Application of broccoli BoHXK2LF gene in improving content of indole glucosinolate in broccoli and fusarium resistance

Abstract

The invention provides an application of a broccoli BoHXK2LF gene in improving the content of indole glucosinolate in broccoli and the resistance of broccoli to fusarium. The invention relates to an application of an overexpression BoHXK2LF gene. The application is any one of the following applications: A1) an application in improving the resistance of broccoli to fusarium; a2) application in cultivation of fusarium-resistant broccoli; a3) application in increasing the content of new glucose brassinolide in broccoli; a4) in increasing the content of total indole glucosinolate in broccoli; a5) application in increasing the content of total glucosinolate in broccoli; wherein the nucleotide sequence of the BoHXK2LF gene is as shown in SEQ ID NO. 1 (sequence identifier number 1). The resistance of broccoli plants to pathogenic fungi (such as fusarium layered) can be improved. The method has important theoretical significance and practical value for cultivating high-disease-resistance broccoli, reducing pesticide application and promoting agricultural sustainable development.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant breeding, and particularly relates to application of a Brassica oleracea BoHXK2 LF gene in improving indole glucosinolate content and Fusarium resistance in Brassica oleracea. BACKGROUND

[0002] Brassica oleracea var.italica, also known as green flower, green cauliflower or green broccoli, is an important variety of Brassica oleracea var.italica of Brassica oleracea var.italica. As a nutrient-rich international popular vegetable, Brassica oleracea var.italica enjoys the reputation of "nutrient treasure" and "vegetable crown".

[0003] It is of great significance to study Brassica oleracea var.italica varieties with stronger stress resistance to improve agricultural production efficiency and agricultural product quality. SUMMARY

[0004] Therefore, the present application aims to provide a Brassica oleracea BoHXK2 LF gene in improving indole glucosinolate content and Fusarium resistance in Brassica oleracea.

[0005] Based on the above purpose, the present application provides application of overexpression of a BoHXK2 LF gene, and the application is any one of the following:

[0006] A1) application in improving Fusarium resistance of Brassica oleracea;

[0007] A2) application in breeding Fusarium-resistant Brassica oleracea;

[0008] A3) application in improving neoglucobrassicin content of Brassica oleracea;

[0009] A4) application in improving total indole glucosinolate content of Brassica oleracea;

[0010] A5) application in improving total glucosinolate content of Brassica oleracea;

[0011] Among them, the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO.1.

[0012] In some embodiments, the Fusarium is Fusarium proliferatum.

[0013] The present application also provides application of a recombinant vector overexpressing a BoHXK2 LF gene, and the application is any one of the following:

[0014] A1) application in improving Fusarium resistance of Brassica oleracea;

[0015] A2) use in breeding Fusarium-resistant broccoli;

[0016] A3) use in increasing the content of neoglucobrassicin in broccoli;

[0017] A4) use in increasing the content of total indole glucosinolates in broccoli;

[0018] A5) use in increasing the content of total glucosinolates in broccoli;

[0019] wherein the nucleotide sequence of the BoHXK2 LF gene is shown in SEQ ID NO. 1.

[0020] In some embodiments, the Fusarium is F. proliferatum.

[0021] The present application also provides use of a recombinant microorganism overexpressing the BoHXK2 LF gene, wherein the use is any one of the following:

[0022] A1) use in increasing the resistance of broccoli to Fusarium;

[0023] A2) use in breeding Fusarium-resistant broccoli;

[0024] A3) use in increasing the content of neoglucobrassicin in broccoli;

[0025] A4) use in increasing the content of total indole glucosinolates in broccoli;

[0026] A5) use in increasing the content of total glucosinolates in broccoli;

[0027] wherein the nucleotide sequence of the BoHXK2 LF gene is shown in SEQ ID NO. 1.

[0028] In some embodiments, the Fusarium is F. proliferatum.

[0029] The present application provides a method for increasing the resistance of broccoli to Fusarium, which comprises increasing the content of indole glucosinolates and the resistance to Fusarium in broccoli by increasing the expression of the BoHXK2 LF gene in broccoli; the nucleotide sequence of the BoHXK2 LF gene is shown in SEQ ID NO. 1.

[0030] In some embodiments, the Fusarium is F. proliferatum.

