SNP site associated with wheat plant height major gene and corresponding KASP
By applying the molecular marker Whaas547101 and the KASP marker, which are closely linked to the major QTL gene qPH5A.1 for plant height, in wheat breeding, the problem of screening for wheat plant height in early generations was solved, breeding efficiency and homozygosity were improved, and rapid breeding was achieved.
Patent Information
- Application Number
- CN202510643454.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-19
- Publication Date
- 2025-11-07
AI Technical Summary
Current wheat breeding methods struggle to efficiently screen and identify wheat plant height traits in early generations, resulting in low breeding efficiency.
The molecular marker Whaas547101, an SNP site closely linked to the major QTL gene qPH5A.1 for wheat plant height, was used, and the corresponding KASP marker was developed. Genotypes were determined by real-time PCR amplification technology, and CC genotype materials were selected as parents for tall-stalk breeding, while TT genotype materials were selected as parents for dwarf-stalk breeding.
This technology enables rapid and accurate screening of tall and short-stalked materials in the early generations of wheat breeding, improving breeding efficiency and homozygosity, and shortening the breeding cycle.
Smart Images

Figure CN120905421A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of wheat molecular breeding, and particularly relates to a SNP site closely linked to a major gene for wheat plant height and a corresponding KASP marker. BACKGROUND
[0002] As one of the main food crops, the plant height of wheat is an important trait affecting the plant type and yield of wheat. In the 1960s, the cultivation of new dwarf wheat varieties made an important contribution to the growth of wheat. Studies have shown that appropriately reducing the plant height can improve the light interception and utilization, be beneficial to the transportation and distribution of assimilates, reduce diseases and pests, increase the resistance to lodging, and thus improve the grain yield. Therefore, the in-depth study of the plant height trait of wheat has very important technical significance for the growth of wheat.
[0003] The plant height of wheat is the total length composed of the lengths of exponential internodes, and different internodes elongate at different development periods and jointly affect the plant height trait. Existing studies have shown that the plant height of wheat is a complex quantitative trait controlled by major and minor genes, and is one of the important factors affecting the yield of wheat, but the influence of the plant height on the yield is relatively complex. At present, more than 70 QTLs related to the plant height of wheat have been reported, and the most concerned and most widely studied genes mainly include Rht1, Rht2 and Rht8. Statistics show that more than half of the existing dwarf wheat varieties are provided with the two dwarf genes Rht1 and Rht2, but the dwarf genes used in the existing wheat breeding are mainly Rht1, and the gene reduces the plant height of wheat by inhibiting the gibberellin signal pathway.
[0004] In recent years, with the maturity of genetic engineering technology and the continuous development of biological breeding technology, it has very important technical significance to find new genes related to the plant height trait, analyze the molecular mechanism thereof, and fully utilize the existing related trait genes by using new breeding biological technology for cultivating new wheat varieties. SUMMARY
[0005] The application aims to provide a SNP site (named qPH5A.1 ) closely linked to a major QTL gene (located on the 5AS chromosome and named Whaas547101 ) related to the plant height of wheat, so as to lay a certain foundation for the improvement of wheat varieties and the cultivation of new varieties.
[0006] The technical solution adopted by the application is described in detail as follows.
