Molecular marker primer group and kit for identifying macadimia nut variety Guijin No.1 and application of molecular marker primer group and kit

Abstract

The invention discloses a molecular marker primer group and a kit for identifying a macadamia nut variety Guijin No.1 and application of the molecular marker primer group and the kit. The molecular marker primer group is composed of five pairs of primers, and each pair of primers is composed of an upstream primer and a downstream primer. An upstream primer of the first pair of primers is as shown in SEQ ID NO: 1 in a sequence table, a downstream primer of the first pair of primers is as shown in SEQ ID NO: 2 in the sequence table, an upstream primer of the second pair of primers is as shown in SEQ ID NO: 3 in the sequence table, a downstream primer of the second pair of primers is as shown in SEQ ID NO: 4 in the sequence table, an upstream primer of the third pair of primers is as shown in SEQ ID NO: 5 in the sequence table, and a downstream primer of the fourth pair of primers is as shown in SEQ ID NO: 6 in the sequence table. The downstream primer of the third pair of primers is shown as SEQ ID NO: 6 in the sequence table, the upstream primer of the fourth pair of primers is shown as SEQ ID NO: 7 in the sequence table, and the downstream primer of the fourth pair of primers is shown as SEQ ID NO: 8 in the sequence table. The molecular marker primer group can accurately identify the macadamia nut variety Guire No.1.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the field of molecular biology and genetic breeding, in particular to a molecular marker primer set for identifying Macadamia variety Guire No.1, a kit and application thereof. BACKGROUND

[0002] Macadamia spp. is native to Australia and is recognized worldwide as a high-end edible nut and woody oil plant, enjoying the reputation of "King of Nuts". The kernel of Macadamia is rich in nutrients, with high fat content mainly composed of unsaturated fatty acids, which is beneficial to cardiovascular health. The market demand for Macadamia is strong, but the global annual output is far lower than the market demand, with a huge gap between supply and demand. Therefore, the development prospect of Macadamia industry is very broad.

[0003] In recent years, China has become the main production area and important consumption market of Macadamia in the world, but the main varieties currently planted mainly rely on introduction from abroad. The poor climate adaptability of some introduced varieties leads to low yield, with unit area yield only 1 / 3-1 / 2 of that in the original habitat, which seriously restricts the industrial benefits. At the same time, with the changes in international trade environment and the strengthening of protection of plant variety rights in the original habitat, the introduction of foreign Macadamia varieties in China is limited, and new varieties with independent intellectual property rights and adapted to local environment are urgently needed.

[0004] Plant variety identification can be based on morphological characteristics, physiological and ecological characteristics, biochemical markers and molecular markers. Morphological characteristic identification is intuitive and simple, but it is easily affected by environment and human factors, and has a long cycle and certain seasonality. Molecular marker identification has significant advantages, is not affected by season and development stage, has rich polymorphism and strong specificity, is fast, efficient and high-precision, and has been applied to DUS testing and substantial derivative variety identification of many plants. At present, there are phenomena of "same name different things" and "same thing different names" in Macadamia, which hinders variety breeding, intellectual property protection and industry promotion. Impure or incorrect seedling varieties also damage the economic interests of practitioners, and seriously affect the healthy development of Macadamia industry.

[0005] Guire No.1 is a publicly approved variety, which is selected from a superior mutant single plant of Macadamia seedling introduced in 1989. It was approved by the National Tropical Crop Variety Approval Committee on November 13, 2020, with the approval number: hot product approval 2020004. Accurate identification of Guire No.1 is crucial for its popularization and application.

[0006] DISCLOSURE

[0007] In order to solve the problem of inaccurate identification of Macadamia variety Guire No.1, the present disclosure provides a molecular marker primer set for identifying Macadamia variety Guire No.1, a kit and application thereof. The technical solution is as follows:

