Primer combination, kit and method for rapidly detecting bursaphelenchus xylophilus by convection PCR (polymerase chain reaction) fluorescence

Abstract

The invention discloses a primer combination for rapidly detecting bursaphelenchus xylophilus through convection PCR fluorescence, a kit for rapidly detecting the bursaphelenchus xylophilus through convection PCR fluorescence and comprising the primer combination, and a method for rapidly detecting the bursaphelenchus xylophilus through convection PCR fluorescence. According to the present invention, the upstream and downstream primers and the fluorescent probe are elaborately designed according to the specific gene segment of the pine wood nematode ribosome ITS region, and the detection kit containing the specific primer, the probe and the reaction solution is provided, such that the rapid amplification and the rapid fluorescent detection of the pine wood nematode target DNA region are achieved, the detection can be completed within 30 min by using the nucleic acid rapid extraction reagent, and the detection efficiency is high. The efficiency of DNA amplification and fluorescence detection is greatly improved, the detection accuracy is high, the sensitivity is high, the operation is simple, the consumed time is short, the repeatability is good, and the practicability is strong.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology detection, and particularly relates to a primer combination, a kit and a method for rapid detection of pine wood nematode by flow-through PCR. BACKGROUND

[0002] The pine wood nematode belongs to the small rod order (Rhabditida), the pad blade suborder (Tylenchina), the sliding blade superfamily (Aphelenchoidea), the sliding blade family (Aphelenchoididae), the parasitic sliding blade subfamily (Parasitaphelenchinae), and the umbrella sliding blade genus (Bursaphelenchus). The pine wood nematode is the pathogen of pine wilt disease, originated in North America, and widely occurred in coniferous trees (mainly pine) in the United States, Canada and other countries. However, most of the pine species in these countries have strong resistance, so the pine wilt disease only occurs sporadically and causes little harm. The reason may be that the pine wood nematode and pine have long co-evolved, and the pine has acquired strong disease resistance or tolerance. At the same time, the efficiency of pine wood nematode transmission by local media beetles is relatively low, and there are a large number of natural enemies. However, when the pine wood nematode is introduced into Asia and European countries through the import of pine logs, wooden packaging and other means, the host plant species, media insect community, ecological environment and natural enemy resources have changed significantly, and the harmfulness of the pine wood nematode is greatly stimulated, causing serious damage.

[0003] The pine wood nematode was first discovered in Nanjing Zijin Mountain in 1982, and then the nematode was found in Shenzhen City, Guangdong Province, Ma'anshan City, Anhui Province, Changdao County, Shandong Province, Xiangshan County, Zhejiang Province, etc., causing very serious damage. According to the information of the State Forestry and Grassland Bureau in 2020, pine wood nematode disease has occurred in a total of 18 provinces, 673 county-level administrative regions and 4187 township-level administrative regions in China, with an occurrence area of 13,753,000 mu and a number of 1,124,800 dead pine trees.

[0004] The pine wood nematode is the most harmful forestry invasive species in China, and is also an important quarantine object for internal and external inspection. The customs or forestry system detects and identifies the pine wood nematode in imported timber, wooden packaging or domestic pine, and carries out quarantine and pest control treatment on pine samples carrying the pine wood nematode, which is a key means to prevent the pine wood nematode from being introduced into China and further spreading in the country.

[0005] At present, there are morphological identification methods and various molecular biology identification methods for the pine wood nematode.

[0006] The morphological method is mainly based on the relatively stable characteristics of the tail and tail tip of the female Bursaphlenchus xylophilus and Bursaphlenchus parasiticus and the like. Although the two kinds of nematodes can be basically distinguished by observing the tail shape, there are certain morphological differences between the intra-species populations of nematodes in different regions and different strains. Bursaphlenchus parasiticus is divided into the East Asian subspecies and the European subspecies, and Bursaphlenchus xylophilus can be further divided into the R-type strain and the M-type strain, and some Bursaphlenchus xylophilus R-type strain females have short tail tips. This makes the morphological method have certain difficulty, and requires that the identification personnel can be proficient in the operation of the nematode and the microscope, and need rich identification experience. Moreover, the morphological identification method is limited to female nematodes, and cannot identify male nematodes and larvae.

