Molecular marker and method for rapidly identifying powdery mildew resistance of muskmelon and application

Abstract

The invention discloses a molecular marker and method for rapidly identifying powdery mildew resistance of muskmelon and application, and belongs to the technical field of powdery mildew resistance identification. According to the invention, it is found for the first time that the InDel marker MM365 is closely linked with the powdery mildew resistance of muskmelon, the InDel marker MM365 is located in the 12th chromosome 22.56 Mb of a DHL92 muskmelon genome V4.0 version, and the nucleotide sequence of the InDel marker MM365 is as shown in SEQ ID NO.1; the invention also provides upstream and downstream primer sequences and an identification method for identifying the InDel marker MM365. Identification can be carried out in the seedling stage of the muskmelon, pathogenic bacteria inoculation is not needed, and the detection result is not influenced by the plant growth stage and the external environment condition change and is stable and reliable; the provided molecular marker closely linked with the powdery mildew resistance of the muskmelon can be used for breeding muskmelon powdery mildew resistance varieties, and has important significance in simplifying the breeding process, shortening the identification period and breeding age limit, reducing the breeding cost and promoting the breeding process of the muskmelon powdery mildew resistance.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of powdery mildew resistance identification, and in particular to a molecular marker for rapidly identifying powdery mildew resistance of melon, a method and application thereof. BACKGROUND

[0002] Melon (Cucumis melo L.) is a plant of Cucurbitaceae and Cucumis, also known as bai lang gua, Hami melon and fragrant melon. The fruit is white, yellow or green, crisp and sweet, and contains a large amount of carbohydrates, citric acid, carotene and B vitamins, vitamin C and other nutrients. It has the effects of heat-clearing and diuresis, and improving damp-heat headache, and is a summer fruit that is deeply loved by the public.

[0003] Melon powdery mildew, also known as white hair disease and powdery mildew, is a fungal disease caused by Sphaerotheca cucurbitae (Jacz.) Z.Y. Zhao and Erysiphe Cucurbitacearum Zheng & Chen. It is one of the main diseases in melon production, with a high incidence rate of 30-100%. The disease mainly occurs on leaves, petioles and stems, and the initial symptoms are white, nearly round and star-shaped small powder spots on the front of the leaves. As the disease spreads, the small powder spots spread to the surrounding areas to form a continuous white powder with unclear edges. In severe cases, the whole plant is covered with white powder. The leaves of diseased plants turn yellow and become brittle, which can cause the death of the melon seedlings. The conidia of the pathogen can also be spread by air, causing widespread disease, which seriously affects the early development and growth of the fruit, and leads to a significant decrease in the yield and quality of melon.

[0004] Breeding of disease-resistant varieties is an important means to reduce the use of pesticides, production costs, improve melon yield and quality, reduce environmental pollution, enhance agricultural sustainability and ensure food security. Traditional disease-resistant breeding methods rely on pathogen inoculation and induction of disease in the field or greenhouse, and long-term phenotypic observation. This process is not only time-consuming and labor-intensive, but also susceptible to environmental conditions, resulting in low screening efficiency and long breeding cycle.

[0005] Molecular marker-assisted selection (MAS) technology can accurately predict the genotype at any growth stage of the plant (especially at the seedling stage) by using DNA molecular markers closely linked to the target trait. It has the advantages of high efficiency, accuracy and stability. Therefore, the development of a molecular marker closely linked to the melon powdery mildew resistance gene and capable of stable application is crucial for improving breeding efficiency and accelerating the breeding of disease-resistant varieties. SUMMARY

[0006] The application aims to provide a molecular marker, a method and an application for rapidly identifying resistance of melon to powdery mildew, so as to overcome the defects of long identification period, high cost, time-consuming and laborious, great environmental influence and poor result stability of melon resistance to powdery mildew in the prior art.

[0007] To achieve the above-mentioned object, the application provides a molecular marker for rapidly identifying resistance of melon to powdery mildew, which is an InDel marker MM365, the nucleotide sequence is shown in SEQ ID NO. 1, and is located in the 22.56 Mb of the 12th chromosome of melon in the V4.0 version (http: / / cucurbitgenomics.org / v2 / organism / 23) of the DHL92 melon genome.