[0008] In one aspect, the present disclosure provides a molecular marker primer set for identifying Macadamia integrifolia cultivar Girel 1, which consists of five pairs of primers, each pair consisting of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is set forth in SEQ ID NO: 1 of the Sequence Listing, the downstream primer of the first pair of primers is set forth in SEQ ID NO: 2 of the Sequence Listing, the upstream primer of the second pair of primers is set forth in SEQ ID NO: 3 of the Sequence Listing, the downstream primer of the second pair of primers is set forth in SEQ ID NO: 4 of the Sequence Listing, the upstream primer of the third pair of primers is set forth in SEQ ID NO: 5 of the Sequence Listing, the downstream primer of the third pair of primers is set forth in SEQ ID NO: 6 of the Sequence Listing, the upstream primer of the fourth pair of primers is set forth in SEQ ID NO: 7 of the Sequence Listing, the downstream primer of the fourth pair of primers is set forth in SEQ ID NO: 8 of the Sequence Listing, the upstream primer of the fifth pair of primers is set forth in SEQ ID NO: 9 of the Sequence Listing, and the downstream primer of the fifth pair of primers is set forth in SEQ ID NO: 10 of the Sequence Listing.

[0009] In another aspect, the present disclosure provides a kit for identifying Macadamia integrifolia cultivar Girel 1, which comprises the above-mentioned molecular marker primer set.

[0010] In yet another aspect, the present disclosure provides an application of a molecular marker primer set for identifying Macadamia integrifolia cultivar Girel 1, characterized in that the application comprises: amplifying a sample to be tested using the molecular marker primer set according to claim 1 to obtain an amplification product;

[0011] sequencing the amplification product by next-generation high-throughput sequencing to obtain sequencing data;

[0012] aligning the sequencing data to a Macadamia integrifolia reference genome to obtain sequencing results of the sample to be tested as set forth in SEQ ID NO: 11 of the Sequence Listing to SEQ ID NO: 66 of the Sequence Listing;

[0013] analyzing the sequencing results to obtain different sequence types;

[0014] when the obtained sequence type is set forth in SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 36, SEQ ID NO: 41, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, and SEQ ID NO: 65 of the Sequence Listing, then the sample to be tested is identified as Macadamia integrifolia cultivar Girel 1.

[0015] The application also includes: the molecular marker primer set distinguishes Macadamia cultivars 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No. 1, Nanya No. 3, Yunyan No. 10, Yunyan No. 4 and Yunyan No. 9.

[0016] The technical scheme provided by the embodiments of the present disclosure has the beneficial effects that: the embodiments of the present disclosure provide a molecular marker primer set for identifying Macadamia cultivar Guire No. 1, a kit and an application. The molecular marker primer set is used to amplify the to-be-tested sample, the obtained amplification product is sequenced, and the cultivars are distinguished according to the sequencing results. There are multiple base differences between the sequences of different cultivars, including substitution, insertion, deletion and repetition, and the accurate identification of Macadamia cultivar Guire No. 1 is realized through these differences. At the same time, the differences can be used to effectively distinguish Guire No. 1 and other 29 Macadamia cultivars 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No. 1, Nanya No. 3, Yunyan No. 10, Yunyan No. 4 and Yunyan No. 9. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present disclosure, the drawings needed in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are only some embodiments of the present disclosure, and other drawings can also be obtained by those skilled in the art without creative labor.

[0018] Figure 1 is a sequence alignment map of the first pair of primers provided in Embodiment Three of the present disclosure.

[0019] Figure 2 is a sequence alignment map of the second pair of primers provided in Embodiment Three of the present disclosure.

[0020] Figure 3 is a sequence alignment map of the third pair of primers provided in Embodiment Three of the present disclosure.

[0021] Figure 4 is a sequence alignment map of the third pair of primers provided in Embodiment Four of the present disclosure.

[0022] Figure 5 is a sequence alignment map of the third pair of primers provided in Embodiment Five of the present disclosure. DETAILED DESCRIPTION

[0023] In order to make the objectives, technical solutions and advantages of the present disclosure clearer, the present disclosure will be further described in detail below.

