An eqtl molecular marker related to hypoxia tolerance of elates aviceps and application thereof
By locating molecular markers at four SNP sites upstream of the pla2g1b gene in golden pomfret, and combining primer pairs and sequencing technology, the early screening challenge for hypoxia tolerance traits in golden pomfret was solved, improving breeding efficiency and aquaculture stability.
Patent Information
- Application Number
- CN202511446944.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-11
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2045-10-11
AI Technical Summary
Golden pomfret are susceptible to hypoxia stress in intensive aquaculture, leading to mass mortality. There is a lack of efficient and stable molecular markers for early screening, and traditional breeding methods are inefficient, making it difficult to achieve precision breeding and stable aquaculture.
By integrating whole-genome resequencing, transcriptome sequencing, and open chromatin omics analysis, four SNP sites (T→G, G→T, G→A, C→A) in the upstream -1711 ~ -1881 bp promoter region of the pla2g1b gene of golden pomfret were located. Specific primer pairs were designed for PCR amplification and Sanger sequencing, and haplotype detection was performed to assess the hypoxia tolerance of golden pomfret.
This study enabled efficient and accurate identification of the hypoxia tolerance trait in golden pomfret, improved breeding selection efficiency, shortened the breeding cycle of new varieties, and provided a reliable basis for molecular breeding.
Smart Images

Figure CN120905406B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The embodiment of the present application relates to the field of molecular breeding of aquatic animals, and particularly relates to an eQTL molecular marker related to the low oxygen tolerance trait of Pampus argenteus and application thereof. BACKGROUND
[0002] Pampus argenteus and Trachinotus blochii are widely distributed in the warm and tropical waters of the Indian Ocean, the Pacific Ocean and the Atlantic Ocean, and are one of the most economically valuable marine fish in the coastal areas of South China. Pampus argenteus and Trachinotus blochii have the characteristics of high oxygen consumption and low oxygen tolerance. In the process of intensive aquaculture, Pampus argenteus and Trachinotus blochii are easily threatened by low oxygen due to high temperature in summer, falling tide level, typhoon, water eutrophication, ammonia nitrogen and parasitic infection. Once acute hypoxia occurs, Pampus argenteus and Trachinotus blochii will die in a short time, causing serious economic losses. With the intensification of global warming trend, the impact of marine hypoxia on biodiversity and aquaculture industry will become increasingly serious. At present, the molecular basis of the low oxygen tolerance trait of Pampus argenteus and Trachinotus blochii is not clear, and there is a lack of efficient and stable molecular markers that can be used for early screening. Traditional breeding methods have the problems of long cycle, low efficiency and resource waste. Therefore, it is urgent to develop a molecular assisted screening method for the low oxygen tolerance trait, to clarify the key regulatory factors of Pampus argenteus and Trachinotus blochii to low oxygen stress and their expression regulation mechanism, so as to realize precise breeding, improve breeding efficiency and aquaculture stability, and help the sustainable development of Pampus argenteus and Trachinotus blochii aquaculture industry.
[0003] Expression quantitative trait locus (eQTL) refers to a genomic locus that can regulate the variation of gene expression level, which mediates the difference of phenotype by affecting the transcription abundance of mRNA. As an important bridge connecting genotype variation and gene expression level variation, eQTL provides a core tool for analyzing the genetic regulation mechanism of complex traits. Compared with traditional molecular markers, eQTL can not only locate the genetic variation associated with traits, but also directly reveal the regulation mechanism of variation on gene expression, so as to more accurately analyze the genetic basis of complex traits. With the wide application of high-throughput sequencing and multi-omics integrated analysis methods, eQTL analysis has become an important tool for understanding the genetic structure and regulation mechanism of complex traits. Its advantages are as follows: 1) high resolution, which can locate the regulation site in a specific tissue or developmental stage; 2) strong function orientation, which directly links SNP-gene expression-phenotype; 3) wide application range, which is suitable for growth, stress resistance, metabolism and other multi-trait research. At present, eQTL has made breakthroughs in human diseases, crop resistance, economic traits of livestock and poultry, etc. However, there is no report on eQTL related to the low oxygen tolerance trait of Pampus argenteus. SUMMARY
[0004] The embodiment of the present application provides an eQTL molecular marker related to the low oxygen tolerance trait of Pampus argenteus and application thereof, so as to provide effective basis and scientific method for the research on the selection breeding of the low oxygen tolerance trait of Pampus argenteus.
[0005] In a first aspect, the eQTL molecular marker related to the low-oxygen tolerance trait of golden pompano provided by the embodiments of the present application comprises:
[0006] Based on whole genome resequencing, transcriptome sequencing and chromatin open group analysis of golden pompano, the eQTL molecular marker is significantly related to the low-oxygen tolerance trait of golden pompano, and is used for assisted selection as a molecular marker of a low-oxygen tolerance strain.
