RPA-CRISPR-Cas12a system-based chilo suppressalis organophosphorus insecticide resistance detection reagent and detection method and application

By employing a dual screening mechanism combining RPA amplification and the CRISPR-Cas12a system, specific RPA primer pairs and crRNA were designed to solve the false-positive problem in the detection of organophosphate insecticide resistance in rice stem borer, enabling rapid and accurate field detection, which is suitable for monitoring insecticide resistance in pests.

CN120905394APending Publication Date: 2025-11-07JIANGXI AGRICULTURAL UNIVERSITY
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202511056861.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-30
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Existing technologies are insufficient to accurately detect the resistance of rice stem borers to organophosphate insecticides, resulting in a high false positive rate, which leads to indiscriminate application of pesticides and exacerbates the development of pesticide resistance in pests.

Method used

A dual screening mechanism combining RPA amplification and the CRISPR-Cas12a system was employed. Specific RPA primer pairs and crRNA were designed, and wild-type and mutant genes were distinguished by fluorescence signals through RPA amplification and CRISPR/Cas12a reactions, enabling accurate detection of organophosphate insecticide resistance in rice stem borer.

Benefits of technology

It enables accurate detection of organophosphate insecticide resistance in rice stem borer, reduces false positive rate, simplifies operation process, is suitable for real-time field testing, reduces equipment dependence, and improves detection efficiency and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905394A_ABST
    Figure CN120905394A_ABST
Patent Text Reader

Abstract

The invention provides an RPA-CRISPR-Cas12a system-based detection reagent for the drug resistance of a chilo suppressalis organophosphorus insecticide, a detection method and application, and belongs to the technical field of molecular detection. The invention provides a detection reagent for chilo suppressalis organophosphorus insecticide resistance, the reagent comprises a specific RPA2 primer pair designed for chilo suppressalis acetylcholin esterase ace-1 gene A314S resistance mutation site and crRNA, a double screening mechanism of RPA amplification and CRISPR-Cas12a is combined, wild type and mutant type genes can be accurately distinguished, and the detection reagent can be used for detecting the insecticide resistance of the chilo suppressalis organophosphorus insecticide resistance to the chilo suppressalis organophosphorus insecticide resistance to the chilo suppressalis organophosphorus insecticide resistance to the chilo suppressalis organophosphorus insecticide resistance to the chilo suppressalis. The rapid, sensitive and visual nucleic acid detection of the chilo suppressalis ace-1 gene A314S resistance mutation site is realized, and a visual detection means which is high in specificity, simple and convenient to operate, economical and efficient is provided for field on-site determination of chilo suppressalis resistance populations.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular detection, and particularly relates to a detection reagent and a detection method and application for Chilo suppressalis organic phosphorus pesticide resistance based on an RPA-CRISPR-Cas12a system. BACKGROUND

[0002] Chilo suppressalis (Walker) belongs to Lepidoptera and Crambidae, and is one of the most destructive pests affecting rice planting and production. Chilo suppressalis causes serious damage to rice plants by feeding on stems, and can lead to a decrease in rice yield and quality in most areas every year. Due to the long-term overuse of organic phosphorus pesticides in the past, the Chilo suppressalis population has rapidly developed cross-resistance to organic phosphorus pesticides and other pesticides. At present, the effective control of Chilo suppressalis in the field mainly relies on chemical pesticides, but the continuous and large-scale use of chemical pesticides has caused people's concerns about their efficacy and environmental impact, so it is necessary to continuously research comprehensive pest resistance monitoring and management strategies.

[0003] Organic phosphorus pesticides or their metabolites are strong inhibitors of serine esterase, mainly phosphorylating the serine hydroxyl group in the active site of esterase. From the perspective of toxicology, the main target esterase is acetylcholinesterase, and among the amino acid substitutions of acetylcholinesterase (AChE) identified in Chilo suppressalis, A314S, H668P, E101D, F402V and R667Q have been reported. The mutation represented by the ace-1 gene A314S site refers to the amino acid substitution from alanine (A) to serine (S) at the 314th site of the ace-1 gene. The mutation represented by the ace-1 gene A314S site has been proven to cause acetylcholinesterase to be insensitive to organic phosphorus pesticides, indicating that the Chilo suppressalis population has high resistance to organic phosphorus pesticides. Blind application to Chilo suppressalis populations with high resistance not only leads to cost waste, but also causes the pest resistance to intensify, so it is of great significance to identify Chilo suppressalis populations with high resistance for scientific control of Chilo suppressalis. However, there is a problem of high false positive rate in identifying the organic phosphorus pesticide resistance of Chilo suppressalis, and it is difficult to accurately detect and identify the resistance of Chilo suppressalis population to organic phosphorus pesticides. SUMMARY

[0004] In view of this, the application provides a detection reagent for Chilo suppressalis organic phosphorus pesticide resistance, which combines RPA amplification and CRISPR-Cas12a double screening mechanism to accurately distinguish between wild-type and mutant genes, and realizes detection of Chilo suppressalis organic phosphorus pesticide resistance.

[0005] To achieve the above purpose, the application provides the following technical solutions.

[0006] The application provides a detection reagent for organophosphorus pesticide resistance of Chilo suppressalis, which comprises RPA amplification reagent and CRISPR / Cas12a reagent.

[0007] The RPA amplification reagent comprises an RPA2 primer pair, wherein the RPA2 primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4.

[0008] The CRISPR / Cas12a reagent comprises crRNA, ssDNA reporter molecule and Cas12a protease, wherein the nucleotide sequence of the crRNA is as shown in SEQ ID NO: 8.

[0009] Preferably, the nucleotide sequence of the ssDNA reporter molecule is 5'-F-TTTTT-Q-3'.

[0010] The F represents a fluorescent group, and the Q represents a fluorescence quenching group.

[0011] Preferably, the fluorescent group comprises at least one of FAM, TET, VIC and HEX.

[0012] The fluorescence quenching group comprises TAMRA and / or BHQ.

[0013] Preferably, the detection reagent further comprises sample genomic DNA extraction reagent.

[0014] The application provides application of the detection reagent in at least one of the following aspects: detection of organophosphorus pesticide resistance of Chilo suppressalis and / or genotyping of A314S resistance mutation site of acetylcholinesterase ace-1 gene of Chilo suppressalis, which is not for disease diagnosis and treatment.

[0015] The application provides a detection method for organophosphorus pesticide resistance of Chilo suppressalis and / or A314S resistance mutation of ace-1 gene of Chilo suppressalis, which comprises the following steps:

[0016] The RPA amplification reagent in the detection reagent is used for amplification reaction with the genomic DNA of the Chilo suppressalis sample to be detected as a template to obtain RPA amplification product.

[0017] The RPA amplification product and the CRISPR / Cas12a reagent in the detection reagent are mixed and incubated to obtain reaction product.

