invention, O-succinyl-L-homoserine genetically engineered bacteria with high yield of O-succinyl-L-homoserine are constructed by introducing O-succinyl-homoserine transferase from Vibrio cholera into a chassis strain in an exogenous manner and obtaining a gene mutant metAVc (T242A) of the O-succinyl-L-homoserine transferase, and further increasing the expression of the O-succinyl-L-homoserine transferase by adopting a Trc promoter. The engineering strain obtained through a systematic metabolic engineering modification strategy can realize effective accumulation of OSH, the shake flask yield of OSH reaches 18.8 g / L, the fed-batch fermentation yield of a 5L fermentation tank reaches 105.4 g / L, the sugar-acid conversion rate reaches 52.6%, and a foundation is laid for subsequent construction of high-yield OSH engineering bacteria.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to the field of bio-fermentation production of O-succinyl-L-homoserine, and more particularly relates to a genetically engineered bacterium with high yield of O-succinyl-L-homoserine and a construction method thereof, and application of the genetically engineered bacterium in microbial fermentation preparation of O-succinyl-L-homoserine. BACKGROUND

[0002] O-succinylhomoserine (OSH) as an important metabolic intermediate has wide application value in the field of biosynthesis. In the field of medicine, OSH is a key precursor for the synthesis of various amino acid drugs and antibiotics, and its efficient synthesis helps to reduce drug production costs and improve drug quality; in the field of agriculture, OSH can be used as an important component of biological fertilizers and plant growth regulators, and plays a positive role in promoting plant growth and enhancing crop stress resistance; in addition, in the food industry, OSH can be used to improve the nutritional structure of food and enhance the nutritional value and functionality of food.

[0003] O-succinylhomoserine transferase plays a core role in the production of OSH. The enzyme can catalyze the reaction of homoserine and succinyl coenzyme A to synthesize OSH. Although existing research has confirmed the catalytic effect of the enzyme in OSH synthesis, there are still many problems in actual production application. At present, the activity and stability of O-succinylhomoserine transferase are low, which makes it difficult to meet the growing market demand for OSH production; at the same time, in the traditional production process, the catalytic efficiency of the enzyme is not high, the production process has high energy consumption and cost, and the product separation and purification is difficult, which limits the large-scale industrial production of OSH. In addition, the regulation mechanism of O-succinylhomoserine transferase is not well understood, and it is difficult to optimize its performance through effective means. Therefore, it is urgent to develop an OSH production technology that can improve the activity and stability of O-succinylhomoserine transferase, reduce production costs, and improve production efficiency. SUMMARY

[0004] In order to solve the problems of low yield and low sugar acid conversion rate of OSH fermentation caused by low activity and stability of O-succinylhomoserine transferase in the prior art, the present application modifies E. coli by metabolic engineering to obtain a genetically engineered bacterium with high yield of O-succinyl-L-homoserine.

[0005] The technical scheme adopted by the present application is: a high-yield O-succinyl-L-homoserine genetically engineered bacterium construction method, comprising: using CRISPR-Cas9 gene editing technology, replacing the pseudogene nmpC on the genome of a chassis bacterium with a homoserine transsuccinylase encoding gene metA derived from Vibrio cholerae, introducing an overexpression plasmid containing the genes metA and yjeH, and constructing the high-yield O-succinyl-L-homoserine genetically engineered bacterium.

[0006] To achieve the above-mentioned purpose of the present application, the present application provides a high-yield O-succinyl-L-homoserine genetically engineered bacterium, which is obtained by replacing the pseudogene nmpC in the genome of a chassis bacterium (preferably E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB P trc -metL ΔarcA ΔiclR) with a homoserine transsuccinylase gene metA derived from Vibrio cholerae O1 biovar El Tor str. N16961 Vc (preferably a homoserine transsuccinylase mutant metA Vc(T242A) mutated at T242A), replacing the promoter of metA Vc with a Trc promoter to enhance its expression, and finally introducing an overexpression plasmid containing the homoserine transsuccinylase encoding gene metA and the L-methionine / branched-chain amino acid transporter encoding gene yjeH. The present application increases the expression amount of exogenous O-succinylhomoserine transferase by introducing the exogenous O-succinylhomoserine transferase and increasing the copy number of the enzyme encoding gene.

[0007] Preferably, the homoserine transsuccinylase encoding gene metA derived from Vibrio cholerae is the coding gene metA Vc(T242A) of a homoserine transsuccinylase T242A mutant. In the specific selection of the exogenous gene metA, the present application verifies the genes metA derived from Geobacillus kaustophilus, Bradyrhizobium diazoefficiens, Shewanella oneidensis, Yersinia pestis, Salmonella enterica, and Vibrio cholerae. The results show that among the above six kinds of exogenous O-succinylhomoserine transferase encoding genes, the homoserine transsuccinylase encoding gene metA VcHigh serine transsuccinylase mutant metA mutated at site T242A for best selection Vc(T242A) Compared with wild type, the OSH production capacity of the strain can be further improved.

[0008] As preferred, the method further comprises: replacing the original promoter of the gene metA Vc(T242A) with a Trc promoter. In the specific selection of strong promoters, the present embodiment respectively verifies Trc, P1, P3, P10, and M162 promoters. The results show that among the above five strong promoters, the Trc promoter can more effectively promote the expression of the gene metA Vc(T242A) , so as to further improve the OSH production capacity of the strain.

[0009] As preferred, the chassis strain is E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB P trc -metL ΔarcA ΔiclR. The construction method of the chassis strain comprises: taking E. coli W3110 ΔmetI ΔmetJ ΔthrB ΔmetB as the starting strain (patent CN 109055290 A), first weakening the organic acid metabolic byproduct synthesis pathway, and the weakening method comprises: knocking out the ldhA gene encoding lactate dehydrogenase, the adhE gene encoding glycolate dehydrogenase, and the pflB gene encoding pyruvate formate lyase in the genome. By knocking out the formate synthesis gene pflB, the lactate synthesis gene ldhA, and the ethanol synthesis gene adhE, the synthesis pathways of formic acid, lactic acid, and ethanol are blocked, the accumulation of organic acid metabolic byproducts such as formic acid, lactic acid, and ethanol is reduced, the carbon flux is concentrated on the conversion of pyruvate to oxaloacetate, and the sugar acid conversion rate of the engineering strain is further improved. In order to further increase the supply of precursor L-homoserine, the expression of the metL gene encoding homoserine dehydrogenase is also enhanced, and the overexpression of the metL gene is preferably realized by replacing the original promoter of the gene metL with a strong promoter (such as a trc promoter). In addition, in order to increase the supply of precursor succinyl coenzyme A, the coding gene arcA of the global regulator and the coding gene iclR of the DNA binding transcriptional inhibitor are also knocked out, so that the TCA cycle is accelerated, and the supply amount of succinyl coenzyme A is improved.

[0010] As preferred, the overexpression plasmid containing the gene metA and the gene yjeH is pTrc99A-metA-yjeH. The overexpression plasmid refers to a polynucleotide operably linked to a control sequence expressed in a host cell, and preferably the vector of the overexpression plasmid is pTrc99A.

[0011] As preferred, the amino acid sequence of the homoserine transsuccinylase-encoding gene metA derived from Vibrio cholerae is shown as SEQ ID NO. 6 or SEQ ID NO. 12.

[0012] The application further provides the O-succinyl-L-homoserine-producing genetically engineered bacteria constructed by the method.

[0013] As preferred, the O-succinyl-L-homoserine-producing genetically engineered bacteria is: E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB P trc -metL ΔarcA ΔiclR ΔnmpC::Ptrc-metA Vc(T242A) / pTrc99a-metA-yjeH.

[0014] The application further provides a homoserine transsuccinylase mutant, which is obtained by mutating the threonine at position 242 of the amino acid sequence shown as SEQ ID NO. 6 to alanine, and the amino acid sequence of the mutant is shown as SEQ ID NO. 12.