[0008] Preferably, the resistant plant has more nucleotide sequences shown in SEQ ID NO. 1 than the susceptible plant.

[0009] Preferably, the upstream primer sequence for amplifying the InDel marker MM365 is shown in SEQ ID NO. 2, and the downstream primer sequence is shown in SEQ ID NO. 3.

[0010] A method for rapidly identifying resistance of melon to powdery mildew, which utilizes the above-mentioned molecular marker for rapidly identifying resistance of melon to powdery mildew, and the steps are as follows:

[0011] The genomic DNA of the plant to be identified is used as a template, and the upstream and downstream primers for amplifying the InDel marker MM365 are configured into a reaction system to perform PCR amplification, and the amplification product is subjected to electrophoresis, and the plant with an electrophoretic band of 228 bp is resistant, and the plant with an electrophoretic band of 218 bp is susceptible.

[0012] Preferably, the reaction system is a Taq enzyme reaction system or other reaction system for amplifying a target fragment.

[0013] Preferably, the PCR amplification program is 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, and denaturation, annealing and extension for a total of 35 cycles; and finally 72℃ extension for 5 min.

[0014] An application of the above-mentioned molecular marker for rapidly identifying resistance of melon to powdery mildew in breeding of melon varieties resistant to powdery mildew.

[0015] An application of the above-mentioned upstream and downstream primers for amplifying the InDel marker MM365 in breeding of melon varieties resistant to powdery mildew.

[0016] An application of the above-mentioned method for rapidly identifying resistance of melon to powdery mildew in breeding of melon varieties resistant to powdery mildew.

[0017] Therefore, the application provides a molecular marker, a method and an application for rapidly identifying resistance of melon to powdery mildew, and specific technical effects are as follows.

[0018] (1) The application first discovers that the InDel marker MM365 is closely linked to the resistance of melon to powdery mildew, and the InDel marker MM365 is located at 22.56 Mb of chromosome 12 in the V4.0 version of the DHL92 melon genome (http: / / cucurbitgenomics.org / v2 / organism / 23), and the nucleotide sequence is shown as SEQ ID NO. 1;

[0019] (2) The application also provides sequences of upstream and downstream primers for identifying the InDel marker MM365 and a method for identifying the InDel marker MM365; the identification can be performed at the seedling stage of melon, without pathogenic bacteria inoculation, and the detection result is not affected by the growth period of the plant and changes in external environmental conditions, and the result is stable and reliable;

[0020] (3) At present, there is no commercial melon variety resistant to powdery mildew, and the molecular marker closely linked to the resistance of melon to powdery mildew provided by the application can be used for breeding of melon varieties resistant to powdery mildew, which has important significance for simplifying the breeding process, shortening the identification period and breeding period, reducing the breeding cost, and promoting the breeding process of melon resistant to powdery mildew.

[0021] The technical solutions of the application will be further described in detail below with the help of the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the application, the drawings needed to be used in the description of the embodiments of the application will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0023] Figure 1 is a flow chart for constructing a RIL population in Embodiment 2 of the application;

[0024] Figure 2 is a picture of the disease-resistant plant 'SN-1' in Embodiment 2 of the application;

[0025] Figure 3 is a picture of the disease-susceptible plant 'Yangjiaomeng' in Embodiment 2 of the application;