[0007] A SNP site closely linked to a major gene for the plant height of wheat, the major gene being a QTL gene located on the 5AS chromosome qPH5A.1 , the SNP site being named Whaas547101Molecular marker, specifically SNP site nucleotide sequence is: CAATTTTCCTTCATTCCTAACATGTACAAGTTATGTTCAGCATCCACCCTCCTCCTGCTTTTGGTTCATCTACAAACCTTGAGGCCCTTGCGCTTGAAGC[C / T]AGTAAGTCGCAAGGCCAAGATCAGGATAGCACCTCAGATAATGTTCGATCTCTCTACAGGTAAGACTTTGCTAGTTACCTTTGCCTCTATTTTATCCTCA; The SNP site has a C / T variable base at the 101st site, thus leading to the existence of CC genotype, TT genotype and CT heterozygous genotype; The CC genotype nucleotide sequence is shown in SEQ ID No. 1, and is specifically as follows (202bp): CAATTTTCCTTCATTCCTAACATGTACAAGTTATGTTCAGCATCCACCCTCCTCCTGCTTTTGGTTCATCTACAAACCTTGAGGCCCTTGCGCTTGAAGCCCAGTAAGTCGCAAGGCCAAGATCAGGATAGCACCTCAGATAATGTTCGATCTCTCTACAGGTAAGACTTTGCTAGTTACCTTTGCCTCTATTTTATCCTCA; The TT genotype nucleotide sequence is shown in SEQ ID No. 2, and is specifically as follows: CAATTTTCCTTCATTCCTAACATGTACAAGTTATGTTCAGCATCCACCCTCCTCCTGCTTTTGGTTCATCTACAAACCTTGAGGCCCTTGCGCTTGAAGCTTAGTAAGTCGCAAGGCCAAGATCAGGATAGCACCTCAGATAATGTTCGATCTCTCTACAGGTAAGACTTTGCTAGTTACCTTTGCCTCTATTTTATCCTCA.
[0008] The SNP site is applied in the detection and determination of wheat plant height, and the plant height of the wheat material with CC genotype is significantly higher than that of the wheat with TT genotype and CT heterozygous genotype.
[0009] The KASP marker for the SNP site closely associated with the main gene of wheat plant height is a set of PCR amplification primers, which are specifically designed as follows: F1: 5'-TTGAGGCCCTTGCGCTTGAAGCC-3', GAAGGTGACCAAGTTCATGCT F2: 5'-TTGAGGCCCTTGCGCTTGAAGCT-3', R: 5'-CTGTCAAGTGACATAGTGATTTAAC-3'; GAAGGTGACCAAGTTCATGCT The sequence of "FAM" in the F1 primer part is a FAM fluorescent tag; The sequence of "HEX" in the F2 primer part is a HEX fluorescent tag. GAAGGTGACCAAGTTCATGCT GAAGGTGACCAAGTTCATGCT
[0010] The KASP marker (PCR primer set) is applied in wheat molecular breeding. The application method is as follows: after sampling and extracting the genomic DNA of the material to be screened or identified (for example, using the CTAB method), the fluorescence quantitative PCR amplification is performed on the sample to be detected, and the application is determined based on the PCR amplification result. The determination standard is as follows: If the PCR amplification result is blue fluorescence, it indicates that the sample material to be detected is of CC genotype (corresponding to the nucleotide sequence shown in SEQ ID No. 1); If the PCR amplification result is green fluorescence, it indicates that the sample material to be detected is of TT genotype (corresponding to the nucleotide sequence shown in SEQ ID No. 2); If the PCR amplification result is red fluorescence, it indicates that the sample material to be detected is of CT heterozygous genotype (containing the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2); According to the genotype determined, the plant height of the material to be detected is determined, wherein the plant height of the material of CC genotype is significantly higher than that of the materials of TT genotype and CT heterozygous genotype.
[0011] The wheat variety breeding method using the SNP site or KASP marker selects the wheat material of CC genotype as the high-stalk breeding parent material and the wheat material of TT genotype as the dwarf breeding parent material.