[0018] According to the presence or absence of the fluorescence intensity signal of the reaction product, the sample of Chilo suppressalis to be detected is judged for resistance to organophosphorus insecticide: when the fluorescence intensity signal is detected, it indicates that the sample of Chilo suppressalis to be detected has resistance to organophosphorus insecticide and / or Chilo suppressalis produces ace-1 gene A314S resistance mutation.

[0019] Preferably, the temperature of the amplification reaction is 37℃, and the time of the amplification reaction is 4.5-5.5 min.

[0020] Preferably, the temperature of the incubation is 37℃, and the time of the incubation is 25-35 min.

[0021] Preferably, the molar concentration ratio of the Cas12a protease to the crRNA is 1:(1-8).

[0022] Preferably, the concentration of the Cas12a protease is 180-220 nM.

[0023] The working concentration of the ssDNA reporter molecule is 3-5 μM.

[0024] Compared with the prior art, the present application has the following advantages:

[0025] The present application provides a detection reagent for resistance of Chilo suppressalis to organophosphorus insecticide, characterized in that it comprises RPA amplification reaction reagent and CRISPR / Cas12a reaction reagent; the RPA amplification reaction reagent comprises RPA2 primer pair, and the RPA2 primer pair comprises forward primer with nucleotide sequence as shown in SEQ ID NO: 3 and reverse primer with nucleotide sequence as shown in SEQ ID NO: 4; the CRISPR / Cas12a reaction reagent comprises crRNA, ssDNA reporter molecule and Cas12a protease; the nucleotide sequence of the crRNA is as shown in SEQ ID NO: 8. The present application targets the A314S mutation site of Chilo suppressalis acetylcholinesterase ace-1 gene by designing specific RPA primer pair and crRNA, and combines the double screening mechanism of RPA amplification and CRISPR-Cas12a, so as to accurately distinguish wild type and mutant genes, effectively avoid non-specific amplification interference, avoid false positive problems caused by primer mismatch or non-specific amplification of traditional PCR, and the false positive rate is significantly lower than that of PCR or loop-mediated isothermal amplification (LAMP) technology which is easily affected by primer mismatch. The present application uses RPA amplification technology to enrich the target DNA to a detectable level, and the CRISPR-Cas12a system can recognize as low as a single copy of mutant gene, so that the resistant sample can be effectively detected, and the present application is suitable for actual field environment.

[0026] The application provides a detection method for Chilo suppressalis organic phosphorus insecticide resistance and / or Chilo suppressalis ace-1 gene A314S resistance mutation, comprising the following steps: taking genomic DNA of a Chilo suppressalis sample to be tested as a template, performing amplification reaction by using RPA amplification reaction reagents in the detection reagent to obtain RPA amplification products; mixing the RPA amplification products and CRISPR / Cas12a reaction reagents in the detection reagent, incubating to obtain reaction products; and judging the Chilo suppressalis sample to be tested for organic phosphorus insecticide resistance according to the presence or absence of a fluorescence intensity signal of the reaction products: when the fluorescence intensity signal is detected, it indicates that the Chilo suppressalis sample to be tested has resistance to organic phosphorus insecticides and / or Chilo suppressalis produces ace-1 gene A314S resistance mutation. The method of the application only needs a single pair of primers, simplifies the operation process; the detection result can be directly judged by a fluorescence test strip, which is free from the dependence of LAMP on a turbidimeter or a fluorescent dye, and is more suitable for field instant detection. Compared with other CRISPR detection systems (such as Cas13a targeting RNA), Cas12a can directly recognize double-stranded DNA, avoiding the reverse transcription step, and is more suitable for DNA target detection of pest drug resistance gene mutation.

[0027] The method of the application has the following specific advantages:

[0028] (1) Targeted and high specificity: the double screening mechanism of RPA amplification and CRISPR-Cas12a can accurately distinguish between wild-type and mutant genes at the A314S site of Chilo suppressalis ace-1 gene, effectively avoiding false positive problems caused by primer mismatch or non-specific amplification in traditional PCR;

[0029] (2) Strong field applicability, simple operation and pollution prevention: one-pot design is suitable for field environment, and the whole process only needs 37 DEG C constant temperature reaction and simple incubation device, which can be completed by manual shaking, effectively avoiding the pollution risk caused by repeated opening of the cover;

[0030] (3) Rapid and convenient detection without complex pretreatment: the whole detection process only needs 40-50 min. Field samples only need crude DNA solution without DNA purification step, and can be directly detected to realize the rapid process of "sample in-result out";

[0031] (4) Visual presentation of results, reducing device dependence: the detection results (such as mutation state of Chilo suppressalis ace-1 gene A314S site) are directly visualized by fluorescence color reaction, without the need of complex devices such as centrifuge, electrophoresis instrument and fluorescence quantitative PCR instrument;

[0032] (5) Low judgment threshold: after simple training, farmers or grass-roots technicians can directly judge the fluorescence color results by naked eye, which greatly reduces the technical threshold. BRIEF DESCRIPTION OF DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings used in the embodiments will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0034] Figure 1 RPA primer and crRNA position schematic diagram;

[0035] Figure 2 RPA primer screening result diagram;

[0036] Figure 3 RPA reaction time screening result diagram;

[0037] Figure 4 crRNA, ssDNA reporter molecule and RPA reaction primer screening result diagram, wherein A, B and C use ssDNA1, D, E and F use ssDNA2;

[0038] Figure 5 RPA-CRISIPR-Cas12a reaction system optimization result diagram, wherein A is the Cas12a / tcrRNA1 ratio optimization result; B is the Cas12a concentration optimization result; C is the SS DNA2 concentration optimization result;

[0039] Figure 6 One-pot RPA-CRISIPR-Cas12a detection schematic diagram;

[0040] Figure 7 RPA-CRISPR detection result diagram of Chilo suppressalis ace-1 gene A314S target site based on one-pot field sample;

[0041] Figure 8 Crude DNA extraction solution detection result diagram. DETAILED DESCRIPTION

[0042] The present application provides a Chilo suppressalis organophosphorus pesticide resistance detection reagent, characterized in that it comprises RPA amplification reaction reagent and CRISPR / Cas12a reaction reagent.

[0043] The RPA amplification reaction reagent comprises an RPA2 primer pair, and the RPA2 primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO: 4.

[0044] The CRISPR / Cas12a reaction reagent comprises a crRNA, a ssDNA reporter molecule and a Cas12a protease; the nucleotide sequence of the crRNA is shown in SEQ ID NO: 8.