[0007] Due to the limitations of the morphological method, a plurality of molecular biology methods have been developed, including species-specific PCR identification method, ITS-RFLP identification method, real-time fluorescent PCR identification method, DNA barcoding identification method, and LAMP, RPA, RCA, SEA and other isothermal amplification methods. Among the above methods, the species-specific PCR identification method and the ITS-RFLP identification method need to perform PCR amplification and gel electrophoresis observation, and the process is long and the operation is complicated; the DNA barcoding identification method needs to further perform DNA sequencing and analysis of the target gene fragment; the real-time fluorescent PCR identification method needs expensive and bulky equipment, and generally can only be completed in the laboratory. LAMP, RPA, RCA, SEA and other isothermal amplification methods are currently being rapidly researched and preliminarily applied, but there are still certain shortcomings, such as easy pollution, complicated detection steps, complex DNA extraction, inability to directly detect wood chips, and high price.

[0008] The convective PCR (CPCR: Convection PCR) fluorescent rapid detection method is a new type of PCR technology. In this technology, the amplification reagent is placed in a closed space, and the phenomenon of upward flow of hot fluid and downward flow of cold fluid is caused by maintaining the temperature difference between the upper and lower surfaces. This phenomenon is based on the density change of the fluid caused by the temperature difference between the upper and lower surfaces, thereby generating a hot convection, which provides an innovative mechanism for DNA amplification.

[0009] Compared with the ordinary fluorescent PCR amplification method, the convective PCR fluorescent rapid detection method can maintain the same sensitivity and specificity as the ordinary fluorescent PCR amplification method, greatly shorten the detection time, and make the instrument small and portable, so that the on-site detection is more convenient and reliable.

[0010] There is no convective PCR detection technology for Bursaphlenchus xylophilus in the prior art, and it is necessary to develop a convective PCR fluorescent rapid detection method for Bursaphlenchus xylophilus to improve the detection efficiency and facilitate on-site detection. SUMMARY

[0011] The present application aims to provide a rapid, specific and accurate PCR fluorescence detection method for pine wood nematode.

[0012] The present application adopts the technical solutions of:

[0013] The primer combination for PCR fluorescence detection of pine wood nematode comprises a specific primer combination, which comprises an upstream primer BX-F1X, a downstream primer BX-R1X and a fluorescent probe BX-P01, and the sequences are as follows:

[0014] BX-F1X: CGCGCAATGTTAGGCACCATCA

[0015] BX-R1X: GACAATCGAGCACGAAGCCCT

[0016] BX-P01: CCGCGACCAATATCTTCTACGCAC

[0017] The 5' end of the fluorescent probe BX-P01 is labeled with a fluorescence quenching group BHQ1, and the 3' end is labeled with a fluorescence reporter group FAM.

[0018] The present application also provides a kit for PCR fluorescence detection of pine wood nematode, which comprises a specific primer combination, and the specific primer combination comprises an upstream primer BX-F1X, a downstream primer BX-R1X and a fluorescent probe BX-P01.

[0019] Further, the kit further comprises an external reference template and an external reference amplification primer combination, and the external reference template and the external reference amplification primer combination are used to monitor whether the reaction system is normal, and the positive result of the fluorescence detection of the external reference represents that the reaction system is normal.

[0020] Further, the external reference template is a human gene RNAse P gene, and the external reference amplification primer combination comprises an external reference upstream primer HRpp-F1X, an external reference downstream primer HRpp-R1X and an external reference fluorescent probe HRpp-P01.

[0021] Further, the external reference template is a DNA plasmid comprising the human gene RNAse P gene.

[0022] The sequence of the human gene RNAse P gene is as follows:

[0023] CCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACT

[0024] The external reference amplification primer combination comprises an external reference upstream primer HRpp-F1X, an external reference downstream primer HRpp-R1X, and an external reference fluorescent probe HRpp-P01, and the sequences are as follows:

[0025] HRpp-F1X: CGTCTAGAAAAACCTGCCAAATATG

[0026] HRpp-R1X: TAGCCCAGGATGCCCTTGA

[0027] HRpp-P01: AAGAAGGTGGTGAAGCAGGCG

[0028] The 5' end of the external reference fluorescent probe HRpp-P01 is labeled with a fluorescence quenching group BHQ1, and the 3' end is labeled with a fluorescence reporter group ROX.