[0012] In the process of traditional wheat breeding practice, in order to screen new varieties, the number of generations of wheat seeds harvested by hybridization is large, and the traditional breeding method needs to be self-crossed for 6-8 generations to obtain a high-homogeneity inbred line. At the same time, due to the limitation of experimental scale, it is difficult to select and determine the target traits in early generations of breeding. Therefore, the cultivation and acquisition of DH (Double Haploid) plants is an important technical method to speed up the breeding progress and improve the breeding efficiency. In the present application, the inventors measured and analyzed the wheat plant height trait of the ZC population based on the DH line material of Zheng1088 / CD87 and the F2 population material of CD87 obtained in the previous work. Combined with the BSR pool data and the analysis results of the wheat 660K SNP chip, a key genetic gene controlling wheat plant height which can stably exist in different populations was preliminarily mined, and a major gene related to wheat plant height was further obtained qPH5A.1 closely linked Whaas547101 molecular markers. Based on these results, the identification of excellent allelic variation types can be carried out in the early generation materials of wheat breeding, and scientific basis can be provided for the selection of wheat breeding offspring materials, so as to improve the breeding efficiency of high-quality wheat, and therefore has good practical scientific research value. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 is the Manhattan plot of the ED value correlation frequency distribution; the dotted line is the threshold line of-log10P=4; the red arrow points to the significant marker Whaas547101 identified by the present application, which is located on the 5AS chromosome of wheat; Figure 2 is the genotyping diagram of the Whaas547101 site KASP marker in the ZC population; in the figure, blue represents genotype CC, green represents genotype TT, red represents genotype CT, and gray represents blank control (NTC) without genomic DNA; Figure 3 is the highly differential analysis diagram between different alleles in the ZC population, and the difference of wheat plant height between different genotypes reaches a very significant level; Figure 4 is the genotyping diagram of the Whaas547101 site KASP marker in the ZY population; Figure 5 is the highly differential analysis diagram between different alleles in the ZY population, and the significance difference is calculated according to the genotyping results and the phenotype data. DETAILED DESCRIPTION
[0014] The application will be further explained in combination with the following examples. Before further explanation, it needs to be explained that the related wheat varieties (materials) involved in the present application are all common and commonly used materials in the existing wheat breeding or research, which can be obtained from the market or related germplasm bank and other public channels. The applicant is a professional agricultural scientific research institution, which has constructed a related germplasm resource bank, and the inventors are also professional researchers who have long-term collected and preserved related germplasm materials. Therefore, the acquisition and use of related germplasm materials comply with the current relevant administrative regulations.
[0015] Example 1 In the process of previous work, the inventors constructed a DH line material of Zheng1088 / CD87 and a F2 population material of CD87. In view of the fact that plant height is an important phenotypic trait of wheat, the inventors measured and statistically analyzed the plant height of the population material. Further, in combination with the related sequencing results and gene chip analysis, the inventors further located and researched the related plant height trait control genes. The related experimental conditions are briefly introduced as follows.
[0016] (I) Plant height trait investigation and statistics Before introducing the specific experimental conditions, the related wheat population construction in the present application is briefly explained as follows (the related height data in the present application is only based on the statistical results under the conditions of planting area, planting variety, planting year, etc.).
[0017] In the process of previous work, the inventors obtained a DH plant (denoted as Z1-DH, with an average height of about 45 cm) significantly lower than the parent materials in the progeny of Zheng1088 (~90 cm, female parent) x CD87 (~67 cm, male parent, introduced from Australia, which is widely planted and applied in the main wheat producing areas in southern and eastern Australia) combination, and further obtained F2 population (ZC population) by crossing Z1-DH with the male parent CD87, for subsequent BSR sequencing analysis; In addition, the inventors obtained a DH plant (denoted as Z2-DH) from the combination of CD87 (~67 cm) x Zhengmai369 (~75 cm), and obtained F2 population by crossing Z2-DH with the female parent CD87, as a verification population (ZY population); The related materials were planted in the Henan Modernization Research and Development Base in Yuanyang County, Henan Province.
[0018] After the late wheat heading period in May, the plant height of the F2 population was measured. The land plane was taken as the 0 scale line, and the top of the most medium ear was selected as the final height. The plant height phenotype data of part of the samples are shown in Table 1.
[0019] Table 1, part of the plant height phenotype data of F2 population (2022-2023) Note: The "number" column in the table is self-encoding based on experimental record statistics, which has no special technical meaning.
[0020] (B) BSR-seq sequencing analysis First, according to the plant height measurement results in step (A), 40 high-straw samples (75-82 cm) and 40 low-straw samples (25-41 cm) were randomly selected from the ZC population as sample sources; Subsequently, three sections of stem (about 1 cm each section, 3 parallel groups each) were selected from each of the above wheat sample sources as samples, RNA was extracted, and high-straw and low-straw mixed pools were constructed; simultaneously, a parent material mixed pool was constructed; finally, three BSR mixed pools of high-straw, low-straw, and parent material were obtained (i.e. three libraries were constructed); Finally, the samples were sequenced on both ends to obtain Raw Reads, and subsequent quality control analysis and low-quality data filtering were performed to ensure that the Q20 of each sample sequencing data was >85%.