[0015] The application further provides the application of the high-yield O-succinyl-L-homoserine-producing genetically engineered bacteria or the homoserine transsuccinylase mutant in the microbial fermentation production of O-succinyl-L-homoserine. The application includes: inoculating the engineered bacteria containing the homoserine transsuccinylase mutant-encoding gene or the high-yield O-succinyl-L-homoserine-producing genetically engineered bacteria into a fermentation medium, and performing fermentation culture under the conditions of 28-37℃ and 100-500 rpm for 48-65 h, and then separating and purifying the O-succinyl-L-homoserine from the fermentation supernatant after the fermentation.

[0016] As preferred, the fermentation medium is composed as follows: glucose 10-30 g / L, ammonium sulfate 10-20 g / L, yeast extract 1-5 g / L, KH2PO4 0.5-3 g / L, MgSO4 0.1-2.0 g / L, trace metal salt solution 0.5-5 mL / L, betaine 1.0-3.0 g / L, pH 6.5-7.0, and deionized water as solvent; the trace metal salt solution is composed of 0.01 g / L FeSO4, 0.005 g / L MnSO4, and 0.0025 g / L ZnSO4, and deionized water as solvent. More preferably, the fermentation medium is composed as follows: glucose 25 g / L, ammonium sulfate 16 g / L, yeast extract 2.5 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, betaine 2.0 g / L, and trace metal salt solution 1 mL / L.

[0017] Before fermentation, the genetically engineered bacteria are inoculated into LB medium, cultured overnight at 37 ℃ and 180 rpm to prepare seed liquid, and the seed liquid is inoculated into fermentation medium at a volume concentration of 5%.

[0018] The fermentation is carried out in a 5 L fermenter: the recombinant genetically engineered bacteria are inoculated into an LB plate containing 50 mg / L kanamycin, cultured overnight at 37 ℃, a single colony is picked into an LB test tube containing 50 mg / L kanamycin, and cultured overnight at 37 ℃ and 150 rpm to prepare seed liquid; the seed liquid is inoculated into LB medium at a volume concentration of 5%, and cultured overnight at 37 ℃ and 150 rpm as secondary seed liquid; the secondary seed liquid is inoculated into a 5 L fermenter containing 2 L fermentation medium at a volume concentration of 15%, and 0.2 mM IPTG is added, and the fermentation culture is carried out at 30 ℃, 500 rpm, and aeration amount of 0.5 V / V·min; when the pH value is higher than 6.80 (initial sugar consumption in the fermenter is completed), automatic feeding is started, and the feeding medium is added until the pH value is lower than 6.80; the culture is carried out for 96 h to obtain fermentation liquid containing OSH.

[0019] The feeding medium comprises: glucose 500 g / L, (NH4)2SO4 16 g / L, KH2PO4 12.5 g / L, threonine 4 g / L, and methionine 0.5 g / L, and water as solvent; the pH value is adjusted to 6.8 by using 50% ammonia water. The feeding speed is 25 mL / h, and the total amount of feeding medium added is 1000 mL / 2 L.

[0020] In the present application, the term "enhancement" refers to increasing the activity of an enzyme encoded by a corresponding polynucleotide, which is mainly achieved by replacing the expression regulatory sequence (promoter replacement, etc.) of the gene on the genome.

[0021] The present application has the following beneficial effects: the present application introduces O-succinylhomoserine transferase from Vibrio cholerae into the chassis strain, and obtains a mutant metA of the enzyme gene Vc(T242A) , further increases the expression of O-succinylhomoserine transferase by using a Trc promoter, and constructs the high-yield O-succinyl-L-homoserine genetically engineered bacteria. The engineered strain obtained by the system metabolic engineering modification strategy can realize the effective accumulation of OSH, the OSH yield in a shake flask is 18.8 g / L, the OSH yield in a 5L fermenter fed-batch fermentation is 105.4 g / L, and the sugar acid conversion rate is 52.6%, which lays a foundation for the subsequent construction of high-yield OSH engineering bacteria. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 OD600 of the biomass of strains OSH1, OSH2, OSH3, OSH4, OSH5, OSH6, OSH7 and OSH8 600 and the concentration column chart of OSH.

[0023] Figure 2 OD600 of the biomass of strains OSH8, OSH9, OSH10, OSH11, OSH12 and OSH13 600 and the concentration column chart of OSH.

[0024] Figure 3 OD600 of the biomass of strain OSH-9A in 5-L fermenter fed-batch fermentation and the concentration curve of OSH. DETAILED DESCRIPTION

[0025] The present application also can be implemented or applied by other different specific embodiments, and each detail in the present specification can be modified or changed based on different viewpoints and applications without departing from the spirit of the present application. It should be noted that the following examples and features in the examples can be combined with each other without conflict.

[0026] In the embodiments of the present application, the methods used are conventional methods, and the reagents used can be obtained from commercial channels.

[0027] In the following examples, the final concentration of kanamycin in the liquid medium and the solid medium is 50 mg / L, the final concentration of spectinomycin is 50 mg / L, and the final concentration of IPTG is 0.2 mM.

[0028] Example 1: Construction of strains OSH 1~13-A

[0029] The present embodiment relates to a method for constructing genetically engineered bacteria, which mainly comprises the following steps:

[0030] 1. Using the strain E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB P trc -metL ΔarcA ΔiclR as the chassis strain, named OSH 1, and using CRISPR-Cas9 gene editing technology, the pseudogene nmpC on the genome of the strain OSH 1 is replaced by the exogenous gene metA Gk , metA Bd , metA So , metA Yp , metA Se , metA Vc (Table 1) from Geobacillus kaustophilus, Bradyrhizobium diazoefficiens, Shewanella oneidensis, Yersinia pestis, Salmonella enterica, and Vibrio cholerae, respectively, to obtain the engineered bacteria OSH 2-OSH 7;

[0031] 2. The gene metA Vc on the genome of the engineered strain OSH 7 is subjected to T242A site mutation to obtain the engineered bacteria OSH 8 containing the exogenous gene metA Vc(T242A) ;

[0032] 3. The original promoter of the exogenous gene metA Vc(T242A) on the genome of the engineered strain OSH 8 is replaced by the Trc, P1, P3, P10, and M162 promoters (Table 1), respectively, to obtain the engineered bacteria OSH 9-OSH 13;

[0033] 4. The plasmid pTrc99a-metA-yjeH is transformed into the aforementioned strains OSH 1-OSH 13, respectively, to obtain the engineered bacteria OSH 1-A-OSH 13-A. After fermentation verification, OSH 9-A (E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB P trc -metL ΔarcA ΔiclR ΔnmpC::Ptrc-metA Vc(T242A) / pTrc99a-metA-yjeH) is the optimal O-succinyl-L-homoserine engineered bacteria with high yield.

[0034] Table 1. Exogenous metA gene sources and strong promoters

[0035] Gene name Nucleotide sequence Source metA Gk ]]> SEQ ID NO. 1 Geobacillus kaustophilus metA Bd ]]> SEQ ID NO. 2 Bradyrhizobium diazoefficiens metA So ]] SEQ ID NO. 3 Shewanella oneidensis metA Yp ]]> SEQ ID NO. 4 Yersinia pestis metA Se ]] SEQ ID NO. 5 Salmonella enterica metA Vc ]] SEQ ID NO. 6 Vibrio cholerae metA Vc(T242A) ]] SEQ ID NO. 12 Vibrio cholerae Trc SEQ ID NO. 7 Trc promoter P1 SEQ ID NO. 9 Pl promoter P3 SEQ ID NO. 10 P3 promoter P10 SEQ ID NO. 11 Pl promoter M162 SEQ ID NO. 12 M162 promoter

[0036]

Construction of chassis OSH1

[0037] The chassis E. coli W3110, ΔmetI ΔmetJ ΔthrB ΔmetB ΔldhA ΔadhE ΔpflB Ptrc-metL ΔiclR ΔarcA was constructed as follows.