[0029] The external reference amplification primer combination is designed for the target gene of the external reference template human gene RNase P gene.

[0030] The convective PCR fluorescence rapid detection kit for pine wood nematode can further comprise a convective PCR amplification reaction reagent, and the convective PCR amplification reaction reagent comprises a DNA polymerase, a buffer, etc.

[0031] The convective PCR fluorescence rapid detection kit for pine wood nematode preferably comprises the following components:

[0032] A, nematode sample lysis reagent or wood chip sample lysis reagent; the composition of the nematode sample lysis reagent is 0.1-0.2 M sodium hydroxide, 1~1.2% (V / V) Triton X-100 and enzyme-free sterile water; the composition of the wood chip sample lysis reagent is 0.2 M sodium hydroxide, 5% (g / mL) polyethylene glycol 200, 5% (g / mL) dimethyl sulfoxide and enzyme-free sterile water;

[0033] B, a full-component premixed freeze-dried ball obtained by freeze-drying the following components: 5.5x AirPOC buffer 10.0 μL, Taq enzyme solution with a concentration of 5 U / μL 1.0 μL, pine nematode specific primer combination, external reference amplification primer combination; the specific primer combination comprises 1.5 μL of each of the upstream primer BX-F1X and the downstream primer BX-R1X with a concentration of 10 μM, 1.0 μL of the fluorescent probe BX-P01 with a concentration of 10 μM, the external reference amplification primer combination comprises 1.5 μL of each of the external reference upstream primer HRpp-F1X and the external reference downstream primer HRpp-R1X with a concentration of 10 μM, 1.0 μL of the external reference fluorescent probe HRpp-P01 with a concentration of 10 μM, and 8000~10000 copies of the external reference gene template;

[0034] C. DNA template dilution solution, the components are 10 mM Tris-HCl and enzyme-free sterile water.

[0035] 5.5x AirPOC buffer is purchased from Zhi Ling Long INTAG Company.

[0036] The AirPOC buffer includes 20-100 mM Tris-HCl, 1-10 mM dNTPs, 0.1%-0.5% Tween-20, 10-50 mM magnesium sulfate, 10-50 mM potassium sulfate, 10-50 mM sodium sulfate, and the solvent is enzyme-free sterile water.

[0037] The kit can also include a negative control, such as double distilled water, etc.

[0038] The application also provides a method for rapid detection of pine wood nematode by convection PCR fluorescence, which uses the kit for rapid detection of pine wood nematode by convection PCR fluorescence to perform convection PCR fluorescence detection on the sample to be tested, and the method comprises the following steps:

[0039] (1) extracting nucleic acid from the sample to be tested; the sample to be tested is a wood sample to be tested, a single nematode sample to be tested, or a nematode liquid sample to be tested;

[0040] (2) using the extracted nucleic acid as template DNA to prepare a convection PCR detection system, which includes a specific primer combination, performing convection PCR fluorescence detection, analyzing the results according to the detected fluorescence signal, and determining whether the sample to be tested contains pine wood nematode.

[0041] Further, in the step (2), the convection PCR detection system includes template DNA, an external reference template gene, an upstream primer BX-F1X, a downstream primer BX-R1X, and a fluorescence probe BX-P01, an external reference upstream primer HRpp-F1X, an external reference downstream primer HRpp-R1X, and an external reference fluorescence probe HRpp-P01, a PCR buffer, a deoxyribonucleoside triphosphate mixture (dNTP), and a DNA polymerase.

[0042] Further, the concentrations of the upstream primer BX-F1X, the downstream primer BX-R1X, and the fluorescence probe BX-P01 are each 5-15 μM, preferably 10 μM.

[0043] Preferably, the convection PCR detection system is a 55 μL system, which includes the following components:

[0044] 5.5x AirPOC buffer 10.0 μL, Taq enzyme solution 1.0 μL with a concentration of 5 U / μL, specific primer combination for Bursaphelenchus xylophilus, external reference amplification primer combination; the specific primer combination includes 1.5 μL of each of upstream primer BX-F1X and downstream primer BX-R1X with a concentration of 10 μM, 1.0 μL of fluorescent probe BX-P0l with a concentration of 10 μM, the external reference amplification primer combination includes 1.5 μL of each of external reference upstream primer HRpp-F1X and external reference downstream primer HRpp-R1X with a concentration of 10 μM, 1.0 μL of external reference fluorescent probe HRpp-P0l with a concentration of 10 μM, 5.0-10.0 μL of template DNA to be detected, 8000 copies of external reference gene template; and ddH2O is added to 55 μL.