[0007] The eQTL molecular marker is located on the upstream-1711 ~ -1881 bp promoter region of the gene on chromosome 20 of golden pompano, the genomic position of which is 16650700 ~ 16650870 bp on chromosome 20, and the corresponding nucleotide sequence is shown as SEQ ID NO. 1. pla2g1b
[0008] The eQTL comprises four SNP sites located at 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp on chromosome 20 of golden pompano.
[0009] The four SNP sites are mutated to T→G, G→T, G→A and C→A.
[0010] In a second aspect, the embodiments of the present application provide a primer pair for detecting the eQTL molecular marker of the first aspect, comprising:
[0011] Genomic DNA of golden pompano to be identified is extracted, and the obtained genomic DNA is used as a template to design a forward primer and a reverse primer based on the eQTL molecular marker fragment to amplify the target fragment by PCR, and Sanger sequencing is used to perform SNP typing on the amplified target fragment.
[0012] When the haplotype of the SNP molecular marker is haplotype 1, it represents a golden pompano strain with strong low-oxygen tolerance, and the bases are T / G / G / C.
[0013] When the haplotype of the SNP molecular marker is haplotype 2, it represents a golden pompano strain with poor low-oxygen tolerance, and the bases are G / T / A / A.
[0014] Forward primer 5'-3': CGAATTTCCGATGTGTCTTT;
[0015] Reverse primer 3'-5': CTGTCTTTATTTCCTCCCTAG.
[0016] Thirdly, embodiments of the present invention provide the application of an eQTL molecular marker as described in the first aspect related to the hypoxia tolerance trait of golden pomfret and a primer pair of the eQTL molecular marker as described in the second aspect in regulating the hypoxia tolerance trait of golden pomfret.
[0017] Optionally, the eQTL molecular marker is used in molecular breeding of the hypoxia tolerance trait in golden pomfret.
[0018] Optionally, the eQTL molecular marker can be used in the screening of hypoxia-tolerant strains and in improving the selection efficiency of hypoxia-adaptation-related genes.
[0019] Beneficial effects of the embodiments of the present invention:
[0020] This invention, through integrated whole-genome resequencing, transcriptome sequencing, and open chromatin omics analysis, obtained SNP molecular markers significantly associated with hypoxia tolerance in golden pomfret. These eQTL molecular markers were located in golden pomfret. pla2g1b The upstream promoter region (-1711 ~ -1881 bp) of the gene is located on chromosome 20 at 16650700 ~ 16650870 bp, corresponding to the sequence SEQ ID NO.1. This eQTL molecular marker contains four SNP sites, located on chromosome 20 at 16650770 bp, 16650804 bp, 16650828 bp, and 16650849 bp.
[0021] This eQTL molecular marker can serve as an auxiliary selection marker in molecular breeding of golden pomfret for hypoxia tolerance, effectively improving the screening efficiency of hypoxia-tolerant strains and accelerating the breeding process of new varieties. This invention also discloses a molecular-level identification method for the hypoxia tolerance trait of golden pomfret. By extracting genomic DNA from golden pomfret, designing specific primer pairs for PCR amplification of fragments containing the aforementioned marker sites, and performing SNP genotyping analysis using Sanger sequencing, efficient and accurate identification of the hypoxia tolerance ability of individual golden pomfret is achieved. Attached Figure Description
[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0023] Figure 1 A schematic diagram illustrating the survival rate of longfin and shortfin pomfret after 24 hours of acute hypoxic stress, as provided in an embodiment of the present invention.
[0024] Figure 2This invention provides an embodiment of a hypoxic stress method. pla2g1b A schematic diagram showing the expression levels of the gene in the liver of longfin and shortfin pomfret;
[0025] Figure 3 An embodiment of the present invention provides a method based on a population differentiation index (... F ST Selection pressure analysis using extended haplotype homozygosity test (XP-EHH) to identify key evolutionarily differentially expressed genes. pla2g1b A schematic diagram;
[0026] Figure 4 This is a schematic diagram of linkage disequilibrium analysis of the upstream promoter sequence of the pla2g1b gene provided in an embodiment of the present invention;
[0027] Figure 5 A schematic diagram of an ATAC sequencing peak upstream of the pla2g1b gene provided in an embodiment of the present invention;
[0028] Figure 6 This is a schematic diagram illustrating the distribution frequency of a pla2g1b promoter haplotype in hypoxia-tolerant and hypoxia-sensitive populations, as provided in an embodiment of the present invention.
[0029] Figure 7 This is a schematic diagram illustrating the functional verification of the pla2g1b gene eQTL molecular marker based on a dual-luciferase assay, as provided in an embodiment of the present invention. Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0031] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments were all purchased from commercial channels. The following embodiments define the present invention and describe how the present invention, through integrated multi-omics analysis, identified the key gene pla2g1b, which determines the hypoxia tolerance trait in golden pomfret. It was found that the haplotype SNP in its promoter region is highly associated with the hypoxia tolerance phenotype and can be used as a molecular marker for the breeding of hypoxia-tolerant golden pomfret strains. Based on the description and embodiments of the present invention, those skilled in the art can adjust the technical solutions to adapt to different breeding conditions and breeding needs without departing from the core of the present invention.