[0031] In some embodiments, the method for increasing the resistance of broccoli to Fusarium comprises increasing the content of indole glucosinolates in broccoli by increasing the expression of the BoHXK2 LFThe expression of the gene includes increasing the BoHXK2 LF The expression of the gene.

[0032] In some embodiments, the transgene includes introducing a recombinant expression vector containing the BoHXK2 LF The gene into the Brassica oleracea.

[0033] The present application provides a method for breeding Fusarium-resistant Brassica oleracea, which includes increasing the expression of BoHXK2 LF gene in the Brassica oleracea to obtain the Fusarium-resistant Brassica oleracea; the nucleotide sequence of the BoHXK2 LF gene is shown in SEQ ID NO. 1.

[0034] In some embodiments, the Fusarium is Fusarium decemellum.

[0035] In some embodiments, the increasing the expression of the BoHXK2 LF gene in the Brassica oleracea to obtain the Fusarium-resistant Brassica oleracea includes increasing the expression of the BoHXK2 LF gene in the Brassica oleracea by a transgenic method.

[0036] In some embodiments, the transgene includes introducing a recombinant expression vector containing the BoHXK2 LF gene into the Brassica oleracea by a Ti plasmid, a plant viral vector or an Agrobacterium-mediated method.

[0037] The present application finds that the BoHXK2 LF gene in the Brassica oleracea can improve the resistance to Fusarium, for example, the resistance to Fusarium decemellum, and a transgenic Brassica oleracea with high Fusarium resistance and overexpressing BoHXK2 LF gene is obtained by an Agrobacterium transformation method.

[0038] The present application provides the application of the BoHXK2 LF gene in increasing the neoglucobrassicin content and the resistance to pathogenic fungi in the Brassica oleracea, and the transgenic Brassica oleracea plant is prepared by constructing an overexpression vector and a recombinant microorganism, so as to increase the neoglucobrassicin content in the Brassica oleracea plant and improve the resistance of the Brassica oleracea plant to pathogenic fungi (for example, Fusarium decemellum). It has important theoretical significance and practical value to breed high-disease-resistant Brassica oleracea, reduce pesticide application and promote agricultural sustainable development. BRIEF DESCRIPTION OF DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the application or the related art, the accompanying drawings needed to be used in the embodiments or the related art description will be briefly introduced. Obviously, the accompanying drawings in the following description only aim at the embodiments of the application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0040] Figure 1 BoHXK2 gene infected by Fusarium sambucinum LF Figure of the result of Brassica oleracea plant with BoHXK2 gene;

[0041] Figure 2 BoHXK2 gene infected by Fusarium sambucinum LF Figure of the result of glucosinolate content analysis in hairy roots of Brassica oleracea with BoHXK2 gene and control;

[0042] Figure 3 BoHXK2 gene coding region LF Figure of the result of cloning PCR of BoHXK2 gene coding region;

[0043] Figure 4 Figure of the schematic diagram of vector for genetic transformation;

[0044] Figure 5 Figure of the result of GFP fluorescence signal detection of Brassica oleracea hairy root transformation system;

[0045] Figure 6 BoHXK2 gene expression level analysis in Brassica oleracea hairy roots with BoHXK2 gene and control; LF Figure of the result of BoHXK2 gene expression level analysis in Brassica oleracea hairy roots with BoHXK2 gene and control. DETAILED DESCRIPTION

[0046] In order to make the purpose, technical solutions and advantages of the application more clear, the application will be further described in detail below with specific embodiments and with reference to the accompanying drawings.

[0047] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in the embodiments of the application should be understood as the common meanings understood by those skilled in the art to which the embodiments of the application belong. The "including" or "containing" and similar words used in the embodiments of the application mean that the elements or objects before the words cover the elements or objects listed after the words and their equivalents, and do not exclude other elements or objects.