[0045] In the present application, the ace-1 gene A314S site is a representative mutation that has been proved to cause the acetylcholinesterase to be insensitive to organophosphorus insecticides, indicating that the Chilo suppressalis population has high resistance to organophosphorus insecticides. The present application can accurately distinguish between wild-type and mutant genes by designing specific RPA primer pairs and crRNA for the Chilo suppressalis acetylcholinesterase ace-1 gene A314S resistance mutation site, and avoiding the false positive problem caused by primer mismatch or non-specific amplification in traditional PCR. The RPA primer pairs and crRNA in the present application are designed and synthesized according to the DNA sequence containing the A314S mutation site in the wild-type and mutant genes, and the DNA containing the A314S mutation site is obtained by amplifying the genomic DNA of the wild-type and mutant genes as templates, respectively, using primers CsAce755F (5'-CCCTGATGTACCTGGGAAT G-3') and primers CsAce755R (5'-CAGCATACCGATGAGCGAA-3'). The RPA primer pairs in the present application can enrich the target DNA to a detectable level, and the results of the examples in the present application show that the RPA primer pairs can specifically amplify the DNA containing the A314S mutation site in the sensitive (wild-type) genotype genomic DNA and the mutant genotype genomic DNA, and enrich the target DNA. The crRNA can specifically recognize as low as a single copy of the mutant gene, and the combination of the RPA primer pairs and the crRNA can effectively detect the resistant samples. In the examples of the present application, different RPA primer pairs (RPA1, RPA2 and RPA3) are combined with different crRNAs (crRNA1, crRNA2, tcrRNA1, tcrRNA1-2 and tcrRNA2) to detect Chilo suppressalis samples, and the results show that only when the RPA2 primer pair (RPA2) is combined with the crRNA (tcrRNA1), can the wild-type and mutant genes be effectively distinguished, while other combinations have false positive problems and cannot distinguish between wild-type and mutant genes.

[0046] In the present application, the nucleotide sequence of the ssDNA reporter molecule is preferably 5'-F-TTTTT-Q-3'; F represents a fluorescent group, and Q represents a fluorescence quenching group. The fluorescent group preferably includes at least one of FAM, TET, VIC and HEX; and the fluorescence quenching group preferably includes TAMRA and / or BHQ. The present application can realize the visualization of the detection result by introducing the ssDNA reporter molecule. In the embodiment of the present application, the 5' end of the ssDNA reporter molecule is modified with FAM, and the 3' end is modified with BHQ. When the ssDNA reporter molecule is cut, the fluorescent group and the quenching group are separated, and green fluorescence visible to the naked eye is released. In order to obtain the best visualization effect, the present application compares the effects of two ssDNA reporter molecules (ssDNA1 and ssDNA2) on the detection result, and the results show that the combination of the ssDNA reporter molecule (ssDNA2), the RPA2 primer pair (RPA2) and the crRNA (tcrRNA1) can effectively distinguish the wild type from the mutant gene, and has the best visualization effect.

[0047] In the present application, the detection reagent can detect the organic phosphorus pesticide resistance of Chilo suppressalis and genotype the ace-1 gene A314S resistance mutation site. When the sample contains the mutant type (has the organic phosphorus pesticide resistance) containing the A314S mutation site, after the Cas12a-crRNA complex recognizes the A314S mutation site in the sample to be tested, the transcleavage activity of Cas12a is triggered, the ssDNA reporter is indiscriminately cut, the fluorescent group and the quenching group modified on the ssDNA are separated, and the fluorescence visible to the naked eye is released; and when the sample to be tested is the wild type without mutation, Cas12a has no transcleavage activity, and the ssDNA reporter molecule cannot be cut to emit fluorescence.

[0048] In the present application, the detection reagent also preferably includes a sample genomic DNA extraction reagent. The present application does not make special limitation on the genomic DNA extraction reagent, and a conventional genomic DNA extraction reagent in the art can be used. In the embodiment of the present application, the genomic DNA is extracted by a genomic DNA extraction reagent (DNAiso Reagent) (Takara, Dalian, China), anhydrous ethanol and ddH2O.

[0049] Based on the fact that the detection reagent can detect the organic phosphorus pesticide resistance of Chilo suppressalis and genotype the ace-1 gene A314S resistance mutation site, the present application provides an application of the detection reagent in at least one of the following: detection of the organic phosphorus pesticide resistance of Chilo suppressalis and / or genotyping of the ace-1 gene A314S resistance mutation site of Chilo suppressalis for non-disease diagnosis and treatment.

[0050] The application provides a detection method for Chilo suppressalis organophosphorus insecticide resistance and / or Chilo suppressalis ace-1 gene A314S resistance mutation, comprising the following steps:

[0051] The genomic DNA of the Chilo suppressalis sample to be detected is used as a template, and RPA amplification reaction reagents in the detection reagent are used for amplification reaction to obtain RPA amplification products.

[0052] The RPA amplification products and CRISPR / Cas12a reaction reagents in the detection reagent are mixed and incubated to obtain reaction products.

[0053] Whether the Chilo suppressalis sample to be detected has organophosphorus insecticide resistance is judged according to the presence or absence of the fluorescence intensity signal of the reaction products; when the fluorescence intensity signal is detected, it indicates that the Chilo suppressalis sample to be detected has organophosphorus insecticide resistance and / or Chilo suppressalis produces ace-1 gene A314S resistance mutation.

[0054] The genomic DNA of the sample to be detected is used as a template, and RPA amplification reaction reagents in the detection reagent are used for amplification reaction to obtain RPA amplification products.

[0055] In the application, the sample to be detected preferably comprises Chilo suppressalis. The extraction method of the genomic DNA preferably comprises a kit method, and the application does not make specific limitations on the extraction method of the genomic DNA, and a conventional extraction method of the genomic DNA in the art can be used. In the embodiments of the application, a genomic DNA extraction reagent (DNAiso Reagent) (Takara, Dalian, China) is used for extraction. The application does not make special limitations on the amplification system, and as an optional embodiment, the amplification reaction system can be: buffer 29.5 μL, 10 μM of each of the upstream primer and the downstream primer 2.4 μL, template 1 μL and 280 mM MgOAc 2.5 μL, and enzyme-free water is supplemented to 50 μL. The reaction procedure of the isothermal amplification is preferably 37°C for 4.5-5.5 min, and more preferably 5 min. The application does not make specific limitations on the source of the RPA amplification reagent, and a conventional RPA amplification kit in the art can be used. In the embodiments of the application, a TwistAmp Basic kit (TwistDx, Cambridge, UK) is used for amplification.