[0038] 1. Construction of strain OSH0-2

[0039] E. coli W3110 ΔmetI ΔmetJ ΔthrB ΔmetB (denoted as OSH0-1, the construction method is disclosed in patent CN 109055290 A) was used as the starting strain, and CRISPR / Cas9 gene editing technology was used to knock out ldhA to reduce the accumulation of by-product lactic acid. The specific operation is as follows:

[0040] (1) Construction of pTarget-ldhA plasmid: pTarget plasmid was used as the template, and pTarget-ldhA-F / pTarget-ldhA-R primers were used for amplification. After the PCR product was added with Dpn I and incubated at 37°C for 1 h, it was recovered and purified by Clean up kit, and then transformed into E. coli DH5α, and spread on LB solid plate containing 50 mg / L spectinomycin, and incubated at 30°C for 20 h. Colony PCR was used for preliminary verification, and sequencing was used to verify the correctness of the pTarget-ldhA plasmid, and the plasmid pTarget-ldhA was obtained. Then, pTD-line-F / pTD-line-R primers were used for amplification with pTarget-ldhA plasmid as the template, and the PCR product was added with Dpn I and incubated at 37°C for 3 h. The DNA fragment was recovered by Clean up kit, and the linearized plasmid pTarget-ldhA was obtained.

[0041] (2) Constructing plasmid pTD-ldhA containing Donor: Taking the genome of E. coli W3110 as template, and taking L-ldhA-F / L-ldhA-R as primers to amplify the upstream homologous arm F1; taking R-ldhA-F / R-ldhA-R as primers to amplify the downstream homologous arm R1. Taking L-ldhA-F / R-ldhA-R as primers to fuse the upstream and downstream homologous arms, and recovering the DNA fragment by Clean up kit to obtain the fused fragment. Then the fused fragment and the linearized plasmid pTarget-ldhA in step (1) are used to construct plasmid pTD-ldhA by one-step cloning method, and transformed into E. coli DH5α, and spread on LB solid medium containing 50 mg / L spectinomycin, and incubated at 30°C for 20 h, and the correct strains are preliminarily screened by colony PCR, and finally the correctness of plasmid pTD-ldhA is verified by sequencing.

[0042] (3) Transforming plasmid pCas9 into competent cells OSH1, spreading on LB solid medium containing 50 mg / L kanamycin, and incubating at 30°C overnight, picking single colonies into LB test tube medium containing 50 mg / L kanamycin resistance, and incubating at 30°C overnight. Then inoculating into 100 mL of LB medium at a volume concentration of 1%, and adding 50 mg / L of kanamycin resistance and 10 mM of L-arabinose at a final concentration, and culturing at 180 rpm and 30°C until OD 600 =0.5, and centrifuging at 4°C and 4000 rpm. Washing twice with 4°C pre-cooled ultrapure water, and washing once with 10% pre-cooled glycerol, and finally resuspending and storing by aliquot, to obtain electrotransformation competent cells.

[0043] (4) Mixing 2 μL of pTD-ldhA plasmid constructed in step (2) with 100 μL of electrotransformation competent cells prepared in step (3), and transferring into a 2-mm electroporation cup, and ice-bathing for 45 s, and performing electroporation transformation by using an electroporation instrument (MicroPluser TM , BIO-RAD), and selecting a voltage of 2500 V. Immediately adding 700 μL of 4°C pre-cooled LB medium after completing the electroporation, and immediately transferring into a new sterile 1.5-mL EP tube after uniformly mixing, and incubating at 30°C and 150 rpm for 3 h, and spreading on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubating at 30°C for 24 h. Verifying the strain construction correctness by colony PCR and sequencing using T-ldhA-F / T-ldhA-R as primers, and successfully constructing strain OSH 0-2.

[0044] (5) pTarget and pCas9 plasmid elimination: pick the positive single colony in step (4) and inoculate into LB liquid medium test tube containing 2 mM IPTG and 50 mg / L kanamycin, incubate at 30°C overnight, then streak onto LB solid medium containing 50 mg / L kanamycin, incubate at 30°C for 20 h until single colonies appear, pick single colonies onto LB solid medium containing 50 mg / L spectinomycin, incubate at 30°C for 20 h, if no single colony appears, it means that the pTarget plasmid has been eliminated in this strain. Pick the strain in which the pTarget plasmid has been eliminated and inoculate into LB liquid medium without antibiotics, incubate at 42°C for 10 h, then streak onto LB solid medium without antibiotics, incubate at 37°C for 12 h until single colonies appear, pick single colonies onto LB solid medium containing 50 mg / L kanamycin, if no single colony appears, it means that the pCas9 plasmid has been successfully eliminated, and finally obtain the plasmid-free strain OSH 0-2.

[0045] 2. Construction of strain OSH 0-3

[0046] Take OSH 0-2 as the starting strain, use CRISPR / Cas9 gene editing technology to knock out the adhE gene, reduce the synthesis of by-product ethanol, and the specific operation is as follows:

[0047] (1) Construct pTarget-adhE plasmid: take plasmid pTarget as the template, amplify with primers pTarget-adhE-F / pTarget-adhE-R, add Dpn I to the PCR product after incubation at 37°C for 1 h, then purify with Clean up kit, then transform into E. coli DH5a, spread on LB solid medium containing 50 mg / L spectinomycin, incubate at 30°C for 20 h, then perform colony PCR to preliminarily verify, and then perform sequencing to verify the correctness of the pTarget-adhE plasmid, obtain plasmid pTarget-adhE. Then take pTarget-adhE as the template, amplify with primers pTD-line-F / pTD-line-R, add Dpn I to the PCR product after incubation at 37°C for 3 h, then recover the DNA fragment with Clean up kit, and obtain linearized plasmid pTarget-adhE.

[0048] (2) Constructing plasmid pTD-adhE containing Donor: Taking the genome of E. coli W3110 as template, and L-adhE-F / L-adhE-R as primers to amplify the upstream homologous arm F1; taking R-adhE-F / R-adhE-R as primers to amplify the downstream homologous arm R1. Taking the upstream and downstream homologous arms F1, R1 as templates, and L-adhE-F / R-adhE-R as primers to fuse the upstream and downstream homologous arms, and then recovering the DNA fragments by Clean up kit to obtain the fused fragments. Then the fused fragments and the linearized plasmid pTarget-adhE in step (1) are used to construct plasmid pTD-adhE by one-step cloning method, and transformed into E. coli DH5α, and then coated on LB solid medium containing 50 mg / L spectinomycin, and incubated at 30°C for 20 h, and then the correct strains are screened by colony PCR, and finally the correctness of plasmid pTD-adhE is verified by sequencing.

[0049] (3) Transforming plasmid pCas9 into competent cells OSH 0-2, and coating on LB solid medium containing 50 mg / L kanamycin, and incubating at 30°C overnight, and then picking single colonies into LB test tube medium containing 50 mg / L kanamycin resistance, and incubating at 30°C overnight. Then inoculating into 100 mL of LB medium at a volume concentration of 1%, and adding 50 mg / L of kanamycin resistance and 10 mM of L-arabinose at a final concentration, and incubating at 180 rpm and 30°C until OD 600 =0.5, and centrifuging at 4°C and 4000 rpm. Washing twice with 4°C ultrapure water, and then washing once with 10% cold glycerol, and finally resuspending and storing by aliquot, to obtain electrotransformation competent cells for standby use.

[0050] (4) Mixing 2 μL of pTD-adhE plasmid constructed in step (2) with 100 μL of electrotransformation competent cells prepared in step (3), and transferring into a 2 mm electroporation cup, and ice-bathing for 45 s, and then performing electroporation transformation by using an electroporation instrument (MicroPluser TM , BIO-RAD), and selecting a voltage of 2500 V. Immediately adding 700 μL of 4°C pre-cooled LB medium after completing the electroporation, and then immediately transferring into a new sterile 1.5 mL EP tube, and incubating at 30°C and 150 rpm for 3 h, and then coating on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubating at 30°C for 24 h. Verifying the correctness of strain construction by colony PCR and sequencing using T-adhE-F / T-adhE-R as primers, and successfully constructing strain OSH 0-3.