[0048] The yield and quality of broccoli are affected by multiple factors, and glucosinolates (GSs) content plays a key role in plant defense mechanisms. Glucosinolates are a class of nitrogen- and sulfur-containing plant secondary metabolites, which are widely distributed in Brassicaceae plants. These compounds play an important role in plant stress resistance and have become a hot research field in plant secondary metabolism. In the plant defense system, the glucosinolate pathway is involved in plant resistance to diseases and pests through its unique "sulfur bomb" mechanism, and is closely related to plant innate immunity and broad-spectrum antifungal activity. Studies have shown that aliphatic and indole glucosinolates are involved in the resistance of Brassica crops to the saprophytic fungus Sclerotinia sclerotiorum. In particular, it is worth noting that the transcription factor WRKY33 can quickly respond to the infection of Alternaria brassicae and induce de novo synthesis and specific side chain modification of indole glucosinolates in Arabidopsis and Brassica vegetables, and the specific side chain modification product 4-methoxy-indole 3-methyl glucosinolate has been confirmed to have significant antibacterial activity. In terms of heavy metal stress, it has been found that BGLU28 and BGLU30 genes in Arabidopsis can regulate the metabolic network of sulfur-containing detoxification substances under cadmium stress, promote the degradation of aliphatic glucosinolates, and thus enhance the tolerance of plants to cadmium. This process involves the accumulation of various sulfur-containing detoxification substances such as glutathione, plant chelating peptides, and metallothioneins.

[0049] Therefore, by analyzing the metabolic pathway and regulation mechanism of glucosinolates, it has become an important direction for broccoli to improve its bioavailability and health benefits in a sustainable way. It is helpful to cultivate broccoli varieties with higher glucosinolate content and stronger stress resistance through genetic engineering or traditional breeding methods, and will also provide new strategies for improving agricultural production efficiency and product quality.

[0050] Based on this, the present application provides the application of BoHXK2 LF gene, including the application of overexpressing BoHXK2 LF gene. The nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO: 1. The BoHXK2 LF gene is a broccoli gene. The application can be any of the following applications:

[0051] A1) application in improving the resistance of broccoli to Fusarium. The Fusarium can be Fusarium proliferatum. Improving the resistance of broccoli to Fusarium can manifest as reducing the wilting degree of broccoli, such as Figure 1 .

[0052] A2) Application in cultivating Fusarium-resistant broccoli. Fusarium-resistant broccoli can be understood as broccoli with enhanced resistance to Fusarium compared to ordinary broccoli. Fusarium can be Fusarium proliferatum.

[0053] A3) Application in increasing the content of neoglucobrassin in broccoli. Neoglucobrassin (also known as 1-methoxy-indole-3-methylglucosinolate) (NGBS) is an indole glucosinolate.

[0054] A4) Application in increasing the total indole glucosinolate content of broccoli. For example... Figure 2 As shown, the increase in total indole glucosinolate (IGLs) content is mainly reflected in the increase in neoglucosinolate content.

[0055] A5) Application in increasing the total glucosinolate content of broccoli. For example... Figure 2 As shown, the increase in total glucosinolate (GLS) content is mainly reflected in the increase in neoglucosinolate content.

[0056] This application provides the BoHXK2 nucleotide sequence as shown in SEQ ID NO:1. LF Genes, through overexpression in broccoli (e.g., upregulation or enhancement of BoHXK2 in broccoli) LF Gene expression can enhance broccoli's resistance to pathogenic fungi, which is of great significance and application value for breeding Fusarium-resistant broccoli varieties. This will help reduce the use of chemical pesticides and promote sustainable agricultural development.

[0057] Based on the same inventive concept, this application also provides overexpression of BoHXK2. LF Applications of recombinant vectors. The vector can be a plasmid, granulosome, bacteriophage, or viral vector. The vector can be pCAMBIA1301-35S-eGFP. When constructing the recombinant vector, a linearized vector can be used, constructed using homologous recombination. The application can be any of the following:

[0058] A1) Application in improving the resistance of broccoli to Fusarium;

[0059] A2) Application in cultivating Fusarium-resistant broccoli;

[0060] A3) Application in increasing the content of neoglucosinolates in broccoli;

[0061] A4) Application in increasing the total indole glucosinolate content of broccoli;

[0062] A5) use in increasing total glucosinolate content in Brassica oleracea;

[0063] wherein the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO. 1.

[0064] It should be understood that the recombinant microorganism overexpressing the BoHXK2 LF gene comprises DNA capable of expressing the BoHXK2 LF gene in Brassica oleracea, and has the effect of overexpressing the BoHXK2 LF gene, which will not be repeated here.