[0026] Figure 4is the PAGE electrophoresis result in Example 2 of the present application; wherein M is marker, 1 lane is '1-2', 2 lane is '1-4', 3 lane is '1-5', 4 lane is '1-7', 5 lane is '2-4', 6 lane is '2-5', 7 lane is '3-5', 8 lane is '3-7', 9 lane is '3-6', 10 lane is '3-9', 11 lane is '3-10', 12 lane is '4-3', 13 lane is '4-4', 14 lane is '4-5', 15 lane is '4-7', 16 lane is '4-16', 17 lane is '5-1', 18 lane is '5-7', 19 lane is '5-12', 20 lane is '5-13', 21 lane is '6-3', 22 lane is '6-8', 23 lane is '7-3', 24 lane is '7-4', 25 lane is '7-5', 26 lane is '7-10', 27 lane is '8-2', 28 lane is '8-11', 29 lane is '8-13', 30 lane is '8-17', 31 lane is '9-6', 32 lane is '9-11', 33 lane is '11-5', 34 lane is '11-6', 35 lane is '11-9', 36 lane is '11-11', 37 lane is '21-5', 38 lane is '23-4', 39 lane is '23-5', 40 lane is '23-9', 41 lane is '24-7', 42 lane is '26-2', 43 lane is '27-6', 44 lane is '27-8', 45 lane is '28-2', 46 lane is '28-5', 47 lane is '28-7', 48 lane is '28-9', 49 lane is '29-9', 50 lane is '29-11', 51 lane is '29-12', 52 lane is '30-4', 53 lane is '30-7', 54 lane is '31-1', 55 lane is '31-14', 56 lane is '32-4', 57 lane is '32-8', 58 lane is '33-4', 59 lane is '33-8', 60 lane is '33-7', 61 lane is '33-9', 62 lane is '33-12', 63 lane is 'SN-1', 64 lane is 'YJM';

[0027] Figure 5are the results of the bacteria inoculation test in Example 3 of the present application; wherein 1 is '1-5', 2 is '1-7', 3 is '3-5', 4 is '3-7', 5 is '3-9', 6 is '3-10', 7 is '4-5', 8 is '4-7', 9 is '4-16', 10 is '5-1', 11 is '5-13', 12 is '6-3', 13 is '6-8', 14 is '7-5', 15 is '7-10', 16 is '8-11', 17 is '8-13', 18 is '11-5', 19 is '11-6', 20 is '21-5', 21 is '23-4', 22 is '23-9', 23 is '26-2', 24 is '27-6', 25 is '27-8', 26 is '28-2', 27 is '28-5', 28 is '28-9', 29 is '29-9', 30 is '29-11', 31 is '30-4', 32 is '31-1', 33 is '32-4', 34 is '32-8', 35 is '33-4', 36 is '33-8', 37 is '33-12', 38 is '1-2', 39 is '1-4', 40 is '2-4', 41 is '2-5', 42 is '3-6', 43 is '4-3', 44 is '4-4', 45 is '5-7', 46 is '5-12', 47 is '7-3', 48 is '7-4', 49 is '8-2', 50 is '8-17', 51 is '9-6', 52 is '9-11', 53 is '11-9', 54 is '11-11', 55 is '23-5', 56 is '24-7', 57 is '28-7', 58 is '29-12', 59 is '30-7', 60 is '31-14', 61 is '33-7', 62 is '33-9';

[0028] Figure 6is the field powdery mildew phenotype in Example 4 of the present application; wherein 1 is '1-2', 2 is '1-4', 3 is '1-5', 4 is '1-7', 5 is '2-4', 6 is '2-5', 7 is '3-5', 8 is '3-7', 9 is '3-6', 10 is '3-9', 11 is '3-10', 12 is '4-3', 13 is '4-4', 14 is '4-5', 15 is '4-7', 16 is '4-16', 17 is '5-1', 18 is '5-7', 19 is '5-12', 20 is '5-13', 21 is '6-3', 22 is '6-8', 23 is '7-3', 24 is '7-4', 25 is '7-5', 26 is '7-10', 27 is '8-2', 28 is '8-11', 29 is '8-13', 30 is '8-17', 31 is '9-6', 32 is '9-11', 33 is '11-5', 34 is '11-6', 35 is '11-9', 36 is '11-11', 37 is '21-5', 38 is '23-4', 39 is '23-5', 40 is '23-9', 41 is '24-7', 42 is '26-2', 43 is '27-6', 44 is '27-8', 45 is '28-2', 46 is '28-5', 47 is '28-7', 48 is '28-9', 49 is '29-9', 50 is '29-11', 51 is '29-12', 52 is '30-4', 53 is '30-7', 54 is '31-1', 55 is '31-14', 56 is '32-4', 57 is '32-8', 58 is '33-4', 59 is '33-8', 60 is '33-7', 61 is '33-9', 62 is '33-12'. DETAILED DESCRIPTION

[0029] The technical solutions of the present application are further described below through the drawings and examples.