[0024] Embodiment One

[0025] The present embodiment provides a molecular marker primer set for identifying Macadamia integrifolia cultivar Guire 1, which is composed of five pairs of primers, each pair of primers consisting of an upstream primer and a downstream primer. The upstream primer of the first pair of primers is shown in SEQ ID NO: 1 in the sequence listing, specifically: GCTCAGCTTCAACAATCTCAATGTA, and the downstream primer of the first pair of primers is shown in SEQ ID NO: 2 in the sequence listing, specifically: TCAAGGAGACTCATGTGGAAGAATT. The upstream primer of the second pair of primers is shown in SEQ ID NO: 3 in the sequence listing, specifically: CCAGAGAAATGGGCTTTGAATCTTT, and the downstream primer of the second pair of primers is shown in SEQ ID NO: 4 in the sequence listing, specifically: ATATAGATGCCACCCAAGACGGATT. The upstream primer of the third pair of primers is shown in SEQ ID NO: 5 in the sequence listing, specifically: GGGTACTCATTTTTGTAATTGGCCT, and the downstream primer of the third pair of primers is shown in SEQ ID NO: 6 in the sequence listing, specifically: CGGTATGGAGACTGACCAAGATAG. The upstream primer of the fourth pair of primers is shown in SEQ ID NO: 7 in the sequence listing, specifically: AGATTTGCTAAGTTCAAGCTTACCA, and the downstream primer of the fourth pair of primers is shown in SEQ ID NO: 8 in the sequence listing, specifically: CATGTATTCGGTCACAGTCAGTTTT. The upstream primer of the fifth pair of primers is shown in SEQ ID NO: 9 in the sequence listing, specifically: GAATTCAATTCAATATGGTCCACCA, and the downstream primer of the fifth pair of primers is shown in SEQ ID NO: 10 in the sequence listing, specifically: AGACTCTTTCAGGTGTTTCTTCTCT. The relevant information of the five pairs of primers is shown in Table 1.

[0026] Table 1 is the relevant information of the five pairs of primers

[0027] Primer pair Chromosome Start End First primer pair GWHBAUK00000003_1 48295618 48295841 Second primer pair GWHBAUK00000004_1 1065077 1065350 Third primer pair GWHBAUK00000006_1 17964840 17965082 Fourth primer pair GWHBAUK00000008_1 32527470 32527682 Fifth primer pair GWHBAUK00000010_1 29182421 29182641

[0028] Embodiment Two

[0029] The present disclosure provides a kit for identifying Macadamia integrifolia cultivar Guire 1, which comprises the molecular marker primer set provided in Embodiment One.

[0030] Embodiment Three

[0031] The application of the molecular marker primer set for identifying the macadamia cultivar Guire No.1 provided in the embodiment one, the application comprising: using the molecular marker primer set provided in the embodiment one to identify the macadamia cultivar Guire No.1.

[0032] Further, the application further comprises: using the molecular marker primer set provided in the embodiment one to effectively distinguish the 29 macadamia cultivars 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No.1, Nanya No.3, Yunyan No.10, Yunyan No.4 and Yunyan No.9.

[0033] Specifically, 30 macadamia cultivars are used as the samples to be tested, and the cultivar names are shown in Table 2. The 30 samples to be tested are all from the Ministry of Agriculture Jinghong Macadamia Germplasm Resource Garden, which has perfect germplasm preservation conditions and standardized management measures, and all the macadamia cultivars involved in the embodiment are planted and preserved in the garden.

[0034] Table 2 shows the cultivar names of the 30 samples to be tested

[0035]

[0036]

[0037] The DNA of the above-mentioned 30 samples to be tested is extracted. In the implementation, the DNA of the samples to be tested is extracted by using a new plant genomic DNA extraction kit produced by Tiangen Biosciences (Beijing) Co., Ltd. The specific operation is performed according to the instructions of the new plant genomic DNA extraction kit.

[0038] The DNA of the 30 samples to be tested is amplified by using the molecular marker primer set provided in the embodiment one. Specifically, the amplification system comprises: 50 ng of DNA of the samples to be tested, 0.5 μL of 10 mM dNTP (deoxy-ribonucleoside triphosphate), 0.5 μL of each upstream primer, 0.5 μL of each downstream primer, 2.5 μL of Tap Buffer buffer, 0.2 μL of Taq enzyme, and ddH2O is added to make up the amplification system to 20 μL. The amplification program comprises: 95℃ for 3 min; (95℃ for 30 sec, 60℃ for 30 sec) x 30 cycles; 72℃ for 6 min.

[0039] After amplification, the amplification products are obtained. The amplification products are then subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data are then aligned to the macadamia nut reference genome (version number GWHBAUK00000000.1) using Bowtie2 software to obtain the sequencing results for each sample to be tested.