[0045] Alternatively, the flow-through PCR detection system is prepared according to the following method:

[0046] 10 μL of template DNA is taken into 500 μL of template diluent, mixed, 60 μL of which is mixed with the full-component premixed freeze-dried ball to obtain the flow-through PCR detection system.

[0047] The full-component premixed freeze-dried ball is obtained by freeze-drying the following components: 5.5x AirPOC buffer 10.0 μL, Taq enzyme solution 1.0 μL with a concentration of 5 U / μL, specific primer combination for Bursaphelenchus xylophilus, external reference amplification primer combination; the specific primer combination includes 1.5 μL of each of upstream primer BX-F1X and downstream primer BX-R1X with a concentration of 10 μM, 1.0 μL of fluorescent probe BX-P0l with a concentration of 10 μM, the external reference amplification primer combination includes 1.5 μL of each of external reference upstream primer HRpp-F1X and external reference downstream primer HRpp-R1X with a concentration of 10 μM, 1.0 μL of external reference fluorescent probe HRpp-P0l with a concentration of 10 μM, 8000 copies of external reference gene template;

[0048] The DNA template diluent has the components of 10 mM Tris-HCl and enzyme-free sterile water.

[0049] The template DNA is obtained according to the following method: the wood chip sample to be detected, the single sample of nematode to be detected or the sample of nematode liquid to be detected is placed into the corresponding wood chip sample lysis reagent or nematode sample lysis reagent, heated at 95℃ for 5 min to lyse the nematode and release the DNA, thereby obtaining the template DNA;

[0050] The nematode sample lysis reagent has the components of 0.1-0.2 M sodium hydroxide, 1-1.2% (V / V) Triton X-100 and enzyme-free sterile water;

[0051] The composition of the wood chip sample lysis reagent is 0.2 M sodium hydroxide, 5% (g / mL) polyethylene glycol 200, 5% (g / mL) dimethyl sulfoxide and enzyme-free sterile water;

[0052] Further, in the step (1), the nucleic acid extracted from the sample to be tested can be performed according to the following steps:

[0053] For the nematode liquid sample to be tested, the supernatant is removed by centrifugation, 20 μL of nematode sample lysis reagent is added, and the mixture is heated at 95℃ for 5 min to lyse the nematodes and release DNA;

[0054] For a single nematode sample to be tested, a single nematode is picked up with a nematode picking needle into 20 μL of nematode sample lysis reagent, and the mixture is heated at 95℃ for 5 min to lyse the nematodes and release DNA;

[0055] For the wood chip sample to be tested, 50 mg of wood chips are placed in a 2 mL tube, 1 mL of wood chip sample lysis reagent is added to the tube, and the mixture is heated at 95℃ for 5 min to lyse the nematodes and release DNA;

[0056] Further, in the step (2), the flow PCR fluorescence is preferably detected by using an AirPOC-1 portable nucleic acid rapid detector or an AirPOC-4 high-throughput nucleic acid rapid detector, and the reaction conditions for detection are as follows: incubation at an upper temperature of 53.5℃ and a lower temperature of 104.5℃ for 5 min, then reaction at an upper temperature of 45.5℃ and a lower temperature of 103.8℃ for 20 min, and fluorescence signal is collected every 100 s.

[0057] The AirPOC-1 or AirPOC-4 is produced by Zhi Ling Long INTAG Company.

[0058] In the step (2), the result analysis method is as follows: when the TP value is less than or equal to 1500, it is judged to be positive, i.e. the sample to be tested contains pine wood nematodes.

[0059] The TP value is the time when the fluorescence value exceeds the set threshold value. The time when the curve fluorescence value reaches the threshold value is approximately converted to the TP value of PCR.

[0060] Further, the positive quality control (external reference) should have a typical amplification curve and TP value. Under the premise that the positive quality control is correct: if the TP value of the sample to be tested is less than or equal to 1500, the result is determined to be positive.