[0051] (5) pTarget and pCas9 plasmid elimination: pick the positive single colony in step (4) and inoculate into LB liquid medium tube containing 2 mM IPTG and 50 mg / L kanamycin, incubate at 30°C overnight, then streak onto LB solid medium containing 50 mg / L kanamycin, incubate at 30°C for 20 h until single colonies appear, pick single colonies onto LB solid medium containing 50 mg / L spectinomycin, incubate at 30°C for 20 h, if no single colony appears, it means that the pTarget plasmid has been eliminated in this strain. Pick the strain in which the pTarget plasmid has been eliminated and inoculate into LB liquid medium without antibiotics, incubate at 42°C for 10 h, then streak onto LB solid medium without antibiotics, incubate at 37°C for 12 h until single colonies appear, pick single colonies onto LB solid medium containing 50 mg / L kanamycin, if no single colony appears, it means that the pCas9 plasmid has been successfully eliminated, and finally obtain the plasmid-free strain OSH 0-3.

[0052] 3. Construction of strain OSH 0-4

[0053] Take OSH 0-3 as the starting strain, use CRISPR / Cas9 gene editing technology to knock out the pflB gene, reduce the synthesis of byproduct formic acid, and the specific operation is as follows:

[0054] (1) Construct pTarget-pflB plasmid: take plasmid pTarget as the template, amplify pTarget-pflB-F / pTarget-pflB-R with primers, add Dpn I to the PCR product, incubate at 37°C for 1 h to eliminate methylated plasmid template. Transform into E. coli DH5a competent cells, spread on LB solid medium containing 50 mg / L spectinomycin, incubate at 30°C for 20 h until single colonies appear, perform colony PCR for preliminary verification, and finally verify the correctness of the constructed plasmid by sequencing. Prepare linearized plasmid pTarget-pflB according to the preparation method of strain OSH 0-2.

[0055] (2) Construct plasmid pTD-pflB: take E. coli W3110 genome as the template, amplify the upper and lower homology arms with L-pflB-F / L-pflB-R and R-pflB-F / R-pflB-R as primers, and transfer the upper and lower homology arms into linearized plasmid pTarget-pflB according to the construction method of strain OSH 0-2 to obtain plasmid pTD-pflB.

[0056] (3) Introduce pCas9 plasmid into strain OSH 0-3 and prepare electrotransformation competent cells according to the construction method of strain OSH 0-2.

[0057] (4) The same as the strain OSH 0-2 construction method, the plasmid pTD-pflB is introduced into the electrocompetent cells of step (3) to construct the strain OSH 4.

[0058] (5) Plasmid elimination: the plasmid in the strain of step (4) is eliminated by using the strain OSH 0-2 construction method to obtain a plasmid-free strain, which is recorded as OSH 0-4.

[0059] 4. Construction of strain OSH 0-5

[0060] Taking OSH 0-4 as the starting strain, the original promoter of the metL gene is replaced with the Trc promoter by using the CRISPR / Cas9 gene editing technology to enhance the synthesis of OSH precursor homoserine, and the specific operation is as follows:

[0061] (1) Construction of pTarget-metL plasmid: taking the plasmid pTarget as the template, the primers pTarget-metL-F / pTarget-metL-R are used for amplification, and Dpn I is added to the PCR product for 1 h at 37°C to eliminate the methylated plasmid template. Transform into E. coli DH5a competent cells, spread on LB solid medium containing 50 mg / L spectinomycin, and incubate at 30°C for 20 h until single colonies appear. Colony PCR is used for preliminary verification, and finally sequencing is used to verify the correctness of the constructed plasmid. The linearized plasmid pTarget-metL is prepared by the same method as that of strain OSH 2.

[0062] (2) Construction of plasmid pTD-metL: taking the E. coli W3110 genome as the template, the primers L-metL-F / L-metL-R and R-metL-F / R-metL-R are used for PCR amplification to obtain the upper and lower homologous arms. The same as the strain OSH 0-2 construction method, the upper and lower homologous arms are introduced into the linearized plasmid pTarget-metL to obtain the plasmid pTD-metL.

[0063] (3) The same as the strain OSH 0-2 construction method, the pCas9 plasmid is introduced into the strain OSH 0-4 and the electrocompetent cells are prepared.

[0064] (4) The same as the strain OSH 0-2 construction method, the plasmid pTD-metL is introduced into the electrocompetent cells of step (3) to construct the strain OSH 0-5.

[0065] (5) Plasmid elimination: the same as the strain OSH 2 construction method, the plasmid in the strain of step (4) is eliminated to obtain a plasmid-free strain, which is recorded as OSH 0-5.

[0066] 5. Construction of strain OSH 0-6

[0067] With OSH 0-5 as the starting strain, the arcA gene was knocked out by CRISPR / Cas9 gene editing technology, and the specific operation was as follows:

[0068] (1) Construction of pTarget-arcA plasmid: taking plasmid pTarget as the template, pTarget-arcA-F / pTarget-arcA-R as the primers for amplification, adding Dpn I to the PCR product, and incubating at 37°C for 1 h to eliminate the methylated plasmid template. Transform into E. coli DH5a competent cells, spread on LB solid medium containing 50 mg / L spectinomycin, and incubate at 30°C for 20 h until single colonies appear. Colony PCR was used for preliminary verification, and finally the correctness of the constructed plasmid was verified by sequencing. The linearized plasmid pTarget-metL was prepared according to the construction method of strain OSH 0-2.

[0069] (2) Construction of plasmid pTD-arcA: Taking E. coli W3110 genome as the template, L-arcA-F / L-arcA-R and R-arcA-F / R-arcA-R as primers, PCR amplification was used to obtain the upper and lower homologous arms. The upper and lower homologous arms were transferred into the linearized plasmid pTarget-arcA according to the construction method of strain OSH 0-2 to obtain the plasmid pTD-arcA.

[0070] (3) According to the construction method of strain OSH 0-2, the pCas9 plasmid was introduced into strain OSH 0-5 and the electrotransformation competent cells were prepared.

[0071] (4) According to the construction method of strain OSH 0-2, the plasmid pTD-arcA was transferred into the electrotransformation competent cells of step (3) to construct strain OSH6.

[0072] (5) Plasmid elimination: According to the construction method of strain OSH 0-2, the plasmid in strain of step (4) was eliminated to obtain a plasmid-free strain, which was designated as OSH 0-6.

[0073] 6. Construction of strain OSH 0-7

[0074] With OSH 0-6 as the starting strain, the iclR gene was knocked out by CRISPR / Cas9 gene editing technology, and the specific operation was as follows:

[0075] (1) Constructing pTarget-iclR plasmid: using plasmid pTarget as template, pTarget-iclR-F / pTarget-iclR-R as primers for amplification, adding Dpn I to the PCR product, 37℃ incubation for 1 h to eliminate the methylated plasmid template. Transform into E. coli DH5α competent cells, spread on LB solid medium containing 50 mg / L spectinomycin, 30℃ incubation for 20 h until single colonies appear, colony PCR for preliminary verification, and finally sequencing to verify the correctness of the constructed plasmid. Linearize the plasmid pTarget-iclR by the same method as strain OSH 0-2.

[0076] (2) Constructing plasmid pTD-iclR: using E. coli W3110 genome as template, L-iclR-F / L-iclR-R and R-iclR-F / R-iclR-R as primers, PCR amplification to obtain the upper and lower homologous arms, and then transforming the upper and lower homologous arms into linearized plasmid pTarget-iclR by the same method as strain OSH 0-2 to obtain plasmid pTD-iclR.

[0077] (3) Introducing pCas9 plasmid into strain OSH 0-6 and preparing electrotransformation competent cells by the same method as strain OSH 0-2.

[0078] (4) Transforming plasmid pTD-iclR into the electrotransformation competent cells of step (3) to construct strain OSH 0-7 by the same method as strain OSH 0-2.

[0079] (5) Plasmid elimination: eliminating the plasmid in strain OSH 0-7 of step (4) by the same method as strain OSH 0-2 to obtain a plasmid-free strain, denoted as OSH 0-7, which is the chassis strain OSH1.