[0040] Based on the upstream and downstream primer sequences of the molecular marker primer pairs, e-PCR was performed using the TBtools software to verify that all five primer pairs were for specific amplification.

[0041] Based on the upstream and downstream primer sequences of the molecular marker primer pairs and the relevant information in Table 1, the target sequences of the five primer pairs on the reference genome were extracted using the TBtools software and denoted by the numbers 01, 02, 03, 04 and 05, respectively.

[0042] The sequencing results were analyzed using Microsoft Office Excel software. The first primer pair contained nine different sequence types. These nine sequence types were named a1, b1, c1, d1, e1, f1, g1, h1, and i1, as shown in SEQ ID NO:11 to SEQ ID NO:19 in the sequence listing.

[0043] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 1 As shown, in Figure 1 In the sequence, the number 01 represents the target sequence of the first pair of primers on the reference genome, specifically: GCTCAGCTTCAACAATCTCAATGTATCCATGGGATCATCCACATGAACGCCTTTAACCATTGTGTTCTTGACCTCCACAATTTCAATTTCAAGCTCCTTAAGATCTTCCTCTTGGCTGTTCACAGTCATCACAATAGTTGTAGTGTCAAGTTCCTCAGTCACAACCCTATTGTCCATTGTGGCAACCTTGTTGCTTTCGAATTCTTCCACATGAGTCTCCTTGA (as shown in SEQ ID NO:15 in the sequence listing), where sequence e1 is the same as the target sequence 01 on the reference genome, and the remaining sequences are different.

[0044] The second primer pair has a total of 13 different sequence types, which are named a2, b2, c2, d2, e2, f2, g2, h2, i2, j2, k2, l2 and m2, as shown in SEQ ID NO:20 to SEQ ID NO:32 in the sequence listing.

[0045] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 2 As shown, the number 02 represents the target sequence of the second pair of primers on the reference genome, specifically: CCAGAGAAATGGGCTTTGAATCTTTTTATTTACTATACGTTTGAGAGGTTTAAGGCCTCTTTCCATGAGATGGGGATCGTACATGTACACCAAGAAGCCACAGGCGCTGGTCGCCCAGAACAGTACTTCACGGGTTCCAATTTCATCCAGAAATGCCTTGGGCTGTGTGTGATCGCCTTGGGCTCCATGGCCGAGCATTTCTGGCCATTGGATACCTGCCAGATGCCCTGCTGCACCACATATGAATTCAATCCGTCTTGGGTGGCATCTATAT (as shown in SEQ ID NO:31 in the sequence listing), where sequence l2 is the same as the target sequence 02 on the reference genome, and the rest of the sequences are different.

[0046] The third primer pair has 13 different sequence types, which are named a3, b3, c3, d3, e3, f3, g3, h3, i3, j3, k3, l3 and m3, as shown in SEQ ID NO:33 to SEQ ID NO:45 in the sequence listing.

[0047] Sequence alignment was performed using the software DNAMAN. The sequence alignment results are as follows: Figure 3 As shown, number 03 represents the target sequence of the third pair of primers on the reference genome, specifically: GGGTACTCATTTTTGTAATTGGCCTTTTGAGGCCTTAATGAAAAAGTATGGGATCACCTATAAGTTGTCTACCCCTTATCACCCCCAAACTAGTGGCCAAGTGAAGATATCTAATAGGCATATCAAACAAATCTTGAAGAAAACTGTAAATCCCAATCGTAATGATTGGTCACTTAGGCTTATTGATGCATTATGGGCCCATCAGATTGCATTCAAGACCTATCTTGGTCAGTCTCCATACCG (as shown in SEQ ID NO:67 in the sequence listing). All 13 sequences are different from the target sequence 03 on the reference genome.

[0048] The fourth pair of primers has 12 different sequence types, which are named a4, b4, c4, d4, e4, f4, g4, h4, i4, j4, k4 and l4 respectively, and are specifically shown in SEQ ID NO: 46-SEQ ID NO: 57 in the Sequence Listing.