[0032] One of the purposes of the embodiment of the present application is to provide an eQTL molecular marker related to the low oxygen tolerance trait of golden pomfret, so as to provide an effective basis and scientific method for future selection and breeding of the low oxygen tolerance trait of golden pomfret.
[0033] The second purpose of the embodiment of the present application is to provide a primer pair of an eQTL molecular marker related to the low oxygen tolerance trait of golden pomfret.
[0034] The third purpose of the embodiment of the present application is to provide a screening method for identifying a molecular marker related to the low oxygen tolerance trait of golden pomfret.
[0035] The above first purpose of the embodiment of the present application can be realized by the following technical scheme: a haplotype SNP marker related to the low oxygen tolerance trait of golden pomfret, wherein the marker is located at the 51st, 85th, 109th and 130th bases of the nucleotide sequence shown in SEQ ID NO. 1.
[0036] Specifically, SEQ ID NO. 1 is pla2g1b The upstream-1711~ -1881 bp interval sequence of the gene, the genomic position of which is 16650700 ~ 16650870 bp of chromosome 20. The eQTL molecular marker comprises four SNP sites, which are mutation T→G at 16650770 bp of chromosome 20, mutation G→T at 16650804 bp of chromosome 20, mutation G→A at 16650828 bp of chromosome 20 and mutation C→A at 16650849 bp of chromosome 20.
[0037] The nucleotide sequence shown in SEQ ID NO. 1 is as follows:
[0038] GCTTAAAGGCTACACAGAAAAAGATCTTTAATGCAGCTTTTTCCTAATTAATTTCATAGTAAATTATGTTGTATACACTTAAAATGTTGTATTTACAATATACATTACTTGGCAAAGAAGTACAAAGGAACCTTTAAGCAAACGTGGCTAGGGAGGAAATAAAGACAGAGAAAGAT.
[0039] Among them, the mutation of the 51st base is T→G, the mutation of the 85th base is G→T, the mutation of the 109th base is G→A, and the mutation of the 130th base is C→A.
[0040] The double luciferase experiment and significance test prove that when the 51th, 85th, 109th and 130th bases in the sequence shown in SEQ ID NO. 1 are G, T, A and A, the haplotype formed by the sequence makes the pla2g1b gene have a higher transcription level under hypoxia, and makes the hypoxia tolerance of the golden pompano significantly enhanced.
[0041] The hypoxia tolerance of the golden pompano in the embodiment of the present application specifically refers to the survival time of the golden pompano under the dissolved oxygen of the water body below the suffocation point.
[0042] In order to study the genetic difference of the hypoxia response of the golden pompano, two groups with obvious morphological characteristics, i.e., long-fin golden pompano and short-fin golden pompano, are selected as candidate reference groups. The survival rate and molecular expression characteristics of the individuals of the two groups after acute hypoxia stress are collected. The experimental results show that the long-fin golden pompano has a higher survival rate under hypoxia stress, and is therefore used as a hypoxia tolerance reference strain, and the short-fin golden pompano is a hypoxia sensitive strain. Based on this, the two are used for subsequent comparative omics and molecular marker screening analysis.
[0043] The above second object of the embodiment of the present application can be achieved by the following technical solution: a primer pair for detecting the haplotype SNP molecular marker, for detecting the genotype of the eQTL molecular marker site.
[0044] According to the nucleotide sequence shown in SEQ ID NO. 1, the embodiment of the present application designs a specific primer pair for the eQTL molecular marker, and the nucleotide sequence of the primer pair is:
[0045] Forward primer 5'-3': CGAATTTCCGATGTGTCTTT;
[0046] Reverse primer 5'-3': CTGTCTTTATTTCCTCCCTAG.
[0047] The above third object of the embodiment of the present application can be achieved by the following technical solution: a mutation T→G at 16650770 bp of chromosome 20 of the golden pompano, a mutation G→T at 16650804 bp of chromosome 20, a mutation G→A at 16650828 bp of chromosome 20 and a mutation C→A at 16650849 bp of chromosome 20 are associated with the hypoxia tolerance of the golden pompano, and the specific steps include:
[0048] (1) Sample extraction and library sequencing: the hypoxia tolerance group and the hypoxia sensitive group of the golden pompano are distinguished through acute hypoxia stress experiment, total RNA of liver tissue is extracted for transcriptome sequencing and chromatin openness (ATAC) sequencing, and fin strip samples are taken to extract DNA samples for whole genome sequencing.
[0049] (2) Data processing and quality control: Illumina NovaSeq 6000 sequencing platform is used for RNA sample transcriptome sequencing and ATAC sequencing, and DNBSEQ-T7 sequencing platform of Huada Gene is used for DNA sample whole genome resequencing to obtain raw sequencing data.