[0056] After obtaining the RPA amplification product, the RPA amplification product and the CRISPR / Cas12a reaction reagent in the detection reagent are mixed and incubated to obtain a reaction product. In the present application, the molar concentration ratio of the Cas12a protease to the crRNA is preferably 1:(1-8), more preferably 1:(2-6), and most preferably 1:4. The working concentration of the Cas12a protease is preferably 180-220 nM, more preferably 190-210 nM, and most preferably 200 nM; and the working concentration of the ssDNA reporter molecule is preferably 3-5 μM, and most preferably 4 μM. By optimizing the concentrations of crRNA, Cas12a protease and ssDNA reporter molecule in the RPA-CRISPR Cas12a reaction system in the embodiments of the present application, it is found that when the molar concentration ratio of the Cas12a protease to the crRNA is 1:2, the working concentration of the Cas12a protease is 200 nM, and the working concentration of the ssDNA reporter molecule is 4 μM, the green fluorescence is most obvious and the detection efficiency is the highest. The incubated system is not specially limited in the present application, and as an optional embodiment, the incubated system can be 10x reaction buffer 1 μL, 8 μM crRNA 1 μL, 1 μM Cas12a 2 μL, 40 μM ssDNA reporter molecule 1 μL and RPA amplification product 2 μL, and enzyme-free water is added to 10 μL. The incubation reaction procedure is preferably 37°C for 25-35 min, and more preferably 30 min.

[0057] After obtaining the reaction product, whether the test Chendua sample has resistance to organophosphorus insecticides is judged according to the presence or absence of the fluorescence intensity signal of the reaction product: when the fluorescence intensity signal is detected, it indicates that the test Chendua sample has resistance to organophosphorus insecticides.

[0058] In the present application, when the homozygous or heterozygous mutation of the acetylcholinesterase ace-1 gene A314S site is detected in the sample, the RPA primer pair performs RPA amplification on the target gene, and the obtained RPA amplification product reacts with the CRISPR / Cas12a reaction reagent. After the crRNA recognizes the A314S mutation site of the RPA amplification product, the Cas12a protease is activated, the Cas12a protease cuts the ssDNA reporter molecule labeled with a fluorescent group and a quencher group, thereby releasing the fluorescent group and producing fluorescence. In the present application, the ssDNA reporter molecule emits green fluorescence visible to the naked eye after being cut, and if green fluorescence is observed in the reaction product, it indicates that the Chendua sample has homozygous or heterozygous mutation of the acetylcholinesterase ace-1 gene A314S site, and the Chendua population has a certain level of resistance to organophosphorus insecticides.

[0059] The application embodiment is used for evaluating the detection efficiency of the detection method for the A314S mutation site of the Chilo suppressalis acetylcholinesterase ace-1 gene. The results show that the detection method can accurately determine the genotype of the field sample, and the detection results are consistent with the traditional sequencing results. The detection method only needs 40-50 minutes (10 minutes for DNA extraction + 5 minutes for RPA amplification + 30 minutes for CRISPR detection), which is much faster than the qPCR or sequencing method which needs several hours. The advantages of the detection method are further highlighted in agricultural applications. The method can support field screening, and the population resistance and drug application can be determined within a few tens of minutes, avoiding the cost waste and the increase of pest resistance caused by blind drug application; the reagent cost is only 1 / 5-1 / 10 of that of qPCR, which is suitable for large-scale resistance dynamic monitoring network construction. The method integrates rapid amplification, accurate recognition and portable detection, and is becoming a key tool for promoting precision agriculture and pesticide resistance management. In the future, if combined with innovative technologies such as smart phones or internet monitoring systems, it is expected to realize the technology popularization from the laboratory to the field.

[0060] In the application, in order to simplify the operation process and be more suitable for field real-time detection, the amplification reaction and the incubation can be integrated into a single tube reaction, and the one-pot method is used for detecting the organophosphorus pesticide resistance of Chilo suppressalis. The one-pot method for detecting the organophosphorus pesticide resistance of Chilo suppressalis preferably places the genomic DNA of Chilo suppressalis sample and the RPA amplification reaction reagent in the detection reagent at the bottom of the tube, places the CRISPR / Cas12a reaction reagent in the inner tube cover, mixes the obtained amplification product with the CRISPR / Cas12a reaction reagent in the inner tube cover after the amplification reaction, incubates, and obtains the reaction product. The steps are as follows:

[0061] (1) extraction of Chilo suppressalis sample genomic DNA;

[0062] (2) constructing a partition reaction system in a sealed tube: placing the mixture of genomic DNA extraction solution and RPA amplification reaction reagent in the detection reagent at the bottom of the tube, and placing the CRISPR / Cas12a reaction reagent in the inner tube cover;

[0063] (3) RPA isothermal amplification reaction, obtaining RPA reaction amplification product; mixing the RPA reaction amplification product with the CRISPR / Cas12a reaction reagent by manually shaking the sealed tube, incubating, and obtaining the reaction product;

[0064] (4) after a period of reaction, irradiating the reaction product with 365 nm ultraviolet light, judging whether Chilo suppressalis produces ace-1 gene A314S resistance mutation according to whether the fluorescence under the ultraviolet light lamp is visible to the naked eye, so as to judge the resistance of Chilo suppressalis to organophosphorus pesticides.

[0065] In the present application, in order to facilitate on-site detection in the field, the extraction of the genome DNA of the Chilo suppressalis sample can adopt a crude extraction method. In the embodiments of the present application, TIANcombi DNA Lyse&Det PCR Kit (Tiangen, Beijing, China) is used to perform crude extraction on the genomic DNA. After crude extraction, the genomic DNA is preferably diluted, and more preferably diluted by 10 times. When detecting the organophosphorus pesticide resistance of Chilo suppressalis based on a one-pot method, in a 200 μL centrifuge tube, the bottom contains the following components in the RPA reaction system: 13.6 μL of primer free rehydration buffer, 1.2 μL of each of the forward and reverse RPA2 primers, 2 μL of DNA template, and 1 microsphere; the top (tube cover) system contains 1 μL of 20 μM crRNA, 1 μL of 100 μM ssDNA reporter molecule, 2.5 μL of 10x reaction buffer, and 2.5 μL of 2 μM Cas12a.

[0066] In order to evaluate the detection efficiency of the method for the A314S mutation site of the acetylcholinesterase ace-1 gene of Chilo suppressalis in field detection, the embodiments of the present application detect Chilo suppressalis in the field, and the results show that the method can accurately determine the genotype of the field sample, and the detection results are consistent with the traditional sequencing results. The whole process is carried out under constant temperature conditions at 37°C, only a simple normal temperature preservation device is needed, and the reaction can be completed by manual shaking and shaking, which effectively avoids the pollution risk caused by repeated opening of the cover. The detection result is directly presented by fluorescence colorimetry, without relying on complex equipment such as high-speed centrifuge, electrophoresis instrument or fluorescence quantitative PCR instrument. After collecting the sample in the field, DNA purification is not needed, and only crude DNA extraction can be directly used for detection, which truly realizes the rapid detection process of "sample in, result out", and can timely guide farmers to adjust the pesticide application strategy. After simple training, farmers or grass-roots technical personnel can directly read the results by naked eye, which greatly reduces the technical application threshold. The method has excellent genotype discrimination ability in field sample detection, and its rapid and sensitive characteristics fully meet the on-site detection needs of the target resistance related molecular markers of organophosphorus insecticides, and has good accuracy and reliability in pest resistance monitoring practice.