[0080] Table 2. Primers used in the construction of the chassis strain

[0081] Primer name Primer sequence (5'-3') pTarget-ldhA-F TAATACTAGTCAATAACGTCGACCTTGACGGTTTTAGAGCTAGAAATAGC pTarget-ldhA-R GCTCTAAAACCGTCAAGGTCGACGTTATTGACTAGTATTATACCTAGGAC L-ldhA-F TTTTGAATTCTCTAGATCAAGTTCTACCGTGCCGAC L-ldhA-R AGCGGCAAGAAAGACTTTCTCCAGTGATGTTGA R-ldhA-R AAAGTCTTTCTTGCCGCTCCCCTGC R-ldhA-R ATCTAAGCTTCTGCAGTATAAGTTAATGTCTGTTTTGCGGTCG T-ldhA-F ATTGATCCAGGTGTTAGGCAG T-ldhA-R TGTGTGCATTACCCAACGG pTarget-adhE-F TAATACTAGTATCACTATCGCTGAACCAATGTTTTAGAGCTAGAAATAGC pTarget-adhE-R GCTCTAAAACATTGGTTCAGCGATAGTGATACTAGTATTATACCTAGGAC L-adhE-F TTGAATTCTCTAGAAGGTCTGAATCACGGTTAGC L-adhE-R CTACTGAAATGCTCTCCTGATAATGTTAAACTTT R-adhE-F GAGAGCATTTCAGTAGCGCTGTCTGGCA R-adhE-R AGATCTAAGCTTCTGCAGAGTCATCCTTCAGGTAACGTT T-adhE-F ATTGATCCAGGTGTTAGGCAG AGCGAGATCCACAAGATAATG T-adhE-R GTGGATGTGTTGGCAGACC pTarget-pflB-F TAATACTAGTAAACGTGCTCTTATCCCGTTGTTTTAGAGCTAGAAATAGC pTarget-pflB-R GCTCTAAAACAACGGGATAAGAGCACGTTTACTAGTATTATACCTAGGAC L-pflB-F TTTTGAATTCTCTAGATATATGACCGCAAATGGTCAATGGG L-pflB-R TCAAATCTAAGTAACACCTACCTTCTTAAGTGGATT R-pflB-R AGGTGTTACTTAGATTTGACTGAAATCGTACAGTAA R-pflB-R AGATCTAAGCTTCTGCAGGTCCAGACAGGTATGAATGCC T-pflB-F TTCCACCGTGTTGATTGTTGTTG T-pflB-R TGGATCTCGTCGTTCATCTGT pTarget-metL-F ACTAGTATTAACACAATGTTTACTCTGTTTTAGAGCTAGA pTarget-metL-R TAAAACAGAGTAAACATTGTGTTAATACTAGTATTATACC L-metL-F TTTGAATTCTCTAGATTCCGGGATTTCGTC L-metL-R AAAATGGACATTATTTCCCCTCCACTGCGGCAACATACATCTGGACATCTAAACT R-metL-F AATAATGTCCATTTTAATCGATAAAAACACCAAGGTTATCTGCCGACATTTCACCGACA R-metL-R TCTAAGCTTCTGCAGCTTGTTGATTAAGTA T-metL-F TGGGTCGCAGACAACGTGCT T-metL-R GCGGAATAGTCGGAACCGT pTarget-arcA-F CTGCAGAAGCTTAGATCTATTACCC pTarget-arcA-R TAATACTAGTGTGGCCTGAAATTACTGGAGGTTTTAGAGCTAGAAATAGC L-arcA-F GCTCTAAAACCTCCAGTAATTTCAGGCCACACTAGTATTATACCTAGGAC L-arcA-R CGGTGCTTTTTTTGAATTCTCTAGAAGTACCAGCAGGTCGTTGTT R-arcA-F CAGAAAAAGTCTGTATCGTGGAAATCATT R-arcA-R CGATACAGACTTTTTCTGGCGGGCAGA T-arcA-F GGGTAATAGATCTAAGCTTCTGCAGACAATTCACTCAGGGTTTGG T-arcA-R CCACTCGTCAGCACAAGCTC pTarget-iclR-F TAATACTAGTGTGGCCTGAAATTACTGGAGGTTTTAGAGCTAGAAATAGC pTarget-iclR-R GCTCTAAAACCTCCAGTAATTTCAGGCCACACTAGTATTATACCTAGGAC L-iclR-F CGGTGCTTTTTTTGAATTCTCTAGAAGTACCAGCAGGTCGTTGTT L-iclR-R CAGAAAAAGTCTGTATCGTGGAAATCATT R-iclR-F CGATACAGACTTTTTCTGGCGGGCAGA R-iclR-R GGGTAATAGATCTAAGCTTCTGCAGACAATTCACTCAGGGTTTGG T-iclR-F CCACTCGTCAGCACAAGCTC T-iclR-R TGTGTCGGCATACTATACGG pTD-line-F CTGCAGAAGCTTAGATCTATTACCC pTD-line-R TCTAGAGAATTCAAAAAAAGCACCG pTD-VF GGCCTTTTGCTCACATGTTC pTD-VF TAGCACGATCAACGGCACTG pTrc99a-metA-F CACACAGGAAACAGACCATGCCGATTCGTGTGCCGGACGA pTrc99a-metA-R GGTCTGTTTCCTGTGTGAAATTAATCCAGCGTTGGATTCAT pTrc99a-yjeH-F TTTCACACAGGAAACAGACCATGAGTGGACTCAAACAAGA pTrc99a-yjeH-R TCTCATCCGCCAAAACAGCCTTATGTGGTTATGCCATTTT T-F ACATCATAACGGTTCTGGCA T-R CGCTTCTGCGTTCTGATTTA pTrc99a-line-F AAGCTTGGCTGTTTTGGCGG pTrc99a-line-R GGTCTGTTTCCTGTGTGAAA

[0082]

Construction of strains OSH2-OSH7

[0083] Using OSH1 as the starting strain, the exogenous genes metA Gk , metA Bd , metA So , metA Yp , metA Se , and metA Vc were inserted into the OSH1 genome by knocking out and replacing the pseudogene nmpC to increase the synthesis of O-succinyl-L-homoserine, and the specific operations were as follows:

[0084] (1) Construction of pTarget-nmpC plasmid: Using plasmid pTarget as template and pTarget-nmpC-F / pTarget-nmpC-R as primers for amplification, the PCR product was digested at 37 ℃ for 1 h after adding Dpn I. The product was then purified using a Clean Up kit and transformed into E. coli DH5α. The product was plated on LB agar plates containing 50 mg / L spectinomycin and incubated upside down at 30 ℃ for 20 h. Colony PCR was used for preliminary verification, and sequencing was used to verify the correctness of the pTarget-nmpC plasmid, thus obtaining plasmid pTarget-nmpC. Then, using pTD-line-F / pTD-line-R as primers and pTarget-nmpC as template for amplification, the PCR product was digested at 37 ℃ for 3 h after adding Dpn I. The DNA fragment was recovered using a Clean Up kit to obtain linearized plasmid pTarget-nmpC.

[0085] (2) Construction of plasmid pTD-nmpC containing Donor: Using the genome of E. coli W3110 as a template, the upstream homologous arm F1 was amplified using L-nmpC-F / L-nmpC-R primers; the downstream homologous arm R1 was amplified using R-nmpC-F / R-nmpC-R primers. The upstream and downstream homologous arms were fused using L-nmpC-F / R-nmpC-R primers. The DNA fragment was recovered using a Clean up kit to obtain the fused fragment. The fused fragment and the linearized plasmid pTarget-nmpC from step (1) were then used to construct plasmid pTD-nmpC using a one-step cloning method. The plasmid was transformed into E. coli DH5α, plated on LB solid plates containing 50 mg / L spectinomycin, and incubated upside down at 30 ℃ for 20 h. Colony PCR was used to preliminarily screen for the correct strains. Finally, the correctness of plasmid pTD-nmpC was verified by sequencing.