[0021] (Three) SNP site screening Combined with the sequencing results and the transcriptome data results of the constructed library, and compared with the reference genome of Zhonghua Chun, the final results found a QTL site related to wheat plant height on chromosome 5A.
[0022] Further, the inventors used a wheat 660K SNP chip to further screen and compare the sites obtained from the foregoing screening, and drew a Manhattan plot related to the frequency distribution of ED values (as shown in Figure 1 The final result preliminarily identified SNP site Whaas547101 is a SNP site closely linked to the plant height trait. The nucleotide sequence of the site is: CAATTTTCCTTCATTCCTAACATGTACAAGTTATGTTCAGCATCCACCCTCCTCCTGCTTTTGGTTCATCTACAAACCTTGAGGCCCTTGCGCTTGAAGC[C / T]AGTAAGTCGCAAGGCCAAGATCAGGATAGCACCTCAGATAATGTTCGATCTCTCTACAGGTAAGACTTTGCTAGTTACCTTTGCCTCTATTTTATCCTCA; There is a C / T allele mutation polymorphism site at the 103rd base; accordingly, the homozygous genotype can be divided into CC type and TT type.
[0023] Example 2 In order to facilitate the further analysis and application of the target gene, based on the characteristics of the SNP site determined in Example 1 and the characteristics of KASP technology, the inventors further developed the corresponding primer set and carried out further detection and determination method, the specific circumstances are briefly introduced as follows.
[0024] (I) Primer design Referring to the SNP site sequence determined in Example 1, taking the annealing temperature of 60℃ as the reference, and considering the subsequent fluorescence detection and differentiation, the KASP marker primer set is designed as follows: F1: GAAGGTGACCAAGTTCATGCT TTGAGGCCCTTGCGCTTGAAGCC, F2: GAAGGTGACCAAGTTCATGCT TTGAGGCCCTTGCGCTTGAAGCT, R: CTGTCAAGTGACATAGTGATTTAAC, Among them, the front end of the forward primer F1 and F2 horizontal line part respectively represents the addition of FAM and HEX fluorescent label.
[0025] (II) Genomic DNA extraction Using the CTAB method, the leaf material of the previously collected wheat material at the seedling stage was used as the experimental sample, and its genomic DNA was extracted and diluted to 50 ng / μL as the template for subsequent PCR amplification.
[0026] (III) PCR reaction Using the DNA extracted in step (II) as the template, the primers designed in step (I) were used for PCR amplification, and the 5 μL amplification system was designed as follows: KASP Master Mix, 2.5 μL; F1 primer, 0.075 μL; F2 primer, 0.075 μL; R primer, 0.2 μL; DNA template, 1.8 μL (50 ng / μL); ddH2O, 2.15 μL; The PCR amplification program is: 95℃, 15min; 95℃, 20s, 65℃-55℃, 1min, 10 cycles, each cycle decreases by 1℃; 95℃, 20s, 57℃, 1min, 35 cycles; 37℃, 1min; After the end of the fluorescence quantitative PCR (CFX Connect TM ), the wheat gene analysis of the test material was carried out according to the color, wherein: Blue fluorescence indicates that the wheat material is of CC genotype; Green fluorescence indicates that the wheat material is of TT genotype; Red fluorescence indicates that the wheat material is of CT heterozygous type; Black indicates a blank control (NTC) without genomic DNA.
[0027] Based on the above genotyping results (results are shown in Figure 2 , Figure 3 , compared with the actual wheat phenotype trait results, the results show that the height of the wheat material of CC genotype is higher than that of the material of TT genotype; the wheat material of CC genotype is of high-stalk trait, and the average height is 81.90 cm; the wheat material of TT genotype is of low-stalk trait, and the average height is 38.39 cm; the wheat material of CT genotype is of intermediate height, and the average height is 63.23 cm.