[0050] (3) Expression difference and selection signal analysis: quality control, sequence alignment and gene expression quantitative analysis are performed on the transcriptome data to obtain the gene expression profile of each sample; quality control filtering, sequence alignment and variation detection are performed on the genome data to obtain the whole genome SNP marker information.
[0051] (4) Selection pressure analysis is performed on the genome data, and F ST and XP-EHH methods are used to screen the selected genomic regions, and regulatory sequence variations and candidate genes are identified through variation annotation and functional classification.
[0052] (5) Key regulatory site and candidate gene identification: differential expression genes under hypoxia and normoxia conditions are identified in each variety through transcriptome analysis; the results of selection pressure analysis and transcriptome analysis are integrated to identify key genes related to the low oxygen tolerance trait of golden pomfret. Further analysis of chromatin openness combined with ATAC-seq data verifies the spatial consistency of key sites and transcription factor binding sites, and clarifies the regulatory mechanism.
[0053] (6) Different haplotypes are constructed into a promoter-luciferase reporter vector and transfected into 293T cells, and the fluorescence intensity is compared to verify the difference in promoter activity.
[0054] Preferably, the acute hypoxic stress condition in step (1) is that the dissolved oxygen concentration is controlled at 1.5 ± 0.2 mg / L, the stress time lasts for 24 hours, and the water temperature is maintained at 28 ± 1℃.
[0055] Preferably, in step (4), VCFtools software is used to calculate the population genetic differentiation index (Fst) F ST ) with a window size of 2 kb and a step size of 1 kb.
[0056] Preferably, in step (5), MACS2 software is used for peak recognition analysis of ATAC-seq data, and the q-value threshold is set to 0.05.
[0057] The present application embodiment finds that the low oxygen tolerance of golden pomfret pla2g1bThe haplotype SNP site in the gene promoter region is closely related to the low oxygen tolerance of the golden pompano, and the low oxygen tolerance of the genetic population of the golden pompano can be efficiently identified by detecting the haplotype polymorphism site, and the application further discloses a screening method of an eQTL related to the low oxygen tolerance of the golden pompano, and the screened gene and SNP molecular marker can be applied to the selection breeding of the low oxygen tolerance of the golden pompano, and a new molecular target is provided for the selection breeding of the golden pompano.
[0058] The application further provides a detection method of the low oxygen tolerance of the golden pompano, which comprises the following steps:
[0059] (1) extracting genomic DNA of the golden pompano to be detected;
[0060] (2) performing PCR amplification on the genomic DNA of the golden pompano to be detected by using the primer pair, so as to obtain an amplification product;
[0061] (3) performing electrophoresis detection on the PCR amplification product, and purifying a target band by using a gel recovery kit;
[0062] (4) connecting the purified product to a pMD19-T vector, transforming DH5a competent cells, and picking single colonies for sequencing;
[0063] (5) directly performing Sanger sequencing on the amplification product, and directly obtaining sequence SNP information by using software.
[0064] Preferably, in step (1), the total DNA is extracted by cutting part of the fin bar of the golden pompano, and the quality of the DNA sample is ensured, that is, the ratio of A260 / A280 is between 1.8 and 2.0, and the DNA concentration is greater than 100 μg / μL.
[0065] Preferably, in step (2), the PCR amplification is performed, and the PCR system is shown in Table 1.
[0066] Table 1
[0067] Reaction components Volume Final concentration 5 x Prime STAR Buffer 5 μL 1 × Prime STAR HS DNA Pol 0.5 μL 1.25 U / 25 μL DNA template 1-5 μL 0-100 ng dNTP Mixture (2.5 mM) 2 μL 200 μM Upstream primer (10 μM) 0.5 μL 0.2 μM Downstream primer (10 μM) 0.5 μL 0.2 μM ddH2O up to 25 μL
[0068] The PCR amplification program is shown in Table 2.
[0069] Table 2
[0070] Preferably, when the 51st / 85th / 109th / 130th positions of SEQ ID NO. 1 are G / T / A / A, the low oxygen tolerance haplotype is determined as a low oxygen tolerance parent for the selection breeding of the Trachinotus ovatus.
[0071] In conclusion, the eQTL molecular marker and haplotype SNP combination significantly associated with the hypoxia tolerance trait of golden pompano are disclosed, which belong to the field of molecular breeding technology of aquatic animals, and the method for screening eQTL and identifying genotypes is also disclosed. The early accurate prediction of the hypoxia tolerance performance of golden pompano can be realized by detecting the haplotype polymorphism site, the breeding selection efficiency is significantly improved, and a new molecular breeding technical means is provided for breeding new varieties of golden pompano with hypoxia tolerance.
[0072] In order to better explain the technical solutions in the embodiments of the present application, the above technical solutions will be described in specific embodiments.