[0086] (3) Construct a system containing metA Gk plasmid pTD-nmpC::metA Gk Using pTD-nmpC as a template and pTD-nmpC-line-F / pTD-nmpC-line-R as primers for amplification, the PCR product was digested with Dpn I at 37 °C for 3 h. The DNA fragments were recovered using a Cleanup kit to obtain the linearized plasmid pTD-nmpC. Gk The sequence is a template, metA Gk -F / metA GkR is primer amplification, Clean up kit to recover DNA fragments, and the plasmid pTD-nmpC::metA is constructed by one-step cloning method Gk , transformed into E. coli DH5a, coated on LB solid plate containing 50 mg / L spectinomycin, 30 ℃ inverted culture for 20 h, and the correct strain was screened by colony PCR, and finally the correctness of the plasmid pTD-nmpC::metA was verified by sequencing. Gk

[0087] (4) The plasmid pCas9 was transformed into the competent cells OSH1, coated on LB solid plate containing 50 mg / L kanamycin, cultured overnight at 30 ℃, and single colonies were picked into LB test tube culture medium containing 50 mg / L kanamycin resistance and cultured overnight at 30 ℃. Then 1% (volume concentration) of the inoculum was inoculated into 100 mL of LB medium, and 50 mg / L of kanamycin resistance and 10 mM of L-arabinose were added, and cultured at 180 rpm and 30 ℃ until OD 600 =0.5, centrifuged at 4 ℃ and 4000 rpm. Washed twice with 4 ℃ pre-cooled ultrapure water, and washed once with 10% pre-cooled glycerol, and finally resuspended with 10% glycerol and stored, to obtain electrotransformation competent cells.

[0088] (5) 2 μL of the plasmid constructed by the method of step (3) and 100 μL of the electrotransformation competent cells prepared by the method of step (4) were mixed and transferred into a 2 mm electroporation cup, and ice-bathed for 45 s, and then subjected to electroporation transformation using an electroporation instrument (MicroPluser TM , BIO-RAD), and the selected voltage was 2500 V. After the electroporation was completed, 700 μL of 4 ℃ pre-cooled LB medium was immediately added, mixed uniformly, and then immediately transferred to a new sterile 1.5 mL EP tube, and cultured at 30 ℃ and 150 rpm for 3 h, coated on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and cultured at 30 ℃ for 24 h, and the strain construction correctness was verified by colony PCR using T-nmpC-F / T-nmpC-R as primers and sequencing, and the strain OSH2 was successfully constructed.

[0089] ​(6) pTarget and pCas9 plasmid elimination: pick the positive single colony in step (4) and inoculate into LB liquid medium test tube containing 2 mM IPTG and 50 mg / L kanamycin, 30 °C overnight culture, dip the bacterial liquid to streak on LB solid medium containing 50 mg / L kanamycin, 30 °C inverted culture for 20 h to single colony, pick single colony to LB solid medium containing 50 mg / L spectinomycin, 30 °C inverted culture for 20 h, if no single colony appears, it means that the pTarget plasmid has been eliminated in this strain. Pick the strain without pTarget plasmid and inoculate into LB liquid medium without antibiotic, 42 °C culture for 10 h, dip the bacterial liquid to streak on LB solid medium without antibiotic, 37 °C inverted culture for 12 h to single colony, pick single colony to LB solid medium containing 50 mg / L kanamycin, if no single colony appears, it means that the pCas9 plasmid elimination is successful, and finally obtain the plasmid-free strain OSH2.

[0090] (7) Construct pTarget-nmpC::metA Bd , pTarget-nmpC::metA So , pTarget-nmpC::metA Yp , pTarget-nmpC::metA Se , pTarget-nmpC::metA Vc plasmid, using steps (1) (2) (3) method.

[0091] (8) Using steps (4) (5) (6) method, obtain plasmid-free strain, respectively recorded as OSH3, OSH4, OSH5, OSH6, OSH7.

[0092]

Construction of strain OSH8

[0093] Take OSH7 as the starting strain, use CRISPR / Cas9 gene editing technology to mutate metA Vc to resist feedback inhibition and increase the synthesis of O-succinyl-L-homoserine, the specific operation is as follows:

[0094] (1) Construct pTarget-nmpC::metA Vc(T242A) plasmid: take pTarget-nmpC::metA VcFor template, T242A-F / T242A-R was used as primer for amplification, and the PCR product was added with Dpn I and incubated at 37 ℃ for 1 h, then purified by Clean up kit, and then transformed into E. coli DH5α, and coated on LB solid plate containing 50 mg / L spectinomycin, and incubated at 30 ℃ for 20 h, and then colony PCR was performed for preliminary verification, and then sequencing was performed for verification of pTarget-nmpC::metA Vc(T242A) The correctness of the plasmid was verified, and the plasmid pTarget-nmpC::metA was obtained Vc(T242A) .

[0095] (3) The plasmid pCas9 was transformed into competent cells OSH1, and coated on LB solid plate containing 50 mg / L kanamycin, and incubated at 30 ℃ overnight. Single colonies were picked into LB test tube culture medium containing 50 mg / L kanamycin resistance, and incubated at 30 ℃ overnight. Then 1% of the volume concentration was inoculated into 100 mL of LB culture medium, and 50 mg / L of kanamycin resistance and 10 mM of L-arabinose were added, and cultured at 180 rpm and 30 ℃ until OD 600 =0.5, and centrifuged at 4 ℃ and 4000 rpm. Washed twice with 4 ℃ ultrapure water, and once with 10% cold glycerol, and finally resuspended with 10% glycerol and stored in aliquots, to obtain electrotransformation competent cells for standby.

[0096] (4) 2 μL of pTarget-nmpC::metA Vc(T242A) plasmid constructed by the method of step (2) was mixed with 100 μL of electrotransformation competent cells prepared by the method of step (3), and transferred into a 2 mm electroporation cup, and ice-bathed for 45 s, and then subjected to electroporation with an electroporation instrument (MicroPluser TM , BIO-RAD), and the selected voltage was 2500 V. After the electroporation was completed, 700 μL of 4 ℃ pre-cooled LB medium was immediately added, and then transferred into a new sterile 1.5 mL EP tube, and incubated at 30 ℃ and 150 rpm for 3 h, and then coated on LB solid medium containing 50 mg / L kanamycin and 50 mg / L spectinomycin, and incubated at 30 ℃ for 24 h. Colony PCR was performed with T-nmpC-F / T-nmpC-R as primer, and sequencing was performed to verify the correctness of the strain construction, and the strain OSH8 was successfully constructed.

[0097] (5) pTarget and pCas9 plasmid elimination: pick the positive single colony in step (4) and inoculate into LB liquid medium tube containing 2 mM IPTG and 50 mg / L kanamycin, 30 °C overnight culture, dip the bacterial liquid to streak on LB solid medium containing 50 mg / L kanamycin, 30 °C inverted culture for 20 h until single colony appears, pick the single colony to LB solid medium containing 50 mg / L spectinomycin, 30 °C inverted culture for 20 h, if no single colony appears, it means that the pTarget plasmid has been eliminated in this strain. Pick the strain without pTarget plasmid and inoculate into LB liquid medium without antibiotics, 42 °C culture for 10 h, dip the bacterial liquid to streak on LB solid medium without antibiotics, 37 °C inverted culture for 12 h until single colony appears, pick the single colony to LB solid medium containing 50 mg / L kanamycin, if no single colony appears, it means that the pCas9 plasmid elimination is successful, and finally obtain the plasmid-free strain OSH8.

[0098]

Construction of strains OSH9-OSH13

[0099] (1) Construction of pTarget-Ptrc-metA Vc(T242A) Plasmid: use plasmid pTarget as template, pTarget-metA Vc(T242A) -F / pTarget-metA Vc(T242A) -R as primers, add Dpn I to the PCR product, 37 °C incubation for 1 h to eliminate the methylated plasmid template. Transform into E. coli DH5a competent cells, spread on LB solid medium containing 50 mg / L spectinomycin, 30 °C culture for 20 h until single colony appears, colony PCR for preliminary verification, finally verify the correctness of the constructed plasmid by sequencing. Linearize the plasmid pTarget-Ptrc-metA by the method in step 2 Vc(T242A) .