[0061] The application also provides a convection PCR fluorescence rapid detection device, which comprises a shell, a light source module, an upper and lower heating module, a battery, a fluorescence signal acquisition module, the shell comprises a main body and a top cover, the top cover is openable, and the addition of a sample is detected. The light source module is composed of an LED light source and a light guide column, the power module is composed of a battery, the upper and lower heating module is composed of two resistance heating plates, and the fluorescence signal acquisition module is composed of a light guide column, a filter and a photodiode.

[0062] The light source module comprises four-color LED lamps with wavelengths of 470 nm, 520 nm, 590 nm and 630 nm. The upper and lower heating module is composed of a resistance heating plate with a rated power of 10 W, a temperature change range of 30-110 DEG C and a temperature change accuracy of ± 0.5 DEG C. The power module is composed of a rechargeable lithium battery with a rated capacity of 1500 mAh. The filter of the fluorescence signal acquisition module filters wavelengths of 490 nm, 550 nm, 610 nm and 650 nm.

[0063] Compared with the prior art, the application has the beneficial effects that:

[0064] The application is based on the convection PCR technology, and the upstream primer, the downstream primer and the fluorescence probe are carefully designed for the specific gene fragment of the ribosome ITS region of the pine wood nematode. A detection kit comprising specific primers, probes and reaction solutions is provided, and the pine wood nematode can be detected by convection PCR fluorescence. The application realizes rapid amplification and fluorescence rapid detection of the target DNA segment, can detect one sample or four samples at the same time, and can complete the detection within 30 min, greatly improving the efficiency of DNA amplification and fluorescence detection. The application has high detection accuracy, high sensitivity, simple operation, short time consumption, good repeatability and strong practicability. The application can efficiently and rapidly identify the pine wood nematode in imported wood or wooden packaging, meet the rapid detection and identification or wood sample preliminary screening requirements of customs port and forestry system workers, and provide timely and reliable detection means and technical support for preventing the pine wood nematode from invading the port and the forestry department from conducting a general survey of the pine wood nematode disease. BRIEF DESCRIPTION OF DRAWINGS

[0065] Fig. 1 The sensitivity experimental results of example 4.

[0066] Fig. 2 The specificity experimental results of example 5. DETAILED DESCRIPTION

[0067] The technical solutions of the application are further described below through specific experimental examples, but the protection scope of the application is not limited thereto.

[0068] The present application is selected from the ribosomal internal transcribed spacer sequence of Bursaphelenchus xylophilus obtained by self-cloning sequencing, by comparing with the homologous genes of similar species in GenBank, using TipMT (http: / / 200.131.37.155 / tipMT / ?pg=extract) to analyze specific sites and non-specific sites, and using Primer Explorer V4 (http: / / primerexplorer.jp) to design specific primers. After a large number of reaction condition optimization, comparison test and verification test, and a large number of actual sample detection application evaluation, using the DNA of Bursaphelenchus xylophilus as a template, Bursaphelenchus pseudohaplium, Bursaphelenchus iranicus, Bursaphelenchus lignicolus, Bursaphelenchus rufus, Bursaphelenchus sp., Bursaphelenchus sp., Bursaphelenchus sp. and the like as negative controls, water as a blank control, using the primers to perform counterflow PCR detection. By observing the conservation and specificity of the amplification products, the most suitable primers and probes are screened, and finally the specific primers and fluorescent probes with good amplification efficiency and specificity are screened. The primers are synthesized by Shanghai Shengong Biotechnology Co., Ltd.

[0069] Example 1, single nematode DNA extraction method

[0070] Pick up a single nematode and put it into a 200 μL PCR tube, which has been added with 20 μL of 0.1 M NaOH and 1% TritonX-100, heat at 95℃ for 5 min, and microcentrifuge the PCR tube on a microcentrifuge to obtain the DNA template.

[0071] Example 2, nematode liquid DNA extraction method

[0072] Absorb 10 μL of nematode liquid into a 200 μL PCR tube, which has been added with 20 μL of 0.1 M NaOH and 1% TritonX-100 (or centrifuge a large amount of nematode liquid at 2000 r / min for 2 min, absorb the supernatant, then add 20 μL of 0.1 M NaOH and 1% TritonX-100), heat at 95℃ for 5 min, and microcentrifuge the PCR tube on a microcentrifuge to obtain the DNA template.