[0049] The sequence alignment is performed by using the software DNAMAN, and the sequence alignment result is shown in Table 4, wherein the number 01 represents the target sequence of the first pair of primers on the reference genome, and specifically is: GAATTCAATTCAATATGGTCCACCACATCCGGAGCCTTCCAACCAATGCAATGCAATCTCTACTCTAAGAAGTGGACACGCGTATCTAAAGGATTGTCCACCCTTGCCAAATTTTGAATCTCAAGGAGACCATCCCATTGAGGTGAGTGATTCAATTCCTCCATTTCAAGGTTCATTTGAGGAACCTTGAACTATTAGAGAAGAAACACCTGAAAGAGTCT (as shown in SEQ ID NO: 66 in the Sequence Listing), wherein the sequence i5 is the same as the target sequence 05 on the reference genome, and the other sequences are different. Figure 4

[0050] The fifth pair of primers has 9 different sequence types. The 9 different sequence types are named a5, b5, c5, d5, e5, f5, g5, h5 and i5 respectively, and are specifically shown in SEQ ID NO: 58-SEQ ID NO: 66 in the Sequence Listing.

[0051] The sequence alignment is performed by using the software DNAMAN, and the sequence alignment result is shown in Table 5, wherein in Table 5, the number 01 represents the target sequence of the first pair of primers on the reference genome, and specifically is: GAATTCAATTCAATATGGTCCACCACATCCGGAGCCTTCCAACCAATGCAATGCAATCTCTACTCTAAGAAGTGGACACGCGTATCTAAAGGATTGTCCACCCTTGCCAAATTTTGAATCTCAAGGAGACCATCCCATTGAGGTGAGTGATTCAATTCCTCCATTTCAAGGTTCATTTGAGGAACCTTGAACTATTAGAGAAGAAACACCTGAAAGAGTCT (as shown in SEQ ID NO: 66 in the Sequence Listing), wherein the sequence i5 is the same as the target sequence 05 on the reference genome, and the other sequences are different. Figure 5 Figure 5

[0052] ​​​The specific genotypes of the 30 samples to be tested are shown in Table 3. In order to improve the efficiency of variety identification, the same genotype of the same pair of primers is not listed, i.e. the repeated values in the same column of Table 3 are deleted and only shown in the form of spaces. The only genotype amplified by the same pair of primers, i.e. the only value without space in the same column of Table 3, is regarded as the specific genotype.

[0053] Table 3: Specific genotypes of the 30 samples to be tested

[0054]

[0055] As can be seen from Table 3, each of the 30 samples has at least one specific genotype, indicating that the molecular marker primer set provided in Example 1 can distinguish the 30 samples to be tested.

[0056] Specifically, as for sample No. 23, variety Guang 11, there is only one specific genotype, i.e. one specific genotype a5f5 of the fifth pair of primers, and the specific genotype of the fifth pair of primers of sample No. 24, variety Guire No. 1, is a5h5, which is different from f5, indicating that the fifth pair of primers can distinguish variety Guang 11 from variety Guire No. 1.

[0057] For example, as for sample No. 24, variety Guire No. 1, the specific genotype of the first pair of primers of sample No. 24 is different from that of sample Nos. 1, 3, 5, 6, 8, 10, 12, 14, 17, 19, 25, 27 and 30, indicating that the first pair of primers can distinguish sample No. 24, variety Guire No. 1, from sample Nos. 1, 3, 5, 6, 8, 10, 12, 14, 17, 19, 25, 27 and 30.

[0058] Guire No. 1 has five specific genotypes, and the specific genotype combination thereof is b1e1+c2d2+d3i3+i4k4+a5h5, so that accurate identification of Guire No. 1 can be realized. According to the different specific genotypes and combinations, the other 29 varieties of Macadamia, i.e. 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No. 1, Nanya No. 3, Yunyan No. 10, Yunyan No. 4 and Yunyan No. 9, can be effectively distinguished.

[0059] Accuracy analysis of the molecular marker primer set

[0060] Two reproducible experiments are used for accuracy analysis. In this embodiment, two independent experiments are carried out by different persons, different batches of reagents and different laboratories, so as to simulate the identification of different batches of Macadamia. High reproducibility means that the identification results of different laboratories can be accurately compared with each other. Accuracy analysis of the molecular marker primer set

[0061] Reproducibility experiments were performed with 30 test samples, and each result was analyzed, and specific genotypes and combinations were recorded, as shown in Table 4.

