Method for rapidly identifying A1 and A2 genotype beta-casein of dairy cow based on high throughput

By using KASP amplification and fluorescence signal typing technology, specific primers and standardized DNA templates were designed to solve the problem of β-casein typing of A1 and A2 genotypes in large-scale dairy cattle populations. This enabled high-throughput, rapid, and accurate genotype identification, which is suitable for large-scale dairy cattle breeding.

CN120905367APending Publication Date: 2025-11-07YANGZHOU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511023825.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-24
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are difficult to use efficiently, easily, and at low cost to rapidly genotype A1 and A2 β-casein in large-scale dairy herds, resulting in high false positive rates, cumbersome procedures, and low sensitivity, making it difficult to meet the rapid genotyping needs of large-scale dairy herds.

Method used

KASP amplification and fluorescence signal typing techniques were used to design specific primers targeting the 67th nucleotide mutation site of the β-casein CSN2 gene. Combined with standardized blood genomic DNA processing and a small-volume PCR reaction system, high-throughput genotyping was performed using a real-time fluorescence PCR instrument.

Benefits of technology

It enables precise and efficient identification of the A1/A2 genotype of bovine β-casein, significantly shortening the detection cycle and achieving an accuracy rate of over 99.9%, making it suitable for genetic screening of large-scale dairy herds.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905367A_ABST
    Figure CN120905367A_ABST
Patent Text Reader

Abstract

The invention discloses a method for rapidly identifying cow A1 and A2 genotype beta-casein based on high throughput, and relates to a KASP technology in the field of molecular markers, so that the genotype of cow beta-casein is rapidly identified. The method comprises the following steps: S1, designing a PCR (Polymerase Chain Reaction) primer according to a mutation site (A-C) of 67th nucleotide of a beta-casein CSN2 gene; s2, sample DNA rapid extraction; s3, carrying out KASP (Competitive Allele Specific Polymerase Chain Reaction); and S4, carrying out fluorescence signal scanning, and analyzing the typing result to obtain the beta-casein genotype of the sample. According to the method, DNA in blood can be rapidly extracted, a large amount of time is saved, accurate and efficient identification of the dairy cow beta-casein A1 / A2 genotype is achieved, the cost is low, and the method is suitable for genetic screening of large-group dairy cows.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genes and relates to the field of rapid confirmation of genotypes of dairy cows, in particular to a method for rapidly identifying the genotypes of A1 and A2 beta-casein of dairy cows based on high-throughput. BACKGROUND

[0002] Milk is one of the high-quality dietary sources for human beings, rich in natural high-quality animal protein, fat-soluble vitamins and trace mineral salts, and plays an important role in human health. The protein contained in milk is mainly composed of casein and whey protein. The content of casein accounts for about 80% of the total amount of milk protein, and the content of beta-casein (CSN2 gene coding) is as high as 45%. Beta-casein can be divided into A1 (histidine) or A2 (proline) type according to the nucleotide mutation encoding the 67th amino acid. The original form of casein in milk is A2 type, and A1 type casein is the result of gene mutation. Studies have shown that A2 type beta-casein has significant effects on improving intestinal immune disorders, increasing the cognition of autistic children, and increasing the content of glutathione in the blood of infants and young children, and A2 type milk does not produce beta-casomorphin (BCM-7) in the process of digestion and absorption. However, there are reports that BCM-7 is related to the occurrence of various diseases such as type I diabetes, digestive functional disorders, childhood autism, schizophrenia, hyperactivity, etc. Therefore, the allergenicity of A2 type milk is very low. Therefore, the production and development of A2 type milk has become one of the current research hotspots at home and abroad.

[0003] Currently, there are two ways to detect beta-casein typing, one is at the protein level (directly detecting the types of beta-casein in milk), and the other is at the molecular level (detecting the genotype of the cow source of milk). The difference between A2 type beta-casein and A1 type beta-casein is that the 67th amino acid is different in molecular structure. When beta-casein is directly detected, some genotypes are difficult to separate, and the false positive rate is high. However, molecular level detection can be operated in large quantities, and the cost is relatively low. At present, the methods commonly used to identify the genotype of this SNP site include PCR-RFLP, AS-PCR, SSCP, etc. However, the above methods generally have problems such as complicated operation, low sensitivity, throughput limitation, etc., and it is difficult to meet the rapid typing needs of large-scale dairy cow groups. Therefore, it is urgent to establish a new genotyping method that is simple to operate, high in sensitivity, low in cost, and suitable for large-scale sample detection, so as to promote the molecular assisted breeding and industrial development of A2 type dairy cows. SUMMARY

[0004] In view of the defects in the prior art, the purpose of the present application is to provide a method for rapidly identifying the A1 and A2 genotypes of beta-casein in dairy cows based on high-throughput.