[0073] Example 1 - Establishment of hypoxia-tolerant and sensitive groups
[0074] (1) 300 tails of two main golden pompano varieties, long-finned golden pompano and short-finned golden pompano, were collected, and the samples were all from Hainan breeding groups with a weight of 50.0 ± 3 g. Under laboratory conditions, the water temperature was controlled at 27 ± 0.5°C, the salinity was 20-30‰, the ammonia nitrogen was less than 0.02 mg / L, the natural light was used, and the air pump was used for aeration to maintain saturated dissolved oxygen. The fish were fed twice a day, and the feeding of feed was stopped two days before the formal start of the experiment.
[0075] (2) The hypoxia stress experiment was carried out at 1.5 ± 0.2 mg / L, and the hypoxia stress environment was mainly completed by using a self-made dissolved oxygen adjusting device. The experiment was divided into two groups of long-finned golden pompano and short-finned golden pompano, and each group had three parallels, and 80 fish were randomly allocated in each parallel. 27°C saturated dissolved oxygen was used as the starting setting condition, and 5 tails were randomly selected from each group and each parallel repeat as the normoxic group. The self-made dissolved oxygen adjusting device was used to reduce the dissolved oxygen to 1.5 mg / L within 2 hours, which was recorded as the starting point of the experiment (0h), and 7 fish in good condition without floating head phenomenon were taken from each barrel, and the liver tissue was stored in liquid nitrogen for transcriptome pool sequencing (mixing 7 tail samples). After 24 hours, the same method was used for sampling. After 24 hours of hypoxia stress, the survival rates of the two golden pompano varieties were calculated, and the golden pompano group with higher survival rate was used as the hypoxia-tolerant group, and the golden pompano group with lower survival rate was used as the hypoxia-sensitive group.
[0076] Example 2 - Acquisition of multi-omics data
[0077] (1) RNA extraction, quality inspection and transcriptome sequencing
[0078] The liver tissues of the low-oxygen tolerant group and the low-oxygen sensitive group under normoxia, low oxygen for 0 h and low oxygen for 24 h were subjected to total RNA extraction by TRIzol method, and the genomic DNA pollution was removed by DNase I digestion. The RNA integrity (RIN≥8.0) was detected by Agilent 2100 Bioanalyzer, the purity (A260 / A280=1.9-2.1) and concentration (≥200 ng / μL) were determined by Nanodrop 2000. The qualified RNA samples were subjected to library construction, and 150 bp double-end sequencing was performed on the Illumina NovaSeq 6000 platform, and ≥20 million clean reads were obtained for each sample. The sequencing data was subjected to quality control and filtration, and the qualified data was aligned to the golden pompano reference genome, and the gene expression quantitative analysis was performed by HTSeq to obtain the population gene expression profile data.
[0079] (2) DNA extraction, quality control and whole genome sequencing:
[0080] The fin strip samples of 50 fish from each group were subjected to total DNA extraction by phenol-chloroform method, and the complete band (>20 kb) was detected by 1% agarose gel electrophoresis. The DNA purity (A260 / A280=1.8-2.0) and concentration (≥50 ng / μL) were determined by Nanodrop 2000. The qualified DNA samples were subjected to ultrasonic fragmentation to 350 bp fragments by Covaris S220, and the whole genome sequencing library was constructed. The double-end sequencing was performed on the Huada Gene DNBSEQ-T7 sequencing platform, and the sequencing depth of each sample was ≥20×. The sequencing data was subjected to quality control and filtration. The qualified data was aligned to the golden pompano genome reference genome sequence, and the SNPs in the population were obtained and further filtered. The SNP sites with minor allele frequency (MAF) <0.05, genotype missing rate >0.1 or Hardy-Weinberg index (HW) <0.0001 were deleted.
[0081] (3) ATAC-seq library construction and quality control: 50 mg of fresh liver tissue was quickly frozen in liquid nitrogen and then treated with Tn5 transposase for chromatin open fragmentation. The reaction system contained 25 μL TD Buffer and 2.5 μL Tn5 enzyme, and was incubated at 37°C for 30 minutes with shaking. DNA fragments were purified using AMPure XP magnetic beads, and the fragment distribution was detected by Agilent 2100 Bioanalyzer. The main peak was required to be located at 200-600 bp, there was no obvious primer dimer peak, and the library concentration was ≥2 nM. Qualified libraries were sequenced on the Illumina NovaSeq 6000 platform for 150 bp double-end sequencing, and ≥50 million reads were obtained for each sample. The experiment included 3 technical repeats. The raw data was subjected to FastQC quality control, and the Q30 was required to be ≥85%. Subsequent peak identification analysis, open region analysis and sequence motif prediction were performed.
[0082] Example 3 - Key gene screening and eQTL positioning:
[0083] (1) Identify hypoxia-responsive genes using transcriptome analysis:
[0084] The StringTie ver.1.3.4d software was used to calculate the TPM quantification of gene expression level, and the R package LIMMA was used for TPM normalization. The R package DESeq2 was used for differential expression gene analysis: 1) In the population (short-fin pompano vs. long-fin pompano), the differential genes under normoxia were detected, i.e. constitutive differential expression genes; 2) In the population, the differential genes of hypoxia 0h vs. normoxia and 24h vs. normoxia were identified, and the differential expression genes obtained by the above analysis were defined as dataset 1.