[0065] Based on the same inventive concept, the present application also provides use of a recombinant microorganism overexpressing the BoHXK2 LF gene. The microorganism can be yeast, bacteria, algae or fungi, for example Agrobacterium. The recombinant microorganism refers to a microorganism whose genes are operated and modified, thereby obtaining a recombinant microorganism with changed functions. For example, the recombinant microorganism obtained after introducing the above-mentioned recombinant vector into the target microorganism. The recombinant microorganism can be understood not only as a specific recombinant microorganism, but also as the offspring of such cells, and due to natural, accidental or intentional mutations and / or changes, the offspring can not necessarily be completely consistent with the original parent cell, but is still included in the range of recombinant microorganisms. The recombinant microorganism can be Agrobacterium containing the above-mentioned recombinant vector. The use can be any of the following uses:

[0066] A1) use in improving the resistance of Brassica oleracea to Fusarium;

[0067] A2) use in breeding Fusarium-resistant Brassica oleracea;

[0068] A3) use in increasing neoglucobrassicin content in Brassica oleracea;

[0069] A4) use in increasing total indole glucosinolate content in Brassica oleracea;

[0070] A5) use in increasing total glucosinolate content in Brassica oleracea;

[0071] wherein the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO. 1.

[0072] It should be understood that the recombinant microorganism overexpressing the BoHXK2 LF gene comprises DNA capable of expressing the BoHXK2 LF gene in Brassica oleracea, and has the effect of overexpressing the BoHXK2 LF gene, which will not be repeated here.

[0073] Based on the same inventive concept, the present application also provides a method for improving the resistance of broccoli to Fusarium, which comprises improving the expression of BoHXK2 LF gene in broccoli to improve the resistance of broccoli to Fusarium; the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO. 1.

[0074] In some embodiments, the improvement of the expression of BoHXK2 LF gene in broccoli comprises improving the expression of BoHXK2 LF gene in broccoli by transgenic methods. The Fusarium can be Fusarium proliferatum.

[0075] In some embodiments, the transgenic methods can comprise introducing a recombinant bacterium containing the BoHXK2 LF gene into broccoli by Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation or Agrobacterium-mediated methods to improve the expression of BoHXK2 LF gene in broccoli.

[0076] It should be understood that the method for improving the resistance of broccoli to Fusarium by improving the expression of BoHXK2 LF gene in broccoli has the corresponding effect of overexpressing BoHXK2 LF gene, which will not be repeated here.

[0077] Based on the same inventive concept, the present application also provides a method for breeding Fusarium-resistant broccoli, which comprises improving the expression of BoHXK2 LF gene in broccoli to obtain Fusarium-resistant broccoli; the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO. 1.

[0078] In some embodiments, the Fusarium is Fusarium proliferatum.

[0079] In some embodiments, the improvement of the expression of BoHXK2 LF gene in broccoli to obtain Fusarium-resistant broccoli comprises improving the expression of BoHXK2 LF gene in broccoli by transgenic methods to obtain Fusarium-resistant broccoli, i.e. transgenic broccoli.

[0080] In some embodiments, the transgenic methods comprise introducing a recombinant expression vector containing the BoHXK2 LF gene into broccoli by Ti plasmid, plant virus vector or Agrobacterium-mediated methods.

[0081] In some embodiments, the method for cultivating Fusarium-resistant broccoli (i.e., transgenic broccoli) can comprise:

[0082] S1. Designing a primer pair BoHXK2 LF The nucleotide sequence of the BoHXK2 LF gene is shown in SEQ ID NO: 1. The primer pair can comprise: a BoHXK2 LF - upstream primer, the sequence of which is shown in SEQ ID NO: 2; and a BoHXK2 LF - downstream primer, the sequence of which is shown in SEQ ID NO: 3.

[0083] S2. Cloning the BoHXK2 LF gene sequence obtained in S1 and connecting it with a pCAMBIA1301-35S-eGFP vector to obtain an expression vector.

[0084] S3. Transferring the expression vector obtained in S2 into Agrobacterium rhizogenes to obtain a recombinant bacterium, which can be Agrobacterium rhizogenes ATCC15834. The method for infection of the recombinant bacterium can be Agrobacterium rhizogenes-mediated method.

[0085] S4. Infection of the recombinant bacterium obtained in S3 into a broccoli plant to obtain a transgenic broccoli plant.

[0086] It should be understood that the method for cultivating Fusarium-resistant broccoli has the effect of overexpression of BoHXK2 LF gene by increasing the expression of the BoHXK2 LF gene of broccoli, which will not be described here again.

[0087] The technical solutions of the present application will be further described below in combination with specific embodiments.

[0088] In the following examples, the experimental methods are all conventional methods unless otherwise specified.