[0062] Table 4 shows the results of two repeated experiments

[0063]

[0064]

[0065] As shown in Table 4, the specific genotypes and combinations of the two repeated experiments are the same. Therefore, the accuracy of the molecular marker primer set provided by the present application is 100%.

[0066] The variety identification conclusions of the third embodiment of the present application have high consistency between different laboratories or different batches in the same laboratory, so that parallel experiments are not necessary to reduce experimental errors, which greatly facilitates the identification of macadamia varieties.

[0067] The present application provides a molecular marker primer set for identifying macadamia variety Guire No. 1, a kit and application thereof. The test sample is amplified by using the molecular marker primer set, and the amplified product is sequenced, and the varieties are distinguished according to the sequencing results. There are differences in multiple bases between different varieties, including substitution, insertion, deletion and repetition, etc. Through these differences, the macadamia variety Guire No. 1 can be accurately identified. At the same time, the differences can be used to effectively distinguish Guire No. 1 and other 29 macadamia cultivars 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No. 1, Nanya No. 3, Yunyan No. 10, Yunyan No. 4 and Yunyan No. 9, and the identification results are not affected by the environment and other human factors.

[0068] The present application amplifies the target sequence by using a high polymorphic molecular marker primer set, and compares the base differences between different varieties, so as to realize efficient macadamia variety identification, and the reproducibility experiment further verifies the accuracy and reliability of the technology.

[0069] The above only describes optional embodiments of the present disclosure, and does not limit the present disclosure. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present disclosure shall be included in the protection scope of the present disclosure.

Claims

1. A molecular marker primer set for identifying macadamia cultivar Kaitera 1, characterized by, The molecular marker primer set consists of five pairs of primers, each pair consisting of an upstream primer and a downstream primer, the upstream primer of the first pair being as set forth in SEQ ID NO: 1 of the Sequence Listing, the downstream primer of the first pair being as set forth in SEQ ID NO: 2 of the Sequence Listing, the upstream primer of the second pair being as set forth in SEQ ID NO: 3 of the Sequence Listing, the downstream primer of the second pair being as set forth in SEQ ID NO: 4 of the Sequence Listing, the upstream primer of the third pair being as set forth in SEQ ID NO: 5 of the Sequence Listing, the downstream primer of the third pair being as set forth in SEQ ID NO: 6 of the Sequence Listing, the upstream primer of the fourth pair being as set forth in SEQ ID NO: 7 of the Sequence Listing, the downstream primer of the fourth pair being as set forth in SEQ ID NO: 8 of the Sequence Listing, the upstream primer of the fifth pair being as set forth in SEQ ID NO: 9 of the Sequence Listing, and the downstream primer of the fifth pair being as set forth in SEQ ID NO: 10 of the Sequence Listing.

2. A kit for identifying the macadamia cultivar Girethind 1, characterized in that, The kit comprises the molecular marker primer set of claim 1.

3. Use of a molecular marker primer set for identifying macadamia cultivar Kaitera 1, characterized in that, The application comprises amplifying the sample to be tested using the molecular marker primer set of claim 1 to obtain an amplification product. The amplification product is subjected to second-generation high-throughput sequencing to obtain sequencing data. The sequencing data is aligned to the Macadamia integrifolia reference genome to obtain sequencing results of the sample to be tested. The sequencing results are analyzed to obtain different sequence types. When the obtained sequence type is as set forth in SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 36, SEQ ID NO: 41, SEQ ID NO: 54, SEQ ID NO: 56, SEQ ID NO: 58, and SEQ ID NO: 65 of the Sequence Listing, the sample to be tested is identified as Macadamia integrifolia cultivar Guire No.

1.

4. Use according to claim 3, characterized in that, The application further comprises using the molecular marker primer set to distinguish Macadamia integrifolia cultivars 344, 508, 695, 762, 788, 791, 792, 800, 816, 842, 863, 900, 951, A16, A4, D, D4, H2, JW, O.C, O.V, S, Guang 11, Nanya 116, Nanya No. 1, Nanya No. 3, Yunyan No. 10, Yunyan No. 4, and Yunyan No. 9.

Images