[0100] (2) Construction of plasmid pTarget-Ptrc-metA Vc(T242A) : use E. coli W3110 genome as template, L-Ptrc-metA Vc(T242A) -F / L-Ptrc-metA Vc(T242A) -R and R-Ptrc-metA Vc(T242A) -F / R-Ptrc-metA Vc(T242A) -R as primers, PCR amplification to obtain the upper and lower homology arms, and the upper and lower homology arms are transferred into the linearized plasmid pTarget-Ptrc-metA Vc(T242A) by the method in step 2 to obtain the plasmid pTD-Ptrc-metA Vc(T242A) .

[0101] (3) Using the method of step 2, the pCas9 plasmid was introduced into the strain OSH1 of step 3 and the electrotransformation competent cells were prepared.

[0102] (4) Using the method of step 2, the plasmid pTD-Ptrc-metA Vc(T242A) was transformed into the electrotransformation competent cells of step (3) to construct the strain OSH9.

[0103] (5) Plasmid elimination: using the method of step 2, the plasmid in the strain of step (4) was eliminated to obtain a plasmid-free strain, which was recorded as OSH9.

[0104] (6) Using the methods of steps (1) and (2), plasmids pTarget-P1-metA Vc(T242A) , pTarget-P3-metA Vc(T242A) , pTarget-P10-metA Vc(T242A) , pTarget-PM162-metA Vc(T242A) were constructed.

[0105] (7) Using the methods of steps (3), (4) and (5), plasmid-free strains OSH10, OSH11, OSH12 and OSH13 were constructed.

[0106] Table 3. Primers used in the construction process of strains OSH 2-13

[0107] Primer name Primer sequence (5'-3') pTarget-nmpC-F TAATACTAGTCAGAATTCGGTGGTGACACTGTTTTAGAGCTAGAAATAGC pTarget-nmpC-R GCTCTAAAACAGTGTCACCACCGAATTCTGACTAGTATTATACCTAGGAC L-nmpC-F CTTTTTTTGAATTCTCTAGAACGAAGTAACCACTCTTAACAGC L-nmpC-R AAATACAGTCACTGATGCAGCTACAGCAGA R-nmpC-F CTGCATCAGTGACTGTATTTGCTGATCACTTCG R-nmpC-R ATAGATCTAAGCTTCTGCAGCTGCATGCAGTGAATGCGTA pTD-nmpC-line-F ATTGATCCAGGTGTTAGGCAG pTD-nmpC-line-R catccagaTagctgaagataaccagaaaatttgccaatgACTGATGCAGCTACAGCAGA metA Gk -F]] ctAtctggatgtctaaacgtataagcgATGCCGATCAACATTCCG metA Gk -R]] TACCAAGAAACTCCGTACGAATGGGAAGACTGTATTTGCTGATCACTTCG metA Bd -F]] TCAGCTATCTGGATGTCTAAACGTATAAGCGATGCCAATCAAGATTCCGT metA Bd -R]] AGTGATCAGCAAATACAGTCACCACGGATAACACCGTAAC metA So -F]] CAGCTATCTGGATGTCTAAACGTATAAGCGATGCCGGTTAAGATCCCGGACCAT metA So -R]] CGAAGTGATCAGCAAATACAGTCCTGAGATTCCCACGGAGTCA metA Yp -F]] TCAGCTATCTGGATGTCTAAACGTATAAGCGATGCCGATCCGTGTTCCGGA metA Yp -R]] CGAAGTGATCAGCAAATACAGTCGTCCAGAGTCGGATTCATGT metA Se -F]] TCAGCTATCTGGATGTCTAAACGTATAAGCGATGCCGATCCGTGTACTGGA metA Se -R]] CGAAGTGATCAGCAAATACAGTCGTCCAAGGTTGGATTCATGTG metA Vc -F]] CAGCTATCTGGATGTCTAAACGTATAAGCGATGCCAATCCGTATTCCAGATCAGCTG metA Vc -R]] CGAAGTGATCAGCAAATACAGTCTTCGTCTTTGGTGAAGTTCGC T-nmpC-F ACTTATCCATGGATTTCATAACCCCA T-nmpC-R GAGTCATCATGACGCCTGCT T242A-F T242A-R <![CDATA[pTarget-metA Vc(T242A) -F]]> CTAGTTTATCTTCAGCTATCTGGATGTTTTAGAGCTAGAAATAGCAAGTT [CAT] pTarget-metA Vc(T242A) -R]]> CTCTAAAACATCCAGATAGCTGAAGATAAACTAGTATTATACCTAGGACTG L-P-metA Vc(T242A) -F]] CTTTTTTTGAATTCTCTAGAACGAAGTAACCACTCTTAACAGC L-Ptrc-metA Vc(T242A) -R]] AAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAACTGATGCAGCTACAGCAGA [R-Ptrc-metA Vc(T242A) -F]] ATAATGTGTGGAATTTCACACAGGAAACAGACCGATGCCAATCCGTATTCCAGA [R-P-metA Vc(T242A) -R]] GATCTAAGCTTCTGCAGTGCTGCCCAGCAGATGTAC [L-P1-metA Vc(T242A) -R]] ACCTTGTTGTATTGTACTATGCCAGCATACTGTGCCGATATAATTGTCAACAAACTGATGCAGCTACA [R-P1-metA Vc(T242A) -F]] ACAACAAGGTGGGGAACTAGACCCCTAGGTTAAAGAGGAGAAATTAAGGATGCCAATCCGTATTCC L-P3-metA Vc(T242A) -R]] AATGGAAATTGTACTGATGCAGCTACAGCAGA P3-F AGCTGCATCAGTACAATTTCCATTCGCCATT P3-R CGGATTGGCATCTGTCGATCTCTCCCAAATTGC [R-P3-metA Vc(T242A) -F]] GGGAGAGATCGACAGATGCCAATCCGTATTCCAG L-P10-metA Vc(T242A) -R]] AGTATGGTACAAAAAGATGCGAAAGCAAATAAATTTTTTACTGATGCAGCTACAGCA [R-P10-metA Vc(T242A) -F]] ACCATACTTACAGCCATTACTAAAGAGGAGAAATACTAGGATGCCAATCCGTATTCCAGAT L-M162-metA Vc(T242A) -R]] CTCAATTATATCAACGTTGTTATCTCTTGTCAACACCGCCAGAGATAAACTGATGCAGCTACAG [R-M162-metA Vc(T242A) -F]] TATAATTGAGCCTGTACAGTACTTCAATTTGTTTAAACCAGGAAACAGCTGATGCCAATCCGTATTCC pTD-line-F CTGCAGAAGCTTAGATCTATTACCC pTD-line-R TCTAGAGAATTCAAAAAAAGCACCG pTD-VF GGCCTTTTGCTCACATGTTC pTD-VF TAGCACGATCAACGGCACTG

[0108]

Construction of strains OSH 1-A~OSH 13-A

[0109] (1) Prepare electrotransformation competent cells of strains OSH 1~OSH 13. The method for preparing the competent cells is as described above.

[0110] (2) Transform the plasmid pTrc99a-metA-yjeH into the electrotransformation competent cells of strains OSH 1~OSH 13, respectively, to construct strains OSH1 / pTrc99a-metA-yjeH~OSH13 / pTrc99a-metA-yjeH, which are recorded as strains OSH1-A~OSH13-A.