[0089] In the following examples, the experimental materials are all purchased from conventional biochemical reagent stores unless otherwise specified.

[0090] Example 1. Amplification of BoHXK2 LF gene and construction of recombinant vector

[0091] 1. Name of target gene: BoHXK2 LF gene. Gene sequence: SEQ ID NO: 1

[0092]

[0093] The cDNA of the whole "excellent" broccoli seedling grown for 7 days was used as a template for amplification, and BoHXK2 LF - the sequence of the upstream primer and BoHXK2 LF - the sequence of the downstream primer, according to the PCR reaction system in Table 1, to amplify BoHXK2 LF gene sequence, and the target band was obtained after electrophoresis, as shown in Figure 3 the sequence of the upstream primer and BoHXK2 LF - the sequence of the downstream primer, according to the PCR reaction system in Table 1, to amplify BoHXK2 LF - the sequence of the downstream primer, according to the PCR reaction system in Table 1, to amplify BoHXK2

[0094] the sequence of the upstream primer and BoHXK2 LF - the sequence of the upstream primer (SEQ ID NO: 2): ATGGGTAAAGTGGCTGTTGGT

[0095] the sequence of the upstream primer and BoHXK2 LF - the sequence of the downstream primer (SEQ ID NO: 3): TTAACTTGTTTCAGAGTCATCG

[0096] The reaction system in the PCR program is shown in Table 1.

[0097] Table 1 PCR reaction system

[0098]

[0099]

[0100] The PCR reaction program is: 95°C pre-denaturation for 3 min→ (95°C denaturation for 15 s→ 52°C annealing for 15 s→ 72°C extension for 1 min 40 s) × 35 cycles→ 72°C extension for 5 min→ 4°C.

[0101] 2. Recovery of the target fragment and vector ligation

[0102] Recovery of the target fragment: FastPure Gel DNA Extraction Mini Kit was used for recovery and purification, and the operation method is as follows:

[0103] (1) Quickly cut the gel containing the target DNA fragment under the ultraviolet lamp, and weigh the gel (remove the weight of the empty tube).

[0104] (2) Add an equal volume of Buffer GDP. Heat in a metal bath at 55°C until completely melted, and mix well twice during heating to accelerate the solution of the gel.

[0105] (3) Add the solution to the adsorption column, centrifuge at 12000 rpm for 60 sec. Discard the filtrate.

[0106] (4) Add 300 μL Buffer GDP and stand for 1 min. Centrifuge at 12000 rpm for 60 sec. Discard the filtrate.

[0107] (5) Put the adsorption column into a new collection tube, add 700 μL Buffer GW (with anhydrous ethanol added) to the adsorption column. Centrifuge at 12000 rpm for 60 sec. (Repeat once).

[0108] (6) Put the adsorption column into a 1.5 ml sterilized centrifuge tube, add 20 μL Elution Buffer to the center of the adsorption column, and stand for 2 min. Centrifuge at 12000 rpm for 1 min, and the eluted product is the purified target fragment.

[0109] Vector ligation: The expression vector was constructed using the method of homologous recombination, and the recombination system is shown in Table 2 below:

[0110] Table 2 Construction of expression vector

[0111] System Volume Biorun 2 EasyClone Mix 10 μL Linearized vector (pCAMBIA1301-35S-eGFP) 5 μL Purified target fragment 5 μL RNase Free H2O 0 μL

[0112] Ligation conditions: reaction at 37°C for 1 hour.

[0113] Example 2. Obtain recombinant bacteria

[0114] Take 1 μL of the constructed plasmid, add it to 50 μL of melted Agrobacterium tumefaciens ATCC15834 competent cells, mix well by pipetting, and then insert into ice. Set the electroporation program: C = 25 μF, PC = 200 Ω, V = 2400 V. Add the ice-bathed mixture to the pre-cooled electroporation cup, cover the cup, wipe dry, and then put it into the electroporation tank. Start the electric shock, and after the electric shock is completed, quickly insert into ice, and add 1 ml of TY medium without antibiotics. Culture at 28°C for 3 hours, then spread on solid medium containing Kana, and culture for 48 h. Perform colony PCR identification, and the correct one is used for hairy root transformation.