[0005] To solve the problems in the prior art, the technical scheme adopted by the present application is:

[0006] A method for rapidly identifying the A1 and A2 genotypes of beta-casein in dairy cows based on high-throughput, the primer is designed for the mutation site of the A2 type beta-casein genotype as the identification object, and the rapid high-throughput genotyping method of KASP amplification and fluorescence signal typing technology is used to realize accurate and efficient identification of the A1 / A2 genotype of beta-casein in dairy cows, and is suitable for genetic screening of large groups of dairy cows.

[0007] As an improvement, the above method comprises the following steps:

[0008] S1: Design PCR primers according to the mutation site (A→C) of the 67th nucleotide of the beta-casein CSN2 gene;

[0009] S2: Rapid extraction of sample DNA;

[0010] S3: KASP;

[0011] S4: Fluorescence signal reading and genotyping analysis.

[0012] Further improvement is that in step S1, the primer comprises two specific forward primers and one universal reverse primer, i.e. a downstream universal primer, wherein the two specific forward primers are respectively for A1 and A2 alleles and are denoted as upstream typing primer 1 and upstream typing primer 2, and all forward primers are added with fluorescence tags FAM or VIC at the 5' end for fluorescence recognition typing.

[0013] Further improvement is that the upstream typing primer 1 (SNP1 A / C-F1): GATGTTTTGTGGGAGGCTGTTAG

[0014] The upstream typing primer 2 (SNP1 A / C-F2): GATGTTTTGTGGGAGGCTGTTAT

[0015] The downstream universal primer (SNP1 A / C-R): CCCCTTTGCCCAGACACAGT.

[0016] Further improved, in step S2, the genomic DNA in the tail vein blood of the cow is extracted by a blood genomic DNA extraction kit through a machine, wherein, before adding the KASP system, the DNA samples are diluted to the minimum qualified concentration based on the minimum qualified concentration sample passing the quality control, and the remaining samples are diluted to the minimum qualified concentration respectively, so as to ensure the stability and consistency of the template of the subsequent KASP reaction.

[0017] Further improved, the concentration of the genomic DNA is 10-50 ng / μL, and the OD260 / 280 ratio is 1.8-2.0.

[0018] Further improved, in step S3, the upstream typing primer 1, the upstream typing primer 2 and the downstream universal primer are mixed in a volume ratio of 1:1:3, and are added to the KASP reaction system to construct a 5 μL small-volume PCR system, wherein, 1.25 μL of the primer mixture and 1.25 μL of the DNA sample containing the diluted DNA sample are added to each 5 μL reaction system, so as to ensure the consistency and accuracy of the fluorescence signal typing.

[0019] Further improved, in step S4, the signal is scanned by a fluorescence quantitative PCR instrument after amplification, and a special analysis software is used for allele typing identification, different genotypes produce different fluorescence spectra, and the A1 / A2 typing of the sample is completed.

[0020] Beneficial effects:

[0021] Compared with the prior art, the method for rapidly identifying the A1 and A2 genotypes of beta-casein of the cow based on high-throughput, which is based on the primer design around the base difference of the CSN2 gene, ensures the typing specificity through the base difference at the 3' end of the F1 / F2 two primers, standardizes the concentration of the template of the blood sample to avoid typing deviation, and is finally applied to the identification in the actual pasture. The method has the following advantages:

[0022] High throughput: based on the KASP platform and the operation of the 384-well plate, the method is suitable for rapid typing of large-scale cow groups;

[0023] Fast speed: combined with automatic DNA extraction and a small-volume reaction system, the detection period is greatly shortened;

[0024] Low cost: the process is simplified and the reagents are saved, and the method is suitable for conventional breeding screening;

[0025] High accuracy: the primer design is optimized, the template concentration is uniform, the typing result is stable and reliable, and the accuracy is more than 99.9%. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0027] Wherein:

[0028] Figure 1 A1 and A2 are mutation sites of beta-casein in the present application.

[0029] Figure 2 The genotyping result of the beta-casein gene polymorphism site obtained by genotype detection in the present application. DETAILED DESCRIPTION

[0030] In order to make the purpose, technical solutions and advantages of the present application more clear, the present application will be further described in detail in combination with the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application, and are not used to limit the present application.