[0073] Example 3, wood chip DNA extraction method

[0074] Put 50 mg mixed sawdust into 2 ml tube, first add 1 ml sawdust sample lysis reagent (sodium hydroxide 0.2 M, polyethylene glycol 200 5%, dimethyl sulfoxide 5%) into the tube, mix the tube well, and incubate at room temperature for 10 min. During the incubation, knock the tube well three times. After incubation, directly use 2 μL lysis solution as DNA template.

[0075] Example 4, Sensitivity test - specific amplification of DNA of single pine wood nematode juvenile and gradient dilution DNA

[0076] Extract DNA of single pine wood nematode using the extraction method of Example 1, to obtain a total volume of 20 μL of DNA crude extract. Gradient dilution was performed, and the extract corresponding to 1 / 10, 1 / 20, 1 / 100, 1 / 1000, and 1 / 10000 nematodes was used as template for the test. The sensitivity of the test was tested under different DNA concentrations.

[0077] The conditions for the test are as follows:

[0078] 1. System

[0079] Take 10 μL template DNA and add it to 500 μL template diluent, mix well, then take 60 μL and mix well with the full component premixed freeze-dried ball to obtain the convective PCR detection system.

[0080] The full component premixed freeze-dried ball is obtained by freeze-drying the following components: 5.5x AirPOC buffer 10.0 μL, Taq enzyme solution with a concentration of 5 U / μL 1.0 μL, pine nematode specific primer combination, external reference amplification primer combination; the specific primer combination includes 1.5 μL of each of the upstream primer BX-F1X and the downstream primer BX-R1X with a concentration of 10 μM, 1.0 μL of the fluorescent probe BX-P0 with a concentration of 10 μM, the external reference amplification primer combination includes 1.5 μL of each of the external reference upstream primer HRpp-F1X and the external reference downstream primer HRpp-R1X with a concentration of 10 μM, 1.0 μL of the external reference fluorescent probe HRpp-P0 with a concentration of 10 μM, and 8000 copies of the external reference gene template;

[0081] The DNA template diluent is composed of 10 mM Tris-HCl and enzyme-free sterile water.

[0082] 5.5x AirPOC buffer is purchased from Zhenlinglong Company.

[0083] The composition is: 80 mM Tris-HCl, 5 mM dNTPs, 0.2% Tween-20, 20 mM magnesium sulfate, 20 mM potassium sulfate, 15 mM sodium sulfate.

[0084] The specific primer combination comprises an upstream primer BX-F1X, a downstream primer BX-R1X, and a fluorescent probe BX-P01, and the sequences are shown in SEQ ID NO. 1-3, respectively:

[0085] BX-F1X (SEQ ID NO. 1): CGCGCAATGTTAGGCACCATCA

[0086] BX-R1X (SEQ ID NO. 2): GACAATCGAGCACGAAGCCCT

[0087] BX-P01 (SEQ ID NO. 1): CCGCGACCAATATCTTCTACGCAC

[0088] The external reference amplification primer combination comprises an external reference upstream primer HRpp-F1X, an external reference downstream primer HRpp-R1X, and an external reference fluorescent probe HRpp-P01, and the sequences are shown in SEQ ID NO. 4-6, respectively:

[0089] HRpp-F1X (SEQ ID NO. 4): CGTCTAGAAAAACCTGCCAAATATG

[0090] HRpp-R1X (SEQ ID NO. 5): TAGCCCAGGATGCCCTTGA

[0091] HRpp-P01 (SEQ ID NO. 6): AAGAAGGTGGTGAAGCAGGCG

[0092] The external reference gene template is a DNA plasmid comprising a human gene RNase P gene, and the sequence of the human gene RNase P gene is shown in SEQ ID NO. 7:

[0093] SEQ ID NO. 7:

[0094] CCGTCTAGAAAAACCTGCCAAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTACACT

[0095] 2. Procedure

[0096] AirPOC-1 portable nucleic acid rapid detector or AirPOC-4 high-throughput nucleic acid rapid detector (Zhilingsong INTAG Company)