[0085] (2) Identify selected genes using genome analysis:
[0086] To identify the adaptive differentiation related genes of long-fin pompano and short-fin pompano, two methods were used to screen potential selected sites, 1) The PLINK v1.9 software was used to calculate the genetic differentiation index (Fst) of 2Kbp sliding window between populations; F ST 2) The cross-population extended haplotype homozygosity test (XP-EHH) value of short-fin pompano and long-fin pompano was calculated, and the negative value indicated that short-fin pompano was under positive selection, and the positive value indicated that short-fin pompano was under negative selection. The highest 5% threshold and the lowest 5% threshold were calculated. The genomic regions with F ST and XP-EHH values located in the highest 5% threshold and the lowest 5% threshold were identified as selected regions, and the genes and variation sites contained or related in the region were defined as dataset 2.
[0087] (3) Identify the regulatory elements of hypoxia-responsive genes using chromatin accessibility sequencing (ATAC-seq):
[0088] Chromatin accessibility sequencing (ATAC-seq) was performed on 3 shortfin pompanos on the Illumina HiSeq 4000 platform. The ATAC-Seq sequencing data was filtered and the effective sequences (clean reads) were aligned to the reference genome of the pompano using BWA v 0.7.17 software. Peak-calling was performed using Genrich v0.6 software, and sequencing peaks related to genes (within 5000bp upstream and downstream of the start and end coordinates of the longest transcript of each gene) were annotated using Bedtools software, and SNPs overlapping with them were identified. The motifs of the regulatory elements overlapping with the open regions were predicted by MEME software, and the possible transcription factor binding sites were determined by comparing with the known motifs in the database.
[0089] (4) Key genes and eQTL positioning:
[0090] The genes common to datasets 1 and 2 were identified as hypoxia-regulated candidate genes. GO enrichment and KEGG pathway analysis were used to annotate the functions and metabolic pathways of the candidate genes, with a focus on genes related to hypoxia response and metabolism. SNP annotation, linkage disequilibrium analysis, and promoter sequence analysis were performed on the selected regions of the key candidate genes, combined with ATAC-seq to identify regulatory sequence variations affecting hypoxia transcription, i.e. eQTL.
[0091] (5) Data analysis results:
[0092] The results of the acute hypoxia stress experiment showed that the hypoxia survival rate of longfin pompanos (67%) was significantly higher than that of shortfin pompanos (38%), as shown in Figure 1 .
[0093] Transcriptome analysis found that hypoxia stress led to a significant upregulation of the phospholipase encoding gene pla2g1b in shortfin pompanos, but the expression of this gene in longfin pompanos did not change significantly, as shown in Figure 2 .
[0094] Whole genome selection pressure analysis found that multiple phospholipase encoding genes were under selection, among which pla2g1b had strong selection signals, as shown in selection pressure analysis based on Figure 3 . F ST Identification of key evolutionary difference genes based on selection pressure analysis of XP-EHH pla2g1b . As can be seen from Figure 3 , pla2g1bThe genomic region where the gene is located is under strong positive selection in P. panoptes, with an XP-EHH value of -3.38 (the highest 5% threshold is 2.08, and the lowest 5% threshold is -1.21; the XP-EHH analysis takes P. longipinnis as the reference population, and a negative number indicates that P. panoptes is under positive selection, and a positive number indicates that P. panoptes is under negative selection), F ST The value is 0.47 (the highest 5% threshold is 0.44).
[0095] Figure 4 It is shown that pla2g1b The linkage disequilibrium analysis of the upstream promoter sequence of the gene. There are 35 closely linked SNPs in the range of -1959 ~ -7 bp upstream of the gene. Among them, the four core SNPs are Figure 4 The genetic correlation with the rest of the SNPs is extremely strong (r²> 0.97) from the 5th to the 8th from the left in the upper row, which can be used as the representative tag SNP of the block.
[0096] ATAC sequencing found that pla2g1b There is a peak in the range of -1741 bp ~ -1642 bp upstream (as shown in Figure 5 The above results show that pla2g1b participate in the hypoxia response of P. argenteus, and the mutation in the promoter region of the gene regulates gene transcription and is negatively correlated with the hypoxia tolerance of P. argenteus.