[0031] Embodiment 1

[0032] The SNP genotyping site of A2 cow is determined and primer is designed, which is as follows:

[0033] (1) The SNP (A>C) at the 67th codon (NCBI gene number: NC_037333.1) of the beta-casein (CSN2) gene of cow is selected as the target site, and the CSN2-g.6402 mutation causes the amino acid at this position to change from proline (Pro) to histidine (His), which corresponds to the structural difference between A2 type and A1 type beta-casein.

[0034] (2) The primer is designed according to the mutation site of A1 and A2 type beta-casein by using primer 5 software, and the primer information is as follows:

[0035] SNP1 A / C-F1:

[0036] GATGTTTTGTGGGAGGCTGTTAG

[0037] SNP1 A / C-F2:

[0038] GATGTTTTGTGGGAGGCTGTTAT

[0039] SNP1 A / C-R: CCCCTTTGCCCAGACACAGT

[0040] The mutation corresponding to primer F1 is C base, and the mutation corresponding to primer F2 is A base.

[0041] After obtaining the primers, a fluorescent tag needs to be added to the 5' end of the forward primer, with the following information:

[0042] F1(FAM):GAAGGTGACCAAGTTCATGCT

[0043] F2(VIC):GAAGGTCGGAGTCAACGGATT

[0044] Example 2

[0045] The cow blood samples used in this embodiment were obtained from Huai'an Xianchun Animal Husbandry Co., Ltd.

[0046] This embodiment involves the collection and rapid extraction of DNA samples, the construction of the KASP genotyping system and fluorescence signal detection, batch sample genotyping, and result output, as detailed below:

[0047] (1) Blood samples were collected from the tail veins of 3256 cattle. Genomic DNA was extracted from the tail vein blood using a blood genomic DNA extraction kit. The concentration and purity of the DNA were determined. The acceptable standard was a concentration of 10–50 ng / μL and an OD value of [missing value]. 260 / 280 Samples with a ratio between 1.8 and 2.0, or below the lower limit of concentration (10 ng / μL), are not included in the typing process. Samples with concentrations above the lowest level of the dilution baseline (10–50 ng / μL) are all diluted to the lowest concentration to ensure that the sample quality meets the requirements of the KASP reaction system.

[0048] (2) Construction of KASP typing reaction system and detection of fluorescence signal:

[0049] The total volume of the PCR reaction system for each sample is 5 μl, and the specific formulation is shown in Table 1 below:

[0050] Table 1 PCR reaction system

[0051]

[0052] The PCR reaction conditions are shown in Table 2 below:

[0053] Table 2 PCR reaction conditions

[0054]

[0055] After PCR amplification, a real-time quantitative PCR device supporting KASP genotyping was used (in this example, Thermo Fisher Scientific's QuantStudio was used). TM7Flex) to read the FAM / VIC channel signal. The template amount in each sample well was 1.25 μL, and the reaction system was constructed in a primer ratio of 1:1:3. The amplification procedure adopted Touchdown PCR, which was first performed for 10 cycles with a decreasing annealing temperature in each round, and then was performed for 27 cycles at a constant 55°C to enhance the efficiency of allele-specific amplification. The typing was performed by FAM / VIC cluster analysis using the matching KASP analysis software, and the typing results were exported in Excel format. This detection used a multi-plate parallel operation mode, and a single round could complete the typing determination of thousands of samples. The results were clear, the typing success rate was high, and the subsequent screening and breeding data processing of A2 dairy cows were convenient. The specific operation was entrusted to Nanjing Jisihuixiannan Biotechnology Co., Ltd.

[0056] (3) The genotyping results are shown in Table 3 as follows:

[0057] Table 3 β-casein genotyping results

[0058]

[0059] In the application of Jiangsu Huai'an Xianchun Pasture Co., Ltd., 5449 dairy cows were subjected to KASP genotyping detection of β-casein A1 / A2 genotype using the screening method of the present application, and 1770 A2 homozygous genotype dairy cows were successfully identified, providing molecular breeding support for the establishment of A2 milk production population by the enterprise. The typing results were used for precise breeding of high-value-added dairy populations, helping the enterprise to launch characteristic A2 milk products, and showing good throughput adaptability and typing stability in actual production, significantly improving the brand competitiveness and market value.

[0060] This application case verifies the reliability and adaptability of the method of the present application in actual production, indicating that it has the advantages of high throughput, accurate typing, and great popularization potential, and is suitable for rapid screening and selection of A2 type dairy cows in large-scale pastures.