[0028] (Four) Population verification Based on the foregoing analysis results, in order to further verify the accuracy of the KASP marker primer set designed in the application, the ZY population (Zhengmai 369 / CD87) constructed in the early stage is used as a verification population, and the marker is further detected and verified (the related operation can refer to the foregoing). The results show (results are shown in Figure 4 , Figure 5 ): the genotyping results are basically consistent with the phenotype results; the wheat material of CC genotype is of high-stalk trait, and the average height is 77.00 cm; the wheat material of TT genotype is of low-stalk trait, and the average height is 53.33 cm; the wheat material of CT genotype is of intermediate height, and the average height is 66.48 cm.
Claims
1. A SNP locus closely linked to a major gene for plant height in wheat, characterized in that, The major effective gene is a QTL gene located on the 5AS chromosome qPH5A.1 The SNP site is named Whaas547101 The molecular marker, specifically the SNP site, has the nucleotide sequence of CAATTTTCCTTCATTCCTAACATGTACAAGTTATGTTCAGCATCCACCCTCCTCCTGCTTTTGGTTCATCTACAAACCTTGAGGCCCTTGCGCTTGAAGC[C / T]AGTAAGTCGCAAGGCCAAGATCAGGATAGCACCTCAGATAATGTTCGATCTCTCTACAGGTAAGACTTTGCTAGTTACCTTTGCCTCTATTTTATCCTCA; The SNP site has a C / T variable base at the 101st site, so there are CC genotype, TT genotype and CT heterozygous genotype; The CC genotype nucleotide sequence is shown in SEQ ID No. 1; The TT genotype nucleotide sequence is shown in SEQ ID No.
2.
2. Use of the SNP site according to claim 1 in the detection of the plant height determination in wheat, characterized in that, In application, the plant height of wheat material with CC genotype is significantly higher than that of wheat with TT genotype and CT heterozygous genotype.
3. Use of the SNP site according to claim 1 in the breeding of wheat varieties, characterized in that, In application, the plant height of wheat material with CC genotype is significantly higher than that of wheat with TT genotype and CT heterozygous genotype.
4. The KASP marker for the SNP locus closely linked to the major gene for plant height in wheat according to claim 1, characterized in that, The KASP marker is a set of PCR amplification primers, which are specifically designed as follows: F1 : 5'-GTTTCCCGGTTTCGGATTGG-3' GAAGGTGACCAAGTTCATGCT TTGAGGCCCTTGCGCTTGAAGCC-3', F2:5’- GAAGGTCGGAGTCAACGGATT TTGAGGCCCTTGCGCTTGAAGCT-3’, R: 5'-CTGTCAAGTGACATAGTGATTTAAC-3'; the sequence of the F1 primer portion is GAAGGTGACCAAGTTCATGCT the sequence of the FAM fluorescent tag; the sequence of the F2 primer portion is a HEX fluorescent tag. GAAGGTCGGAGTCAACGGATT the sequence of the F2 primer portion is a HEX fluorescent tag.
5. Use of the KASP marker of claim 4 in the determination of plant height in wheat, characterized in that, The application method is to take samples and extract genomic DNA from the materials to be screened or identified, then perform fluorescent quantitative PCR amplification on the samples to be detected, and determine the application based on the PCR amplification results. The determination standard is: If the PCR amplification result is blue fluorescence, it indicates that the sample material to be detected is CC genotype (corresponding to the nucleotide sequence shown in SEQ ID No. 1); If the PCR amplification result is green fluorescence, it indicates that the sample material to be detected is TT genotype (corresponding to the nucleotide sequence shown in SEQ ID No. 2); If the PCR amplification result is red fluorescence, it indicates that the sample material to be detected is CT heterozygous genotype (containing both the nucleotide sequences shown in SEQ ID No. 1 and SEQ ID No. 2); According to the genotype determined, the plant height of the material to be detected is determined, and the plant height of the material with CC genotype is significantly higher than that of the material with TT genotype and CT heterozygous genotype.
6. Use of the KASP marker of claim 5 in wheat molecular breeding, characterized in that, CTAB method is used to extract genomic DNA.
7. Use of the KASP marker of claim 4 in wheat breeding, characterized in that, In application, the KASP marker is used for PCR amplification, and according to the PCR amplification result, the wheat material with CC genotype is selected as the high-stalk breeding parent material, and the wheat material with TT genotype is selected as the dwarf breeding parent material.