[0097] Sequence analysis shows that pla2g1b The promoter region within 2 kb upstream of the gene contains 35 closely linked SNPs, and the combination of these SNPs constitutes four major haplotypes, namely Hap 1, Hap 2, Hap 3, and Hap 4 (see Table 3). As shown in Figure 6 In the longfin P. argenteus (N = 40) that is tolerant to hypoxia, the frequencies of Hap 1, Hap 2, Hap 3, and Hap 4 are about 36.2%, 30.2%, 29.8%, and 3.8%, respectively; in the shortfin P. argenteus (N = 40) that is sensitive to hypoxia, the frequencies of the four haplotypes are about 92.5%, 0%, 5.0%, and 2.5%, respectively. Among them, Hap 1 is almost fixed (extremely high rate) in shortfin P. argenteus that is sensitive to hypoxia; Hap 2 is a medium frequency type in longfin P. argenteus, and is extremely low or not detected in shortfin P. argenteus; Hap 3 and Hap 4 are both low frequency types, mainly existing in longfin P. argenteus, and may be background linkage genetic variation.
[0098] Due to the high linkage rate between SNPs, the pla2g1bFour bases upstream of the gene -1811 / -1777 / -1753 / -1732 bp (genome position of chromosome 20 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp) can distinguish Hap 1 from Hap 2, 3, 4. When the four positions are T / G / G / C, it can be determined as Hap 1; when the bases are G / T / A / A, it belongs to one of the other three haplotypes.
[0099] Table 3
[0100] Serial number Position Haplotype 1 (Hap 1) Haplotype 2 (Hap 2) Haplotype 3 (Hap 3) Haplotype 4 (Hap 4) 1 16650622 G A A A 2 16650647 G C C C 3 16650683 G A A G 4 16650697 G C C G 5 16650711 G A A G 6 16650770 T G G G 7 16650804 G T T T 8 16650828 G A A A 9 16650849 C A A A 10 16650916 C T T T 11 16651053 T A A A 12 16651124 C T T T 13 16651138 A G G G 14 16651201 T A A A 15 16651214 A T A T 16 16651370 G T T T 17 16651392 A G G G 18 16651410 G T T T 19 16651457 A G G G 20 16651479 G A A A 21 16651605 A G G G 22 16651640 T C C C 23 16651942 T C C C 24 16651982 A G G G 25 16652017 A G G G 26 16652047 A T T T 27 16652083 C A A A 28 16652129 C T T T 29 16652165 T C C C 30 16652251 T G G G 31 16652395 T C C C 32 16652433 T C C C 33 16652476 A G G G 34 16652573 T C C C 35 16652574 G A A A
[0101] Molecular functional verification of eQTL in Example 4:
[0102] Synthesis pla2g1b Promoter Hap1 (T / G / G / C) and Hap2 (G / T / A / A) sequences were constructed into pGL3-basic vector, and the full-length coding sequence of hypoxia-inducible factor 1 alpha (HIF1a) was inserted into pcDNA3.1 (+) vector. All constructs were verified by Sanger sequencing. The transfection experiment was performed as follows: HEK293T cells were seeded in a 24-well plate at a confluence of 60-70%, and cultured in DMEM medium containing 10% fetal bovine serum (Gibco). Lipofectamine 2000 (Invitrogen) was used to transfect the plasmid mixture, which included: (i) 400 ng pGL3 series reporter vector: empty vector (pGL3-basic), positive control vector (pGL3-promoter), reporter vector (pGL3-1.2 kb), (ii) 40 ng internal standard vector (pRL-TK), and (iii) 400 ng pcDNA3.1-HIF1a overexpression plasmid or empty vector, maintaining a ratio of firefly / sea anemone luciferase plasmid of 10:1. After 4-6 hours of transfection, the complete medium was replaced and the cells were cultured for another 48 hours. The plasmid transfection combination is shown in Table 4. Luciferase activity was detected using a dual luciferase reporter gene detection system. The results showed that the Hap1 haplotype promoter had stronger transcriptional activity when co-transfected with HIF-1a, and the results are shown in pla2g1b Promoter haplotype 1 and pla2g1b Promoter haplotype 2), (ii) 40 ng internal standard vector (pRL-TK), and (iii) 400 ng pcDNA3.1-HIF1a overexpression plasmid or empty vector, maintaining a ratio of firefly / sea anemone luciferase plasmid of 10:1. After 4-6 hours of transfection, the complete medium was replaced and the cells were cultured for another 48 hours. The plasmid transfection combination is shown in Table 4. Luciferase activity was detected using a dual luciferase reporter gene detection system. The results showed that the Hap1 haplotype promoter had stronger transcriptional activity when co-transfected with HIF-1a, and the results are shown in Figure 7 Based on the above analysis results, the pla2g1b key gene of low oxygen regulation of P. plectorhynchus was identified, and the haplotype SNP in the promoter region of the gene was identified as the eQTL molecular marker of low oxygen regulation of P. plectorhynchus.