[0067] In the present application, the specific primers in traditional sequencing are CsAce755F (5'-CCCTGATGTACCTGGGAATG-3', SEQ ID NO:22) and CsAce755R (5'-CAGCATACCGATGAGCGAA-3', SEQ ID NO:23).

[0068] In order to further illustrate the present application, the solutions provided by the present application are described in detail below in conjunction with the accompanying drawings and examples, but they should not be understood as limiting the scope of protection of the present application.

[0069] The Chilo suppressalis larvae used in the following examples were collected from rice fields in Nanchang City, Jiangxi Province, China. The collected larvae were fed on fresh rice stems, and the feeding conditions were maintained at a temperature of 27±1°C, a light cycle of 16h light and 8h darkness, and a relative humidity of 70±10%.

[0070] Example 1

[0071] Cloning of A314S mutation site sequence of Chilo suppressalis acetylcholinesterase ace-1 gene

[0072] This example is directed to the cloning of A314S mutation site sequence of Chilo suppressalis acetylcholinesterase ace-1 gene. Genomic DNA of 20 randomly selected Chilo suppressalis field resistance samples and 3 Chilo suppressalis laboratory susceptible samples were extracted using DNAiso Reagent (Takara, Dalian, China), and homozygous mutation and homozygous wild DNA templates of A314S site were obtained from the samples. A specific RPA primer pair was designed according to the A314S RR genomic DNA template.

[0073] 1. Extraction of genomic DNA

[0074] (1) Place the larval sample individual into a 2mL centrifuge tube, and add 1mL of DNAiso Reagent. Grind using a grinder for 3min until grinding is sufficient;

[0075] (2) Centrifuge the tissue lysate obtained in (1) at 10,000g at 4°C for 10min. Transfer the supernatant to a new centrifuge tube. Most of the tissue debris, RNA and polysaccharide components in the lysate can be removed;

[0076] (3) Add anhydrous ethanol in an amount of 1 / 2 volume of the lysate. Mix well by repeatedly inverting for 3min, and a cloud-like DNA precipitate will appear. Use a gun tip to wrap the DNA and transfer it to a new centrifuge tube, or gently pour out the supernatant, and leave the DNA precipitate at the bottom of the centrifuge tube;

[0077] (4) Slowly add 1mL of 75% ethanol along the wall of the centrifuge tube, gently invert the centrifuge tube, and centrifuge at 12,000g at 4°C for 5min. Carefully discard the ethanol. Repeat this step twice;

[0078] (5) The genomic DNA after removing ethanol was precipitated and dried at room temperature for 15 seconds, and an appropriate amount of TE Buffer (pH 8.0) or sterilized water was slowly added to dissolve the genomic DNA.

[0079] 2. Cloning of the target gene containing the A314S site

[0080] The genomic sequence containing the target gene of the A314S site was cloned, and the exon and intron sequences of the target gene were determined.

[0081] (1) The extracted genomic DNA was used as a template, and specific primers CsAce755F and CsAce755R in Table 1 were used for PCR amplification.

[0082] The amplification system was: 12.5 μL PrimeStar High Fidelity Enzyme (Takara, Dalian, China), 1 μL CsAce755F, 1 μL CsAce755R and 2 μL genomic DNA template, and the total system was made up to 25 μL with nuclease-free water.

[0083] Table 1 contains DNA amplification primer pairs of A314S mutation site

[0084]

[0085] The amplification program was: 94°C pre-denaturation for 3 min; followed by 34 cycles of 94°C, 15 s, 60°C, 30 s and 72°C, 1 min; finally 72°C extension for 5 min; 12°C storage.

[0086] After amplification, the PCR product was sent to Genscript Company (Nanjing, China) for further sequencing. After sequence alignment, samples containing homozygous mutant genotypes and homozygous sensitive genotypes were selected for subsequent experiments.

[0087] Example 2

[0088] Recombinant polymerase amplification (RPA) reaction

[0089] 1. Design of RPA primers

[0090] This example is based on the A314S mutation site of the acetylcholinesterase ace-1 gene of the white-backed planthopper, and the primer pair required for A314S-RPA reaction is designed using Prime rPremier 5 software. The sequences of the RPA primer pair are shown in Table 2; the positions of the RPA primer pair are shown in Table 2. Figure 1

[0091] Table 2 Specific RPA amplification primer pairs designed for A314S mutation site ​

[0092]

[0093] Note: Because of the lack of suitable PAM sequences near the mutation sites of crRNA2 and tcrRNA2, an artificial PAM site (5'-TTTG-3') with mismatched bases was introduced in the RPA3-F, RPA3-R primer pair. Specifically, the 3rd sixth base of the original sequence of the forward primer RPA3-F was changed from G to T, so that the end of "GTTGTT" became "TTTGTT" (the underlined base is the modified base), so that the RPA product produced a "TTTG" sequence. The forward and reverse primers in the RPA1 primer pair and the RPA2 primer pair were not modified.

[0094] 2. Establishment of RPA reaction system and detection of primer amplification efficiency

[0095] The RPA reaction used TwistAmp Basic kit (TwistDx, Cambridge, UK) according to the manufacturer's instructions.

[0096] First, prepare the rehydration solution of the RPA reaction system, including 29.5 μL of buffer, 10 μM of forward primer and reverse primer each 2.4 μL, 12.2 μL of ddH2O and 1 μL of genomic DNA. After transferring 47.5 μL of rehydration solution to the reaction microspheres, blow and mix the microspheres until they are resuspended. Then add 2.5 μL of 280 mM MgOAc, mix thoroughly to a total volume of 50 μL.

[0097] Then the RPA reaction mixture was incubated in a 37℃ water bath. The mixture was incubated for 5 min, 10 min, 15 min or 20 min. The reaction product was recovered using AxyPrep PCR Cleanup Kit (Axygen, Suzhou, China) and electrophoresis analysis was performed on a 1.5% agarose gel.

[0098] To evaluate the amplification efficiency of the three primer pairs (RPA1-RPA3) in Table 2, RPA reaction systems were prepared using ddH2O, homozygous sensitive genotype genomic DNA and homozygous mutant genotype genomic DNA as templates, respectively, and RPA1-RPA3 as primers. Each RPA reaction system contained a pair of RPA primers, and the RPA reaction system was incubated at 37℃ water bath for 20 min.

[0099] The results are shown in Figure 2 The results show that the RPA products of RPA1-RPA3 can be detected efficiently, and the target bands exist in both sensitive and resistant mutant genotype templates, indicating that RPA1-RPA3 has high amplification efficiency and can be used for subsequent experiments.