[0030] In order to make the purpose, technical solutions and advantages of the present application more clear, thorough and complete, the technical solutions of the present application are described clearly and completely below through the drawings and examples. The following detailed description is the description of examples, which aims to provide further detailed description of the present application. Unless otherwise specified, all technical terms used in the present application have the same meaning as generally understood by those skilled in the art to which the present application belongs.

[0031] The instrument equipment and reagent materials used in the examples are obtained through commercial channels; the method steps not described in detail are all conventional technical means in the art.

[0032] Example 1

[0033] A molecular marker MM365 for rapidly identifying resistance to powdery mildew of Cucumis melo is an InDel marker, which is located at 22.56 Mb on chromosome 12 in the V4.0 version of the C. melo genome (http: / / cucurbitgenomics.org / v2 / organism / 23), and the nucleotide sequence of 10 bp more in the resistant plant than in the susceptible plant (the sequence is shown as SEQ ID NO. 1). The sequence of the upstream primer for amplifying the marker MM365 is shown as SEQ ID NO. 2, and the sequence of the downstream primer is shown as SEQ ID NO. 3.

[0034] SEQ ID NO. 1: GAGAAAATGA

[0035] SEQ ID NO. 2: CCTGGGATACTTGGTTTG

[0036] SEQ ID NO. 3: AAGACTTTACTGCCTTCATA

[0037] Example 2

[0038] The RIL population constructed was identified for resistance to powdery mildew by using the molecular marker MM365, specifically as follows:

[0039] (1) Construct the RIL population, the flow chart is shown as Figure 1 , and the resistant plant ‘SN-1’ is the female parent (the plant photo is shown as Figure 2 , and the plant is a germplasm resource preserved for a long time in the laboratory of the inventor, see Shuo-Shuo Wang, 2022, Ph.D. Dissertation, Shandong Agricultural University, the title of the dissertation is: Study on the physiology and molecular mechanism of Cucumis melo ‘SN-1’ resistance to powdery mildew), and the susceptible plant ‘Yangjiaomeng’ is the male parent (the plant photo is shown as Figure 3 ), and the F1 generation seeds are obtained by hybridization, the F2 generation seeds are obtained by selfing of the F1 generation, and then the single-seed descent method is used for continuous selfing to the F6 generation, and an RIL population containing 62 lines is obtained.

[0040] (2) About 1 cm 2The leaves of different sizes were placed in a clean and sterilized mortar which was cooled to room temperature, and then liquid nitrogen was added. After grinding, the powder was placed in a 2 mL centrifuge tube. The DNA of each line of the RIL population was extracted by the CTAB method, and the dried DNA was dissolved in 100 μL sterilized ddH2O. The concentration and purity of the obtained genomic solution were detected by a Nanodrop 2000, and the results are shown in Table 1. The qualified genomic DNA solution was calculated and prepared into working solutions of 62 lines of genomic solutions according to the detection results in Table 1, so that the genomic concentration was 100 ng / μL. The genomic DNA of unqualified lines was re-extracted by the above method until the purity and concentration detection were qualified.

[0041] Table 1 DNA solution information of 62 lines

[0042]

[0043]

[0044]

[0045] (3) The sequence information of SEQ ID NO. 2 and SEQ ID NO. 3 was sent to a company to synthesize primers for amplifying the MM365 marker. The received primers were dissolved into a 10 mM stock solution according to the attached instructions, and then a certain amount of stock solution was prepared into a 10 μM / L working solution. The primer stock solution was stored at -80°C, and the working solution was stored at 4°C.

[0046] (4) The genomic DNA working solution of 62 lines obtained in (2) was used as a template, and the primers prepared in (3) were used to configure the reaction system according to the attached instructions of Taq enzyme: 5 μL of 2 × Taq PCR MasterMix, 0.25 μL of 10 μM / L upstream primer and downstream primer, 3.5 μL of ddH2O, and 1 μL of genomic working solution. After mixing the reaction system, PCR amplification was performed, and the amplification program was as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 58°C annealing for 15 s, 72°C extension for 30 s, a total of 35 cycles of denaturation, annealing and extension; and finally 72°C extension for 5 min.