[0111] Example 2: Shake flask fermentation of strains OSH 1-A~OSH 13-A

[0112] The constructed strains OSH 1-A~OSH 13-A were verified in fermentation medium. Single colonies were picked into LB test tube medium, and cultured at 37 ℃, 180 rpm overnight to prepare seed liquid. 1 mL of seed liquid was inoculated into a 500 mL shake flask containing 20 mL of fermentation medium, and shaken at 30 ℃, 180 rpm until OD600=0.5. Then, 0.2 mM IPTG was added, and the culture was shaken at 30 ℃, 180 rpm for 48 h. After fermentation, 1 mL of fermentation broth was centrifuged at 12000 rpm for 3 min, and all the supernatant was discarded. 1 mL of distilled water was added to resuspend the bacteria and calcium carbonate, and centrifuged at 12000 rpm for 3 min to discard the supernatant. 1 mL of distilled water was added again to resuspend the bacteria and calcium carbonate, and centrifuged at 12000 rpm for 3 min to discard the supernatant. Finally, 800 μL of distilled water was added to resuspend the bacteria and calcium carbonate, and 200 μL of 20% acetic acid aqueous solution was added. The mixture was allowed to stand at room temperature for 5 min to dissolve the calcium carbonate. 100 μL of the calcium carbonate-dissolved bacterial liquid was added to 1900 μL of distilled water for 20-fold dilution, and the biomass OD600 was finally determined by spectrophotometry. The OSH was detected by Hitachi L8080 amino acid analyzer, and the specific method was described in the L8080 operation manual. LB medium: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, dissolved in deionized water, and the pH value was natural.

[0113] Fermentation medium: glucose 25 g / L, ammonium sulfate 16 g / L, yeast powder 2.5 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, CaCO3 15 g / L, salt solution 1 mL / L, wherein CaCO3 was independently sterilized (0.3 g per portion). CaCO3 and IPTG (final concentration 0.025 mM) were added at the time of inoculation.

[0114] From Figures 1-2 It can be seen that, compared with strain OSH 1-A, the shake flask yield of OSH of strains OSH 7-A and OSH 8-A containing O-succinylhomoserine transferase encoding gene metA Vc or metA Vc(T242A) from Vibrio cholerae was increased from 16.8 g / L to 17.1 g / L and 17.8 g / L, respectively. Therefore, by introducing an exogenous O-succinylhomoserine transferase and increasing the copy number of the enzyme encoding gene metA Vc or metA Vc(T242A) , the supply of precursor L-homoserine and succinyl coenzyme A can be increased, and the synthesis and transport pathway of the target product OSH can be promoted, thereby effectively increasing the accumulation of OSH. The gene metA Vc(T242A)The shake flask yield of OSH of strain OSH 9-A, in which the original promoter of metA gene was replaced by Trc promoter, was increased from 16.8 g / L to 18.8 g / L compared to strain OSH 1-A, and the yield of OSH was increased by 11%, which indicated that further enhancing the expression of key enzyme gene metA Vc(T242A) could effectively increase the accumulation of OSH.

[0115] Example 3: Fed-batch fermentation of strain OSH 9-A in 5-L fermenter

[0116] The strain OSH 9-A in Example 2 was streaked on LB plates containing 50 mg / L kanamycin and incubated at 37 °C overnight, and a single colony was picked into an LB test tube containing 50 mg / L kanamycin and incubated at 37 °C, 150 rpm overnight to prepare a seed solution. The seed solution was inoculated into 100 mL LB medium at a volume concentration of 5%, and incubated at 37 °C, 150 rpm overnight as a secondary seed solution. The secondary seed solution was inoculated into a 5-L fermenter containing 2 L fermentation medium at a volume concentration of 15%, and 0.2 mM IPTG was added. The fermentation culture was carried out at 30 °C, 500 rpm, and aeration rate of 0.5 V / V·min, and when the pH value was higher than 6.80 (the initial sugar consumption in the fermenter was completed), the automatic feeding was started, and the feeding medium was added at a rate of 25 mL / h until the pH value was lower than 6.80, and the residual sugar in the fermenter was maintained at a low level, and the sugar concentration was maintained at 0-2 g / L, and the culture was carried out for 96 h.

[0117] 5-L fermenter medium formula: glucose 25 g / L, ammonium sulfate 16 g / L, yeast extract 2.5 g / L, KH2PO4 1 g / L, MgSO4 0.5 g / L, betaine 2.0 g / L, trace metal salt solution 1 mL / L.

[0118] Feeding medium: glucose 500 g / L, (NH4)2SO4 16 g / L, yeast extract 4 g / L, KH2PO4 12.5 g / L, threonine 4 g / L, methionine 0.5 g / L, and the pH was adjusted to 6.8 with 50% ammonia water.

[0119] After fermentation, the detection of OSH was carried out using Hitachi LA8080 amino acid analyzer, and the specific method was described in the LA8080 operation manual.

[0120] Table 4. OSH production by fermentation of genetically engineered bacteria Strains Shake flask OSH (g / L) Fed-batch OSH (g / L) OSH 1-A 16.8 90.6 OSH 9-A 18.8 105.4

[0121] After genetic engineering operation, the OSH yield of the genetically engineered bacteria OSH 9-A reaches 18.8 g / L through shake flask fermentation, and the OSH yield reaches 105.4 g / L through fed-batch fermentation in a 5 L fermenter. Therefore, the OSH genetically engineered bacteria constructed in the application can realize effective accumulation of OSH in the fermentation broth in the fermentation process, and lays a foundation for construction of genetically engineered bacteria strains with high OSH yield.

[0122] The above-described embodiments are merely preferred embodiments of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application.

Claims

1. A method for constructing an O-succinyl-L-homoserine high-yield engineered bacterium, characterized in that, comprises: The application discloses a method for constructing a high-yield O-succinyl-L-homoserine genetically engineered bacterium by replacing a pseudogene on a genome of a chassis bacterium with a high-homoserine transsuccinylase encoding gene derived from nmpC Vibrio cholerae metA Vc , introducing an overexpression plasmid containing a gene metA and a gene yjeH .​​ 2. The method of claim 1, wherein, The gene metA Vc The gene encoding the homoserine transsuccinylase T242A mutant metA Vc(T242A) .

3. The method of claim 2, wherein, The method also includes replacing the native promoter of the gene metA Vc or the native promoter of the gene metA Vc(T242A) with a Trc promoter.

4. The method of claim 1, wherein, The chassis fungus is E. coli W3110, Δ metI Δ metJ Δ thrB Δ metB Δ ldhA Δ adhE Δ pflB P trc -metL Δ arcA Δ iclR .

5. The method of claim 1, wherein, The high-servlne transsuccinylase-encoding gene derived from Vibrio cholerae The amino acid sequence of the high-servlne transsuccinylase-encoding gene derived from metA is shown in SEQ ID NO. 6 or SEQ ID NO.

12.

6. The genetically engineered O-succinyl-L-homoserine-producing strain constructed by the method of any one of claims 1-5.

7. The genetically engineered O-succinyl-L-homoserine-producing bacterium according to claim 6, wherein the bacterium is Escherichia coli. The genetically engineered bacteria for producing O-succinyl-L-homoserine is: E. coli W3110, Δ metI Δ metJ Δ thrB Δ metB Δ ldhA Δ adhE Δ pflB P trc -metL Δ arcA Δ iclR Δ nmpC ::Ptrc- metA Vc(T242A) / pTrc99a- metA-yjeH .

8. A mutant homospermidine transsuccinylase, characterized in that, The mutant is obtained by mutating the threonine at position 242 of the amino acid sequence shown in SEQ ID NO. 6 to alanine.

9. The high-yield O-succinyl-L-homoserine-producing genetically engineered strain constructed by the method of any one of claims 1-5, the high-yield O-succinyl-L-homoserine-producing genetically engineered strain of any one of claims 6-7, or the application of the homoserine transsuccinylase mutant of claim 8 in the microbial fermentation production of O-succinyl-L-homoserine.

10. The use according to claim 9, wherein the compound is ###0005### comprises: The engineered strain containing the gene encoding the homoserine transsuccinylase mutant or the high-yield O-succinyl-L-homoserine-producing genetically engineered strain is inoculated into a fermentation medium, and fermentation culture is carried out at 28-37°C and 100-500 rpm for 48-65 h. After the fermentation is completed, the supernatant of the fermentation broth is separated and purified to obtain O-succinyl-L-homoserine.

Images