[0115] Example 3. Obtain transgenic broccoli hairy roots

[0116] Broccoli is grown to 2 weeks, and healthy seedlings with consistent growth are selected for infection with the bacteria obtained in Example 2 and empty vectors without the target gene fragment. The infection process is as follows: make an oblique cut 2 cm below the cotyledon, scrape the bacteria from the oblique cut surface, and quickly insert into a flowerpot containing only vermiculite. OD 600= 0.8 was injected into the root, and immediately a transparent plastic cup was buckled to keep the moisture, and to ensure sufficient water, after a week of growth, a large number of hairy roots appeared on the section, and the non-inclined root system was removed, and then the mixture of soil and vermiculite 1:1 was planted again, and the 35S:BoHXK2 LF Hairy roots (as shown in Figure 4 and the control group of broccoli into which the empty vector was inserted.

[0117] Green fluorescence detection and BoHXK2 LF gene expression detection were performed on the hairy roots. Positive broccoli hairy root chimeras were obtained, as shown in Figure 5 BoHXK2 LF gene expression detection was performed on the control group of broccoli into which the empty vector was inserted, and the expression level detection results are shown in Figure 6

[0118] Primer identification: BoHXK2 LF -qpcr-upstream (SEQ ID NO: 4): GTAAAGTGGCTGTTGGTGCG

[0119] BoHXK2 LF -qpcr-downstream (SEQ ID NO: 5): CTCCTCGAGAACCCTCAGGA

[0120] Example 4. Extraction and determination of glucosinolate

[0121] 40 mg of dry broccoli sample of transgenic broccoli hairy root tissue obtained in Example 3 and control group of broccoli into which the empty vector was inserted was weighed, 1 mL of preheated methanol was added, 25 μL of 5 mmol / L benzyl glucosinolate was added as an internal standard, and it was boiled in a water bath for 10 min. The supernatant was collected, 1 mL of preheated methanol was added again, and the operation was repeated, and the mixed supernatant of the two times of extraction was the crude extract of glucosinolate. The crude extract was added to an activated DEAE-Sephadex A-25 chromatography column, washed once with methanol, twice with ddH2O, and finally once with acetic acid buffer. 0.5 mL of sulfatase was added, and after desulfurization at 25°C overnight, it was eluted with 500 μL of ddH2O three times. After the desulfurization treatment of glucosinolate, chromatographic analysis was performed on a Sciex Exion LC system (Sciex, CA, USA) using a Waters ACQUITYT3 chromatography column (50×2.1 mm, 1.8 μm). The mobile phase was ddH2O and methanol, and the flow rate was 0.5 mL / min. Desulfurized glucosinolate was separated by ultra-high performance liquid chromatography (UPLC), and the product peaks were integrated respectively, and the content of each product was calculated by the peak area ratio of each product to the internal standard GTP, i.e. the peak area quantitative method. The detection results are shown in Figure 2 ​as shown.

[0122] Example 5. Fusarium proliferatum infection

[0123] Fusarium proliferatum hyphae were scraped from PDA liquid medium and cultured at 28°C. The OD 600 = 0.8 of the Fusarium proliferatum liquid was divided into 150 mL conical flasks, 30 mL was poured into each conical flask, and the broccoli plants were moved into the conical flasks for 24 h of infection. The control group CK and the overexpression BoHXK2 LF broccoli plants were each biologically repeated in three groups. The control group CK and the overexpression BoHXK2 LF broccoli plants were observed. The results are shown in Figure 1 Figure 1 Part A is a culture diagram of Fusarium proliferatum. B is the appearance of the control broccoli plants with empty vector after infection with Fusarium proliferatum. C is the appearance of the broccoli plants with transgenic hairy roots after infection with Fusarium proliferatum.

[0124] Results analysis

[0125] As can be seen from Figure 3 , the BoHXK2 LF gene can be cloned by designing primers.

[0126] As can be seen from Figure 4 , Figure 5 and Figure 6 , the pCAMBIA1301-35S-BoHXK2 LF -eGFP vector was constructed, and an overexpression system was established in broccoli hairy roots using the Agrobacterium rhizogenes-mediated gene transfer system, and BoHXK2 LF was overexpressed in broccoli. Therefore, broccoli seedlings with transgenic hairy roots were obtained, and they were confirmed. As can be seen from Figure 6 , the expression level of BoHXK2 LF in the underground part of the overexpression strain was significantly increased compared to the expression level of BoHXK2 LF in the underground part of the control broccoli plants with empty vector. Therefore, broccoli seedlings with transgenic hairy roots can be used as transgenic plants overexpressing BoHXK2 LF .