[0100] 3. Optimization of RPA reaction time

[0101] To further optimize the RPA reaction time, the RPA reaction system was prepared with ddH2O and pure homozygous genotype genomic DNA as the template of negative reaction, and RPA2 primer as primer, and then the RPA reaction system was incubated at 37℃ water bath for 5 min, 10 min, 15 min and 20 min, respectively.

[0102] The results are shown in Figure 3 As shown in the negative reaction, only at 5 min, the corresponding negative result without amplification product was observed. On the contrary, unexpected bands appeared when the amplification time was more than 10 min. Therefore, the optimal reaction time of RPA reaction was 5 min.

[0103] Example 3

[0104] Design, synthesis and purification of crRNA

[0105] Based on the A314S mutation site of Chilo irridans acetylcholinesterase ace-1 gene, the crRNA required for CRISPR / cas12a reaction was designed using Primer Premier 5 software.

[0106] The PAM site of CRISPR / Cas12a system is 5'-TTTN-3'. Based on the crRNA, two crRNAs covering the A314S mutation site (crRNA1 and crRNA2 in Table 3) were designed, with a length of 20 or 21 nt. These crRNAs are located behind the PAM near the artificially introduced or sequence mutation site. In order to improve the specificity of crRNA mutation detection, by introducing mismatched bases near the mutation site, mismatched bases were designed in the non-mutation site of crRNA (tcrRNA1, tcrRNA1-2 and tcrRNA2 in Table 3). The crRNA sequences are shown in Table 3 below, and the crRNA positions are shown in Figure 1 .

[0107] Table 3 crRNA designed for A314S mutation site

[0108]

[0109] Note: The PAM site adjacent to the crRNA sequence was artificially designed as shown in the table, and a mismatch base was introduced near the mutant base, so that the original sequence "GUGAGUCAUCGGGAGCGGUU" (SEQ ID NO: 12) became the primer sequence "GUGAGUAAUCGGGAGCGGUU" (SEQ ID NO: 13) or "GUGAGCCAUCGGGAGCGGUU" (SEQ ID NO: 14); the original sequence "GGUGAGUCAUCGGGAGCG" (SEQ ID NO: 15) became the primer sequence "GGUGAGUAAUCGGGAGCG" (SEQ ID NO: 16), wherein the italicized part "U" is the mutant base to be detected, and the double underlined part is the mismatch base.

[0110] Several DNA oligonucleotides containing T7 promoter, guide sequence and conserved stem loop sequence were designed according to the crRNA sequence, as well as DNA oligonucleotides containing T7 promoter sequence (T7-top), as shown in Table 4 below. The designed oligonucleotides were synthesized by Genscript (Nanjing, China). Subsequently, the synthesized oligonucleotides were annealed with T7-top using DNA oligonucleotide annealing buffer (Beyotime, Beijing, China) to obtain partially double-stranded DNA templates. The HiScribe TM In vitro transcription of crRNA was performed using T7 Quick HighYield RNA Synthesis Kit (New England Biolabs) according to the manufacturer's instructions. The transcribed crRNA was purified using Monarch RNA Cleanup Kit (NEB).

[0111] Cas12a protease [EnGen Lba Cas12a (Cpf1), M0653] was purchased from NEB.

[0112] Table 4 T7 promoter sequences designed for crRNA sequences

[0113]

[0114] Example 4

[0115] Construction of RPA-CRISPR detection system for Chilo irridans ace-1 gene A314S mutant site

[0116] 1. Establishment of RPA-CRISPR reaction system

[0117] The RPA-CRISPR detection system described in this embodiment consists of three parts, including sample genomic DNA rapid extraction, recombinase polymerase amplification (RPA) reaction, and CRISPR / Cas12a reaction.

[0118] The sample genomic DNA rapid extraction and the recombinase polymerase amplification (RPA) reaction are shown in the methods of Embodiment 1 and Embodiment 2. In the RPA reaction, the primers are RPA1-RPA3, and the RPA reaction time is 5 min.

[0119] In the CRISPR / Cas12a reaction, the crRNA based on the A314S mutation site is crRNA1, crRNA2, tcrRNA1, tcrRNA1-2, and tcrRNA2 in Embodiment 3.

[0120] The following CRISPR / Cas12a reaction system was assembled at room temperature: 3 μL ddH2O, 1 μL 10× reaction buffer, 1 μL crRNA (4 μM), 2 μL Cas12a (1 μM), 1 μL ssDNA reporter (10 μM), 2 μL RPA amplification product, and the final reaction volume was 10 μL.

[0121] The CRISPR / Cas12a reaction was performed at 37°C for 30 min, and the bright green fluorescent signal was observed under the 365 nm ultraviolet lamp by naked eye, indicating that the sample contained A314S mutation and was a positive sample.

[0122] 2. Optimization of CRISPR / Cas12a reaction system

[0123] To obtain the best visualization effect, the detection system described in this embodiment was optimized in terms of crRNA, ssDNA reporter, and RPA reaction primer screening, CAS12a / crRNA ratio, Cas12a concentration, ssDNA reporter concentration, etc. The specific experimental results are shown in Table 1. Figure 4

[0124] (1) Screening of crRNA, ssDNA reporter, and RPA reaction primer

[0125] ​The DEPC water, sensitive sample (SS) without A314S mutation site and resistant sample (RR) with A314S mutation site were used as materials, the ssDNA reporter molecules were ssDNA1 (5'-F-GATCAA AAA AAA AAGAGC-Q-3', SEQ ID NO: 24) and ssDNA2 (5'-F-TTTTT-Q-3'), the 5' end of the ssDNA reporter molecule was modified with a fluorescent group FAM, and the 3' end of the ssDNA reporter molecule was modified with a fluorescent quenching group BHQ, the RPA reaction primer pairs were RPA1-F and RPA1-R, RPA2-F and RPA2-R, and RPA3-F and RPA3-R (sequences are shown in Table 2), and the crRNA was crRNA1, crRNA2, tcrRNA1, tcrRNA1-2 and tcrRNA2 (sequences are shown in Table 3).

[0126] The RPA reaction was carried out according to the RPA reaction system and the optimized procedure in Example 2, and each reaction system contained a pair of RPA reaction primers. After obtaining the RPA amplification product, the CRISPR / Cas12a reaction was carried out according to the above-mentioned CRISPR / Cas12a reaction system and procedure, and each reaction system contained one crRNA and one ssDNA reporter molecule. The reaction product was irradiated with a 365 nm ultraviolet lamp and subjected to fluorescent visualization analysis.