[0061] In summary, the method of the present application designs KASP specific primers around the mutation site of the 67th nucleotide of the beta-casein CSN2 gene, combines fluorescence labeling and allele-specific amplification strategy, and completes the genotyping detection of the A1 / A2 genotype of dairy cows. That is, the present application combines the KASP system with the specific site of the CSN2 gene of dairy cows, and has good performance in primer specificity, reaction stability and genotyping clarity, and is suitable for high-throughput genotyping analysis in large samples. Compared with traditional PCR-RFLP, AS-PCR and other methods, the present application has the advantages of simplified operation process, no need for gel electrophoresis, shorter reaction time, suitability for automation and the like. Related studies have shown that the consistency and accuracy of the present application in population genetic detection are higher than those of traditional methods, and can reach more than 99%, which provides a more efficient solution for large-scale screening of the A2 genotype of dairy cows, and has good practical application prospect.

[0062] The embodiments described above are only part of the embodiments of the present application, rather than all the embodiments. The detailed description of the embodiments of the present application is not intended to limit the scope of the claimed application, but only represents selected embodiments of the present application. The protection scope of the present application is subject to the scope claimed in the claims, and all other embodiments obtained by those of ordinary skill in the art based on the embodiments in the present application without making creative efforts fall within the protection scope of the present application.

Claims

1. A method for rapid identification of A1, A2 genotypes of beta-casein in dairy cows based on high throughput, characterized by: The primer is designed for the mutation site of the A2 type β-casein genotype as an identification object, and the KASP amplification and fluorescence signal typing technology are used to realize the precise and efficient identification of the β-casein A1 / A2 genotype of dairy cows, which is suitable for genetic screening of large groups of dairy cows.

2. The method for identifying the genotypes of A1 and A2 β-casein of dairy cows based on high-throughput rapid identification according to claim 1, characterized in that: It comprises the following steps: ​ S1: According to the mutation site (A→C) of the 67th nucleotide of the β-casein CSN2 gene, design PCR primers; S2: Rapid extraction of sample DNA; S3: KASP; S4: Fluorescence signal reading and genotyping analysis.

3. The method for rapid identification of A1, A2 genotypes of beta-casein in dairy cows based on high-throughput according to claim 2, characterized in that: In step S1, the primer includes two specific forward primers and one universal reverse primer, i.e. the downstream universal primer, wherein the two specific forward primers are respectively for A1 and A2 alleles, and are denoted as upstream typing primer 1 and upstream typing primer 2, and all forward primers are added with fluorescence tags FAM or VIC at the 5' end for fluorescence recognition typing.

4. The method for identifying the A1 and A2 genotypes of β-casein of dairy cows based on high-throughput rapid identification according to claim 2, characterized in that: The upstream typing primer 1 (SNP1 A / C-F1) is GATGTTTTGTGGGAGGCTGTTAG. The upstream typing primer 2 (SNP1 A / C-F2) is GATGTTTTGTGGGAGGCTGTTAT. The downstream universal primer (SNP1 A / C-R) is CCCCTTTGCCCAGACACAGT.

5. The method for rapid identification of A1, A2 genotypes of beta-casein in dairy cows based on high-throughput according to claim 2, characterized in that: In step S2, the genomic DNA in the tail vein blood of dairy cows is extracted by a blood genomic DNA extraction kit through a machine, wherein the DNA samples are diluted to the minimum qualified concentration based on the minimum qualified concentration of the samples passing the quality control before being added to the KASP system, so as to ensure the stability and consistency of the template in the subsequent KASP reaction.

6. The method for rapid identification of A1, A2 genotypes of β-casein in dairy cows based on high-throughput according to claim 2, characterized in that: The concentration of the genomic DNA is 10–50 ng / μL, and the OD260 / 280 ratio is 1.8–2.

0.

7. The method for rapid identification of A1, A2 genotypes of beta-casein in dairy cows based on high-throughput according to claim 2, characterized in that: In step S3, the upstream typing primer 1, the upstream typing primer 2 and the downstream universal primer are mixed in a volume ratio of 1:1:3, and are added to the KASP reaction system to construct a 5 μL small-volume PCR system, wherein 1.25 μL of primer mixture and 1.25 μL of DNA sample containing dilution are added to each 5 μL reaction system to ensure the consistency and accuracy of the fluorescence signal typing.

8. The method for rapid identification of A1, A2 genotypes of β-casein in dairy cows based on high-throughput according to claim 2, characterized in that: In step S4, the signal is scanned by a fluorescence quantitative PCR instrument after amplification, a special analysis software is used for allele typing and identification, different genotypes produce different fluorescence spectra, and the A1 / A2 typing of the sample is completed.