[0103] Table 4
[0104] Serial number Transfection plasmid combination 1 pcDNA3.1 empty + pGL3-basic + PRL-TK 2 HIF1a-pcDNA3.1 + pGL3-basic + PRL-TK 3 pcDNA3.1 empty + Hap1- pGL3-promoter + PRL-TK 4 HIF1a-pcDNA3.1 + Hap1- pGL3-promoter + PRL-TK 5 pcDNA3.1 empty + Hap2- pGL3-promoter + PRL-TK 6 HIF1a-pcDNA3.1 + Hap2- pGL3-promoter + PRL-TK
[0105] The beneficial effects of the embodiments of the present application are as follows:
[0106] The embodiments of the present application provide an eQTL molecular marker significantly related to the low oxygen tolerance trait of Pampus argenteus, by integrating whole genome resequencing, transcriptome sequencing and chromatin open group data, a specific mutation site combination (haplotype) located in the upstream regulatory region of the gene is screened and obtained, the molecular marker has significant correlation with the low oxygen tolerance capacity of Pampus argenteus individuals, and can be used for efficiently and accurately evaluating the low oxygen adaptability of Pampus argenteus individuals. pla2g1b The primer pair and the typing method provided by the embodiments of the present application can realize specific amplification and typing of the target marker region, are simple to operate, high in sensitivity, and suitable for large-scale screening in a breeding population. The technology can be used as an effective tool for molecular assisted selection of the low oxygen tolerance trait of Pampus argenteus, improves breeding efficiency, shortens the new strain breeding cycle, and provides a reliable molecular basis for breeding of new low oxygen tolerance varieties.
[0107] The present application is described with reference to flowcharts and / or block diagrams according to the methods, devices (systems), and computer program products of the embodiments of the present application. It should be understood that each flow and / or block in the flowcharts and / or block diagrams, and the combination of the flows and / or blocks in the flowcharts and / or block diagrams can be implemented by computer program instructions. These computer program instructions can be provided to a general-purpose computer, a special-purpose computer, an embedded processor, or other programmable data processing devices to produce a machine, so that the instructions executed by the computer or other programmable data processing devices produce a device that implements the functions specified in the flowcharts and / or block diagrams. Figure 1 The functions specified in one or more flows and / or blocks. Figure 1 The devices that implement the functions specified in one or more flows and / or blocks.
[0108] These computer program instructions can also be stored in a computer-readable memory that can guide the computer or other programmable data processing devices to work in a specific manner, so that the instructions stored in the computer-readable memory produce a manufactured product including instruction devices that implement the functions specified in the flowcharts and / or block diagrams. Figure 1 The functions specified in one or more flows and / or blocks. Figure 1 The devices that implement the functions specified in one or more flows and / or blocks.
[0109] These computer program instructions can also be loaded into a computer or other programmable data processing device, so that a series of operation steps are performed on the computer or other programmable device to produce a computer-implemented process, so that the instructions executed on the computer or other programmable device provide a process for implementing the functions specified in the flowcharts and / or block diagrams. Figure 1 The functions specified in one or more flows and / or blocks. Figure 1 The devices that implement the functions specified in one or more flows and / or blocks.
[0110] While the preferred embodiments of the application have been described, additional variations and modifications can be made to these embodiments by those skilled in the art once they have the benefit of the present disclosure without departing from the spirit and scope of the application. Accordingly, it is intended that the appended claims include all such modifications and variations as fall within the scope of the present application.
[0111] It is apparent that those skilled in the art can make various changes and modifications to the application without departing from the spirit and scope of the application. It is therefore intended that the present application cover all such changes and modifications that are within its scope.
Claims
1. A primer pair for detecting eQTL molecular markers associated with hypoxia tolerance in golden pomfret, characterized in that: The primer pair for the eQTL molecular marker includes a forward primer and a reverse primer; Forward primer 5'-3': CGAATTTCCGATGTGTCTTT; Reverse primers 3'-5': CTGTCTTTATTTCCTCCCTAG.
2. The application of a primer pair with an eQTL molecular marker as described in claim 1 in identifying golden pomfret with strong hypoxia tolerance, characterized in that: The eQTL molecular marker is located in the 16650700 ~ 16650870 bp segment of chromosome 20 of the golden pomfret, and the corresponding nucleotide sequence is shown in SEQ ID NO.1; The four SNP loci included in the eQTL are located on chromosome 20 at 16650770 bp, 16650804 bp, 16650828 bp and 16650849 bp, respectively. The four SNP sites mutated to T→G, G→T, G→A, and C→A; When the SNP molecular marker haplotype is haplotype 1, it indicates a golden pomfret strain with strong hypoxia tolerance, and the base is T / G / G / C. When the SNP molecular marker haplotype is haplotype 2, it indicates a golden pomfret strain with poor hypoxia tolerance, and the base is G / T / A / A.
3. The application as described in claim 2, characterized in that: Based on the identification results, further applications will be made in molecular breeding of the hypoxia tolerance trait in golden pomfret.
4. The application as described in claim 3, characterized in that: Based on the identification results, it can be further applied in the screening of strains with strong hypoxia tolerance.
Citation Information
Patent Citations
SNP molecular marker related to hypoxia resistance trait of Trachinotus ovatus and application of SNP molecular marker
CN113151492A
Trachinotus ovatus whole genome SNP molecular marker combination, liquid chip and application
CN118497352A