[0047] (5) The PCR product was subjected to PAGE electrophoresis, and the results are shown in Figure 4As shown, the RIL lines '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', '4-5', '4-7', '4-16', '5-1', '5-13', '6-3', '6-8', '7-5', '7-10', '8-11', '8-13', '11-5', '11-6', '21-5', '23-4', '23-9', '26-2', '27-6', '27-8', '28-2', '28-5', '28-9', '29-9', '29-11', '30-4', '31-1', '32-4', '32-8', '33-4', '33-8', '33-12' have the same marker polymorphism as the susceptible parent 'Honey Rock', and are susceptible materials; '1-2', '1-4', '2-4', '2-5', '3-6', '4-3', '4-4', '5-7', '5-12', '7-3', '7-4', '8-2', '8-17', '9-6', '9-11', '11-9', '11-11', '23-5', '24-7', '28-7', '29-12', '30-7', '31-14', '33-7', '33-9' have the same marker polymorphism as the resistant parent 'SN-1', and are resistant materials.

[0048] Example 3

[0049] The 62 lines of the RIL population were subjected to inoculation test for powdery mildew resistance, as follows:

[0050] The test was carried out in the artificial plant culture room of Shandong Agricultural University. After the melon seeds were germinated in a 28℃ incubator, they were sown in 50-hole deep hole trays (grass charcoal: vermiculite: perlite = 1:1:1, v / v). After the cotyledon expanded, it was irrigated with Hoagland's nutrient solution, and the environmental conditions in the artificial culture room were as follows: light period 16h / 8h, temperature 26℃ / 23℃. When the melon seedlings grew to three leaves and one heart, they were inoculated with powdery mildew fungus. Using the prepared pathogen inoculation box (see the utility model patent with the title of a crop seedling pathogen inoculation box, application number CN202420732719.3), the inoculated melon seedlings were placed under the inoculation box, and the pathogen spores were evenly scattered onto the inoculated melon seedlings through the nylon net of the inoculation box with a clean brush. After standing for 5-10 minutes, the spores in the box were allowed to fully settle to complete the inoculation. (Group standard: melon powdery mildew pathogen inoculation technical procedures T / SDAS1137-2025) On the 15th day after inoculation, the leaves were observed and identified. The leaves with white spots were recorded as susceptible plants, and the leaves without white spots were recorded as resistant plants.

[0051] The photos of the third true leaves on the 16th day after inoculation are as follows:Figure 5 As shown in Table 1, wherein '1-2', '1-4', '2-4', '2-5', '3-6', '4-3', '4-4', '5-7', '5-12', '7-3', '7-4', '8-2', '8-17', '9-6', '9-11', '11-9', '11-11', '23-5', '24-7', '28-7', '29-12', '30-7', '31-14', '33-7', '33-9' leaves had no white spots, and were identified as powdery mildew resistant plants; '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', '4-5', '4-7', '4-16', '5-1', '5-13', '6-3', '6-8', '7-5', '7-10', '8-11', '8-13', '11-5', '11-6', '21-5', '23-4', '23-9', '26-2', '27-6', '27-8', '28-2', '28-5', '28-9', '29-9', '29-11', '30-4', '31-1', '32-4', '32-8', '33-4', '33-8', '33-12' leaves had obvious powdery mildew spots, and were identified as powdery mildew susceptible plants. The identification results were consistent with those of Example 2 using molecular marker MM365.

[0052] Example 4

[0053] In order to more accurately identify the phenotype of the 62 RIL populations, in the second year, the seeds of the 62 RIL populations were grown and transplanted to the experimental base of Shandong Agricultural University. In the late fruiting stage, powdery mildew occurred naturally in the field, and the photos of each plant were as follows: Figure 6Among them, all the leaves of the plants of '1-2', '1-4', '2-4', '2-5', '3-6', '4-3', '4-4', '5-7', '5-12', '7-3', '7-4', '8-2', '8-17', '9-6', '9-11', '11-9', '11-11', '23-5', '24-7', '28-7', '29-12', '30-7', '31-14', '33-7', '33-9' had no white spots on the surface of all the leaves, and were identified as powdery mildew resistant plants; the leaves of '1-5', '1-7', '3-5', '3-7', '3-9', '3-10', '4-5', '4-7', '4-16', '5-1', '5-13', '6-3', '6-8', '7-5', '7-10', '8-11', '8-13', '11-5', '11-6', '21-5', '23-4', '23-9', '26-2', '27-6', '27-8', '28-2', '28-5', '28-9', '29-9', '29-11', '30-4', '31-1', '32-4', '32-8', '33-4', '33-8', '33-12' had different degrees of obvious powdery mildew spots on the surface of the leaves, and were identified as powdery mildew susceptible plants.