[0127] As can be seen from Figure 2 , in the root tissue of the overexpression strain, BoHXK2 LF was overexpressed.The content of new glucobrassicin (NGBS), total indole glucosinolates (IGLs) and total glucosinolates (GLS) can be significantly improved. It can be seen that the increase of the content of total indole glucosinolates (IGLs) and total glucosinolates (GLS) is mainly manifested as the increase of new glucobrassicin (NGBS).

[0128] By Figure 1 It can be seen that the broccoli plant with transgenic hairy roots can significantly slow down the wilting degree of the plant after being infected with Fusarium proliferatum for 12 hours compared with the control broccoli plant into which the empty vector is introduced. Therefore, overexpression of BoHXK2 LF gene in broccoli can improve the resistance of broccoli plant to Fusarium proliferatum.

[0129] The above results show that the method provided in the embodiments of the present application can significantly improve the content of new glucobrassicin (NGBS) and the resistance to pathogenic fungi of the broccoli plant by constructing the broccoli plant with overexpression of BoHXK2 LF transgenic line, and has the advantages of simple method and the like.

[0130] Those skilled in the art should understand that the discussion of any of the above embodiments is merely exemplary and is not intended to suggest that the scope of the disclosure (including the claims) is limited to these examples; under the concept of the present disclosure, the technical features in the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other changes of different aspects of the embodiments of the present disclosure as described above, which are not provided in details for the sake of brevity.

[0131] Although the present disclosure has been described in conjunction with the specific embodiments thereof, it will be understood that many alternatives, modifications and variations will be apparent to those skilled in the art in light of the foregoing description.

[0132] The embodiments of the present disclosure are intended to cover all such alternatives, modifications and variations as falling within the broad scope of the appended claims. Accordingly, any omission, modification, equivalent replacement, improvement, etc. made within the spirit and principle of the embodiments of the present disclosure should be included in the protection scope of the present disclosure.

Claims

1. Overexpression of BoHXK2 LF application characterized in that, The use is any one of: A1) use in increasing broccoli resistance to Fusarium; A2) use in breeding Fusarium resistant broccoli; A3) use in increasing broccoli neoglucobrassicin content; A4) use in increasing broccoli total indole glucosinolate content; A5) use in increasing broccoli total glucosinolate content; The BoHXK2 LF The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The Fusarium is F. decemcellulare.

3. Overexpression of BoHXK2 LF application of a recombinant vector of a gene, characterized in that, The use is any one of: A1) use in increasing broccoli resistance to Fusarium; A2) use in breeding Fusarium resistant broccoli; A3) use in increasing broccoli neoglucobrassicin content; A4) use in increasing broccoli total indole glucosinolate content; A5) use in increasing broccoli total glucosinolate content; The BoHXK2 LF The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

4. Use according to claim 3, characterized in that, The Fusarium is F. decemcellulare.

5. Overexpression of BoHXK2 LF The use of a recombinant microorganism of a gene characterized in that, The use is any one of: A1) use in increasing broccoli resistance to Fusarium; A2) use in breeding Fusarium resistant broccoli; A3) use in increasing broccoli neoglucobrassicin content; A4) use in increasing broccoli total indole glucosinolate content; A5) use in increasing broccoli total glucosinolate content; The BoHXK2 LF The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

6. Use according to claim 5, characterized in that, The Fusarium is F. decemcellulare.

7. A method of increasing resistance of broccoli to Fusarium, characterized by, The method comprises increasing the content of indole glucosinolate and the resistance to Fusarium in broccoli by increasing the expression of BoHXK2 LF gene in broccoli; the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO.

1.

8. The method of claim 7, wherein, The increased expression of BoHXK2 LF gene in Brassica oleracea includes increasing the expression of BoHXK2 LF gene in Brassica oleracea by transgenic methods; and the Fusarium is F. proliferatum.

9. A method of breeding a Fusarium-resistant broccoli plant, comprising: The method comprises increasing the expression of BoHXK2 LF gene in broccoli to obtain Fusarium-resistant broccoli; the nucleotide sequence of the BoHXK2 LF gene is shown as SEQ ID NO.

1.

10. The method of claim 9, wherein, The Fusarium is F. decemcellulare.

Images