[0097] Incubate for 5 min at 53.5℃ upper and 104.5℃ lower, then react for 20 min at 45.5℃ upper and 103.8℃ lower, collect fluorescence signal every 100 s;

[0098] The experimental results are shown in Table 1, and the corresponding capital letters are external reference curves, and the lowercase letters are specific curves, A: 1 / 10; B: 1 / 20; C: 1 / 100; D: 1 / 1000; E: 1 / 10000, the results show that the application has high sensitivity, can guarantee the detection and identification of 1 / 1000 pine wood nematodes, and is suitable for popularization in practical application. Fig. 1

[0099] Example 5, specificity test - specific amplification of pine wood nematodes and similar species of nematodes

[0100] The DNA of pine wood nematodes and similar species of nematodes is extracted by the extraction method of Example 1, and the details are shown in Table 1, and the DNA of the six different species of pine wood nematodes is used as a template, and the detection method of Example 4 is used for testing. The experimental results are shown in Table 1, and the corresponding capital letters are external reference curves, and the lowercase letters are specific curves, A: BX1; B: BX2; C: BM1, D: BKR; E: BNE; F: BR1, the results show that the application has high specificity, can guarantee the accurate identification of pine wood nematodes, and is suitable for popularization in practical application. Fig. 2

[0101] The method or kit provided by the application can quickly identify pine wood nematodes, has high reliability and sensitivity, is easy to operate, does not depend on the experience of the operator, has high accuracy, and has strong practicability.

[0102] Table 1: Pine wood nematodes and similar species of nematodes used in the experiment

[0103] Species name Latin name Strain number Collection place Host pine wood nematode Bursaphelenchus xylophilus BX1 Ningbo, Zhejiang Pinus massoniana pine wood nematode Bursaphelenchus xylophilus BX2 USA Pinus elliotii Bursaphelenchus mucronatus BM1 Turkey Pine package Bursaphelenchus doui BKR Korea Pine package Bursaphelenchus fungivorus BNE Netherlands Peat Bursaphelenchus rainulfi BR1 Ningbo, Zhejiang Pinus massoniana ​ ​ ​ ​ ​​

Claims

1. A primer combination for rapid detection of pine wood nematode by convection PCR fluorescence, characterized in that The primer combination comprises a specific primer combination, including an upstream primer BX-F1X, a downstream primer BX-R1X, and a fluorescent probe BX-P01, and the sequences are as follows: BX-F1X: CGCGCAATGTTAGGCACCATCA BX-R1X: GACAATCGAGCACGAAGCCCT BX-P01: CCGCGACCAATATCTTCTACGCAC The 5' end of the fluorescent probe BX-P01 is labeled with a fluorescence quenching group BHQ1, and the 3' end is labeled with a fluorescence reporter group FAM.

2. A kit for rapid detection of Bursaphelenchus xylophilus by convective PCR fluorescence, characterized by, The kit comprises the primer combination for the convection PCR fluorescent rapid detection of pine wood nematode according to claim 1, wherein the primer combination comprises a specific primer combination, and the specific primer combination comprises an upstream primer BX-F1X, a downstream primer BX-R1X, and a fluorescent probe BX-P01.

3. The kit of claim 2, wherein The kit further comprises an external reference template and an external reference amplification primer combination, wherein the external reference template is a human gene RNase P gene, and the external reference amplification primer combination comprises an external reference upstream primer HRpp-F1X, an external reference downstream primer HRpp-R1X, and an external reference fluorescent probe HRpp-P01, and the sequences are as follows: HRpp-F1X: CGTCTAGAAAAACCTGCCAAATATG HRpp-R1X: TAGCCCAGGATGCCCTTGA HRpp-P01: AAGAAGGTGGTGAAGCAGGCG The 5' end of the external reference fluorescent probe HRpp-P01 is labeled with a fluorescence quenching group BHQ1, and the 3' end is labeled with a fluorescence reporter group ROX.