[0127] The experimental results are shown in Table 2 (CK1: blank control 1 with DEPC water as template, CK2: blank control 2 with water as template for RPA product; SS: addition of sensitive sample without A314S mutation site; RR: addition of resistant sample containing A314S mutation site). Figure 4 The results show that the fluorescent visualization effect of the reaction system combination of selecting ssDNA reporter molecule as ssDNA2, RPA reaction primer pair as RPA2 primer pair and crRNA as tcrRNA1 is best (Example E), and the effect is stable after multiple detection verifications, that is, the combination is most suitable for detecting the presence of ace-1 gene homozygous or heterozygous A314S mutation site in the sample of the diamondback moth. Figure 4 The RPA1 primer pair also has a fluorescent reaction with a negative template during multiple detection processes, causing false positive problems. ssDNA1 is prone to false positive problems, which may be due to the temporary separation of the fluorescent group and the quenching group caused by the folding or collision of ssDNA1 molecules, resulting in a decrease in quenching efficiency and background fluorescence.

[0128] (2) Optimization of Cas12a and crRNA reaction concentration ratio

[0129] Under the above preferred combination of SS DNA2, RPA2 primer pair and tcrRNA1 reaction system, according to the initial concentration of Cas12a of 200 nM, the following five groups of concentration ratios were set: Cas12a:crRNA = 1:1 (200 nM:200 nM), Cas12a:crRNA = 1:2 (200 nM:400 nM), Cas12a:crRNA = 1:4 (200 nM:800 nM) and Cas12a:crRNA = 1:6 (200 nM:1200 nM), Cas12a:crRNA = 1:8 (200 nM:1600 nM). The experimental results are shown in (A) of Figure 5 .

[0130] From the results of optimizing the Cas12 / crRNA reaction concentration ratio in (A), it is found that the fluorescence visualization effect is best when the ratio of Cas12a:crRNA = 1:4 (200 nM:800 nM) is selected. That is, the results of detecting the presence of ace-1 gene homozygous or heterozygous A314S mutation sites in the sample of Chilo suppressalis are most suitable under this ratio. Figure 5

[0131] Further optimization of the concentration of Cas12a, according to the optimal ratio of Cas12a to crRNA, sets the concentration of Cas12a to be 50 nM, 100 nM, 150 nM, 200 nM and 250 nM, a total of 5 concentration gradients. The experimental results are shown in (B) of Figure 5 .

[0132] From the results of optimizing the concentration of Cas12a in (B), it is found that when the concentration of Cas12a is 200 nM under the optimal ratio of Cas12a to crRNA, the concentration is moderate, the cost is low and the visualization effect is good, that is, the results of detecting the presence of ace-1 gene homozygous or heterozygous A314S mutation sites in the sample of Chilo suppressalis are most suitable under this concentration. Figure 5

[0133] (4) Optimization of ssDNA reporter molecule concentration

[0134] Under the above preferred combination of SS DNA2, RPA2 primer pair and tcrRNA1 reaction system and Cas12 / crRNA reaction concentration and ratio, according to the initial concentration of SS DNA2 of 22 μM, 1 μM, 2 μM, 4 μM, 6 μM and 8 μM are set, a total of 5 concentration gradients. The experimental results are shown in (C) of Figure 5 .

[0135] From the results of optimizing the concentration of SS DNA2 in (C), it is found that when the concentration of SS DNA2 is 4 μM, the concentration is moderate, the cost is low and the visualization effect is good, that is, the results of detecting the presence of ace-1 gene homozygous or heterozygous A314S mutation sites in the sample of Chilo suppressalis are most suitable under this concentration. Figure 5 ​​The concentration of the ssDNA reporter molecule SSDNA2 was optimized in the presence of the medium (C). The results showed that the concentration of 4 nM was selected as the optimal concentration, which was moderate and had good visualization effect. That is, the results of detecting the presence of the ace-1 gene homozygous or heterozygous A314S mutation site in the Chilo suppressalis sample were the most appropriate at this concentration.

[0136] In summary, the system of the optimized RPA reaction was the same as that of Example 2, the primer pair of the RPA reaction was RPA2, and the program of the RPA reaction was 37°C for 5 min.

[0137] The concentration ratio of Cas12a protease to crRNA in the CRISPR / Cas12a reaction system was 1:4, the concentration of Cas12a protease was 200 nM, crRNA was tcrRNA1 (SEQ ID NO: 8), and the ssDNA reporter molecule was SSDNA2 with a concentration of 4 μM.

[0138] The CRISPR / Cas12a reaction program was 37°C for 30 min.

[0139] Example 5

[0140] Construction of one-pot Chilo suppressalis ace-1 gene A314S mutation site RPA-CRISPR detection system

[0141] Based on the combination of RPA amplification reaction and CRISPR / Cas12a, this example provides a one-pot RPA-CRISPR detection method for Chilo suppressalis ace-1 gene A314S mutation site, to realize the rapid detection of Chilo suppressalis resistant population to organophosphorus insecticides. The developed detection method shows excellent sensitivity, stability and convenience through specific recognition of RPA product and Cas12a-crRNA complex. The detection method can complete the entire detection process in 40-50 min at 37°C.

[0142] The flowchart of the one-pot detection of Chilo suppressalis ace-1 gene A314S mutation site in this example is shown in Figure 6 , and the operation steps are as follows.

[0143] (1) Chilo suppressalis larvae were collected in the field, and crude DNA solution was extracted using TIANcombi DNA Lyse & Det PCR Kit (Tiangen, Beijing, China). After boiling water bath reaction for 10 min, the supernatant was transferred to a 1.5 mL centrifuge tube and directly used as a crude DNA template for subsequent one-pot detection;

[0144] (2) Using the optimized primers, crRNA, ssDNA reporter molecule, Cas12a and crRNA reaction concentration ratio reaction system in Example 4, the RPA reaction reagent is added to the bottom of the reaction tube, and the CRISPR / Cas12a reaction reagent is added to the wall of the tube, as follows.

[0145] One-pot reaction system: the RPA reaction system at the bottom of the reaction tube contains 18 μL, including 2 μL of DNA template; the CRISPR / Cas12a reaction system is added to the cap, which is 1 μL of 20 μM crRNA, 1 μL of 100 μM ssDNA reporter molecule, 2.5 μL of 10x reaction buffer, and 2.5 μL of 2 μM Cas12a protease;

[0146] (3) Take 3 EP tubes, tube 1 with water as a template for blank control; tube 2 with sensitive sample as negative control; tube 3 with resistant sample as template. 37°C RPA reaction for 5 min to obtain the amplification product of the target sequence;

[0147] (4) After the RPA amplification reaction is completed, the CRISPR / Cas12a reaction reagent is transferred to the bottom of the tube by manual shaking, mixed with the RPA reaction product, and reacted at 37°C for 30 min;

[0148] (5) Use 365 nm ultraviolet lamp irradiation, observe the reaction product of step (4), and the resistant sample template has bright green fluorescent signal under naked eye observation.