[0054] The field identification results of the RIL population were consistent with the identification results of the molecular marker MM365 in Example 2 and the inoculation test in Example 3.

[0055] Therefore, the InDel marker MM365 is found to be closely linked to the powdery mildew resistance of melon for the first time, the InDel marker MM365 is located at 22.56 Mb of chromosome 12 of the DHL92 melon genome V4.0 version, the website of the DHL92 melon genome V4.0 version is http: / / cucurbitgenomics.org / v2 / organism / 23, and the nucleotide sequence is shown as SEQ ID NO. 1; the upstream and downstream primer sequences and identification method of the InDel marker MM365 are also provided; the identification can be carried out at the seedling stage of melon, and the pathogenic bacteria inoculation is not required, the detection results are not affected by the growth period of the plant and the change of external environmental conditions, and the results are stable and reliable; the provided molecular marker closely linked to the powdery mildew resistance of melon can be used for breeding of melon varieties resistant to powdery mildew, and has important significance for simplifying the breeding process, shortening the identification period and breeding period, reducing the breeding cost, and promoting the breeding process of melon resistant to powdery mildew.

[0056] It should be pointed out finally that the above examples are only used to illustrate the technical solutions of the present application but not to limit it, and although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can still be modified or replaced equivalently, and these modifications or equivalent replacements should not make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present application.

Claims

1. A molecular marker for rapid identification of resistance to powdery mildew in Cucumis melo, characterized in that: The molecular marker is InDel marker MM365, the nucleotide sequence is shown as SEQ ID NO. 1, and is located at 22.56 Mb of chromosome 12 in the DHL92 melon genome V4.0 version. The website of the DHL92 melon genome V4.0 version is http: / / cucurbitgenomics.org / v2 / organism / 23.

2. The molecular marker for rapid identification of resistance to powdery mildew in Cucumis melo according to claim 1, characterized in that: The plant resistant to the disease has the nucleotide sequence shown as SEQ ID NO.

1.

3. The molecular marker for rapid identification of resistance to powdery mildew in Cucumis melo according to claim 1, characterized in that: The sequence of the upstream primer for amplifying the InDel marker MM365 is shown as SEQ ID NO. 2, and the sequence of the downstream primer is shown as SEQ ID NO.

3.

4. A method for rapid identification of resistance to powdery mildew in Cucumis melo, characterized in that, The steps of the method for rapidly identifying the resistance of melon to powdery mildew by using the molecular marker according to any one of claims 1 to 3 are as follows: The genomic DNA of the plant to be identified is used as a template, and the upstream and downstream primers for amplifying the InDel marker MM365 are configured into a reaction system to perform PCR amplification, and the amplification product is subjected to electrophoresis. The plant with an electrophoretic band of 228 bp is resistant to the disease, and the plant with an electrophoretic band of 218 bp is susceptible to the disease.

5. The method for rapid identification of resistance to powdery mildew in Cucumis melo according to claim 4, characterized in that: The reaction system is a Taq enzyme reaction system or other reaction system for amplifying a target fragment.

6. The method for rapid identification of resistance to powdery mildew in Cucumis melo according to claim 4, characterized in that: The PCR amplification procedure is 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 30 s, and denaturation, annealing and extension for a total of 35 cycles; and finally 72℃ extension for 5 min.

7. The application of the molecular marker for rapidly identifying the resistance of melon to powdery mildew according to claim 1 to the breeding of a melon variety resistant to powdery mildew.

8. The application of the upstream and downstream primers for amplifying the InDel marker MM365 according to claim 3 to the breeding of a melon variety resistant to powdery mildew.

9. The application of the method for rapidly identifying the resistance of melon to powdery mildew according to any one of claims 4 to 6 to the breeding of a melon variety resistant to powdery mildew.

Images