4. The kit of claim 3, wherein The kit comprises the following components: A, nematode sample lysis reagent or wood chip sample lysis reagent; B, a full-component premixed freeze-dried ball obtained by freeze-drying the following components: 5.5x AirPOC buffer 10.0 μL, Taq enzyme solution with a concentration of 5 U / μL 1.0 μL, pine nematode specific primer combination, external reference amplification primer combination; the specific primer combination comprises 1.5 μL of each of the upstream primer BX-F1X and the downstream primer BX-R1X with a concentration of 10 μM, 1.0 μL of the fluorescent probe BX-P01 with a concentration of 10 μM, the external reference amplification primer combination comprises 1.5 μL of each of the external reference upstream primer HRpp-F1X and the external reference downstream primer HRpp-R1X with a concentration of 10 μM, 1.0 μL of the external reference fluorescent probe HRpp-P01 with a concentration of 10 μM, and 8000~10000 copies of the external reference gene template; C, DNA template diluent, which is composed of 10 mM Tris-HCl and enzyme-free sterile water.

5. The kit of claim 4, wherein The composition of the nematode sample lysis reagent is 0.1-0.2 M sodium hydroxide, 1~1.2% TritonX-100 by volume fraction, and enzyme-free sterile water; the composition of the wood chip sample lysis reagent is 0.2 M sodium hydroxide, 5% polyethylene glycol 200 by mass fraction, 5% dimethyl sulfoxide by mass fraction, and enzyme-free sterile water.

6. Use of the kit for rapid detection of pine wood nematode by convective PCR fluorescence according to any one of claims 2-5 in rapid detection of pine wood nematode.

7. A method for rapid detection of pine wood nematode by convective PCR fluorescence, characterized in that The method uses the kit for rapid detection of pine wood nematode by convective PCR fluorescence according to any one of claims 2-5 to detect the sample to be tested by convective PCR fluorescence, and comprises the following steps: (1) extracting nucleic acid from the sample to be tested; the sample to be tested is a wood sample to be tested, a single nematode sample to be tested, or a nematode liquid sample to be tested; (2) using the extracted nucleic acid as template DNA to prepare a convective PCR detection system; the convective PCR detection system comprises specific primer combination, and convective PCR fluorescence detection is performed, and result analysis is performed according to the detected fluorescence signal to determine whether the sample to be tested contains pine wood nematode.

8. The method of claim 7, wherein In the step (2), the convective PCR detection system comprises template DNA, external reference template gene, upstream primer BX-F1X, downstream primer BX-R1X, and fluorescence probe BX-P01, external reference upstream primer HRpp-F1X, external reference downstream primer HRpp-R1X, and external reference fluorescence probe HRpp-P01, PCR buffer, deoxyribonucleotide triphosphate mixture, and DNA polymerase.

9. The method of claim 7, wherein In the step (2), the convective PCR detection system is prepared by the following method: 10 μL of template DNA is added to 500 μL of template diluent, mixed, and then 60 μL is mixed with a full-component premixed freeze-dried ball to obtain a convective PCR detection system; The full-component premixed freeze-dried ball is obtained by freeze-drying the following components: 5.5×AirPOC buffer 10.0 μL, Taq enzyme solution with a concentration of 5 U / μL 1.0 μL, nematode-specific primer combination, and external reference amplification primer combination; the specific primer combination comprises 1.5 μL of upstream primer BX-F1X and 1.5 μL of downstream primer BX-R1X, each with a concentration of 10 μM, 1.0 μL of fluorescence probe BX-P01 with a concentration of 10 μM, the external reference amplification primer combination comprises 1.5 μL of external reference upstream primer HRpp-F1X and 1.5 μL of external reference downstream primer HRpp-R1X, each with a concentration of 10 μM, 1.0 μL of external reference fluorescence probe HRpp-P01 with a concentration of 10 μM, and 8000 copies of external reference gene template; The DNA template diluent comprises 10 mM Tris-HCl and enzyme-free sterile water.

10. The method of claim 7, wherein The convective PCR fluorescence is detected by using an AirPOC-1 or AirPOC-4 nucleic acid rapid detector, and the reaction conditions for detection are as follows: upper temperature 53.5℃, lower temperature 104.5℃ incubation for 5 min, then upper temperature 45.5℃, lower temperature 103.8℃ reaction for 20 min, and fluorescence signal is collected every 100 s; In the step (2), the result analysis method is that when the TP value is less than or equal to 1500, it is determined to be positive, that is, the sample to be tested contains pine wood nematode.

Images