[0149] Example 6

[0150] One-pot field-based Chilo suppressalis sample ace-1 gene A314S mutation site RPA-CRISPR detection

[0151] In order to further evaluate the detection efficiency of the RPA-CRISPR-based detection system for the A314S mutation site in the ace-1 gene of Chilo suppressalis acetylcholinesterase, the field applicability and detection sensitivity of the rapid visual detection kit were verified. Using the one-pot detection system established in Example 5, the genomic DNA or cDNA of 20 Chilo suppressalis field samples collected was detected for the A314S mutation of the ace-1 gene of Chilo suppressalis using the A314S-RPA-CRISPR / Cas12a detection kit. The accuracy of the RPA-CRISPR / Cas12a detection result was confirmed by parallel testing and confirmation of the traditional sequencing result.

[0152] The experimental results are as follows Figure 7As shown: Tubes 1 and 2, the blank control (CK) and sensitive genotype (S), showed no fluorescence signal after irradiation under a 365nm UV lamp; tube 3, containing the A314S positive mutant genotype (R) of the rice stem borer ace-1 gene, emitted a bright green fluorescence signal after irradiation under a UV lamp, which could be clearly observed with the naked eye. Figure 7 (B) Figure 7 A in the figure represents the electrophoresis result.

[0153] Samples 6-20 all showed significant green fluorescence signals. Figure 7 (C). Combined with the chromatographic analysis results of the control nucleotide sequence, samples 6-13, 15-18, and 20 showed RR homozygous mutant genotypes (only the A314S mutant allele was detected), samples 14 and 19 were identified as RS heterozygous mutant genotypes (both wild-type and mutant alleles were detected), while samples 1-5 showed no fluorescence signal and were confirmed as SS wild-type genotypes (only the wild-type allele was retained). These experimental results effectively verify that the RPA-CRISPR / Cas12a molecular detection system constructed in this invention can directly achieve visualized genotyping detection of the A314S resistance mutation site in the acetylcholinesterase ace-1 gene of rice stem borer. This technical solution demonstrates excellent genotyping ability in field sample detection, and its rapid and sensitive characteristics fully meet the field detection requirements of molecular markers related to organophosphate insecticide target resistance, fully proving that this method has good accuracy and reliability in pest resistance monitoring practice.

[0154] Example 7

[0155] Optimization and Evaluation of DNA Crude Extract Detection

[0156] To simplify the single-tube RPA-CRISPR / Cas12a detection steps in Examples 5-6 above, this example evaluated the effectiveness of using crude DNA extract diluted with ddH2O at different ratios as an RPA template (dilution ratios: ×1, ×3, ×10), and applied the optimal crude DNA extraction protocol to perform single-tube detection on laboratory sensitive control samples and field-collected individuals of the rice stem borer.

[0157] Experimental results are as follows Figure 8 As shown in Figure A, a crude DNA template diluted ×10 produces a clear green fluorescent signal. Therefore, the optimal dilution of the crude DNA extract is ×10.

[0158] The single-tube detection was performed on 2 laboratory sensitive samples and 7 field collected samples of Chilo suppressalis using the crude DNA extraction protocol with 10-fold dilution. The results showed that no fluorescence signal was observed for the laboratory sensitive samples, while all the field samples produced clear fluorescence, and the detection results were consistent with the DNA sequencing results. The whole process of single-tube detection based on crude DNA extraction could be completed within 40-50 min, which fully confirmed the practical application potential of this method in the rapid and on-site monitoring of Chilo suppressalis resistance.

[0159] Although the above embodiments have made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and other embodiments can be obtained according to the present embodiments without creativity, which belong to the protection scope of the present application.

Claims

1. A detection reagent for the resistance of Chilo suppressalis to organophosphorus insecticides, characterized by comprising a polypeptide having a sequence represented by SEQ ID NO: 1 or a functional fragment thereof. The RPA amplification reaction reagent comprises an RPA2 primer pair, and the RPA2 primer pair comprises a forward primer with a nucleotide sequence as shown in SEQ ID NO: 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO:

4. The CRISPR / Cas12a reaction reagent comprises a crRNA, a ssDNA reporter molecule and a Cas12a protease; the nucleotide sequence of the crRNA is as shown in SEQ ID NO:

8. The nucleotide sequence of the ssDNA reporter molecule is 5'-F-TTTTT-Q-3'; 2. The detection reagent according to claim 1, characterized by The F represents a fluorescent group, and the Q represents a fluorescence quenching group. The fluorescent group comprises at least one of FAM, TET, VIC and HEX.

3. The detection reagent according to claim 2, characterized in that, The fluorescence quenching group comprises TAMRA and / or BHQ. The sample genomic DNA extraction reagent is further included.

4. The test reagent according to any one of claims 1 to 3, characterized by, 5. The use of the detection reagent according to any one of claims 1 to 4 in at least one of the following: detection of resistance of Dichocrocis punctiferalis to organophosphorus insecticides and / or genotyping of the A314S resistance mutation site of the Dichocrocis punctiferalis acetylcholinesterase ace-1 gene for non-disease diagnosis and treatment. The method comprises the following steps:

6. A method for detecting Chilo suppressalis organophosphorus insecticide resistance and / or Chilo suppressalis ace-1 gene A314S resistance mutation, characterized in that, The RPA amplification reaction reagent in the detection reagent is used to perform amplification reaction on the genomic DNA of the Dichocrocis punctiferalis sample to be tested to obtain an RPA amplification product; The RPA amplification product and the CRISPR / Cas12a reaction reagent in the detection reagent are mixed and incubated to obtain a reaction product; The presence or absence of a fluorescence intensity signal of the reaction product is determined to judge the resistance of the Dichocrocis punctiferalis sample to be tested to organophosphorus insecticides: when the fluorescence intensity signal is detected, it indicates that the Dichocrocis punctiferalis sample to be tested has resistance to organophosphorus insecticides and / or the Dichocrocis punctiferalis produces an A314S resistance mutation of the ace-1 gene. The temperature of the amplification reaction is 37 DEG C, and the time of the amplification reaction is 4.5-5.5 min.

7. The detection method according to claim 6, characterized in that, The temperature of the incubation is 37 DEG C, and the time of the incubation is 25-35 min.

8. The detection method according to claim 6, characterized in that, The molar concentration ratio of the Cas12a protease to the crRNA is 1:(1-8).

9. The detection method according to claim 6, characterized in that, The concentration of the Cas12a protease is 180-220 nM.

10. The method of claim 6, wherein, The working concentration of the ssDNA reporter molecule is 3-5 muM. ​

Citation Information

Cited By

  • Visual detection kit for realizing drug resistance of botrytis cinerea to methoxy acrylate fungicides based on RPA-CRISPR / Cas12a

    CN121380434A

  • A visual detection kit for realizing the resistance of botrytis cinerea to methoxy acrylate fungicides based on rpa-crispr / cas12a

    CN121380434B