A kasp molecular marker related to drought resistance of sorghum, primer and application thereof

By developing KASP molecular markers and their primer sets related to drought resistance in sorghum, and utilizing PCR amplification and fluorescence detection, the problem of early, accurate, and high-throughput identification and screening of drought resistance traits in sorghum breeding was solved, thereby improving breeding efficiency and accuracy.

CN120905436BActive Publication Date: 2026-04-17LIAONING ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511345846.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-19
Publication Date
2026-04-17
Estimated Expiration
2045-09-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve early, accurate, and high-throughput identification and screening of drought-resistant traits in sorghum breeding. Traditional breeding methods are inefficient and have poor stability.

Method used

To develop a KASP molecular marker and its primer set related to drought resistance in sorghum, and to rapidly identify drought resistance traits in sorghum through PCR amplification and fluorescence detection, the high-throughput and low-cost characteristics of KASP molecular markers are utilized, combined with specific primers to identify different alleles for genotyping analysis.

Benefits of technology

It enables early, efficient, and low-cost auxiliary identification of drought-resistant traits in sorghum, significantly improving breeding efficiency, shortening the breeding cycle, and is suitable for genotyping of large-scale populations and screening of core germplasm.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905436B_ABST
    Figure CN120905436B_ABST
Patent Text Reader

Abstract

This invention belongs to the field of sorghum molecular breeding technology, specifically relating to a KASP molecular marker, primers, and applications related to drought resistance in sorghum. The base sequence of the KASP molecular marker is shown in SEQ ID NO.1. A T / C single nucleotide polymorphism exists at position 150 of this sequence. The KASP molecular marker provided by this invention can be used for the molecular identification of drought resistance traits in sorghum. Fluorescence signal readings are performed using a KASP genotyping detection system. If the sample has a strong FAM fluorescence signal, the corresponding genotype is C / C, indicating a drought-resistant germplasm; if the HEX fluorescence signal is strong, the corresponding genotype is G / G, indicating a drought-sensitive germplasm.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of sorghum molecular breeding technology, specifically relating to a KASP molecular marker, primers, and applications related to drought resistance in sorghum. Background Technology

[0002] sorghum ( Sorghum bicolor Sorghum (L.) is a typical C4 plant with high photosynthetic efficiency, water use efficiency, and adaptability to stress. It is an important food, feed, and energy crop in arid and semi-arid regions of my country. Globally, drought stress has become one of the leading abiotic factors limiting sorghum yield and quality, especially in the Loess Plateau and Northwest Inland regions of my country and parts of Africa, where frequent droughts seriously threaten crop safety.

[0003] Plant response to drought is a complex process involving multiple genes and pathways, encompassing mechanisms such as osmotic regulation, stomatal regulation, root architecture alteration, and activation of antioxidant systems. Although traditional breeding has yielded a number of drought-resistant varieties through field screening, the highly uncertain nature of drought occurrence and significant environmental variations result in low efficiency and poor stability in phenotypic assessment. Therefore, there is an urgent need to utilize molecular marker-assisted breeding technology to achieve early, precise, and high-throughput identification and screening of drought-resistant traits.

[0004] In recent years, with the deepening of whole-genome sequencing and population genetic analysis of sorghum, single nucleotide polymorphisms (SNPs), as the richest and most stable genetic marker resource, have been widely used for QTL mapping and functional gene mining of stress tolerance traits. KASP molecular markers developed based on SNPs have shown great application potential in crop stress tolerance breeding due to their high throughput, low cost, and ease of operation. KASP technology identifies different alleles through specific primers and, combined with a fluorescence detection system, enables rapid and efficient genotyping analysis of target SNP loci. Compared with traditional markers such as SSRs and InDels, KASP technology is simple to operate, highly sensitive, and has good reproducibility, making it widely applicable to genotyping and core germplasm screening in large-scale populations, significantly improving breeding efficiency and shortening the breeding cycle. Therefore, developing a functional KASP marker closely related to drought tolerance traits in sorghum provides a key tool for molecular-assisted selection of drought-tolerant germplasm, improves the adaptability and yield of sorghum in arid regions, and promotes the sustainable development of dryland agriculture. Summary of the Invention

[0005] The purpose of this invention is to provide a KASP molecular marker related to drought resistance in sorghum. This marker can be used for early, efficient, and low-cost auxiliary identification and screening of drought resistance traits in sorghum, significantly improving breeding efficiency.

[0006] The technical solution adopted in this invention is:

[0007] This invention provides a KASP molecular marker related to drought resistance in sorghum, the base sequence of which is shown in SEQ ID NO.1.

[0008] A second aspect of the present invention provides a primer set for amplifying the KASP molecular marker, the primer set comprising forward primer F1, forward primer F2 and universal reverse primer R;

[0009] The sequence of the forward primer F1 is shown in SEQ ID NO.3;

[0010] The sequence of the forward primer F2 is shown in SEQ ID NO.4;

[0011] Preferably, the 5' end of the forward primer F1 is linked to 6-carboxyfluorescein;

[0012] The 5' end of the forward primer F2 is connected to 6-carboxy-2',4',5',7'-tetrachlorofluorescein.

[0013] A third aspect of the present invention provides a KASP molecular marker detection kit, wherein the KASP molecular marker detection kit comprises the aforementioned primer set.

[0014] A fourth aspect of the present invention provides a method for identifying drought-resistant sorghum varieties, the method comprising the following steps:

[0015] (1) Extract genomic DNA from the sorghum stalks to be tested;

[0016] (2) Using genomic DNA of sorghum as a template, PCR amplification was performed using the primer set and / or the KASP molecular marker detection kit to obtain the amplification product;

[0017] (3) Detect the fluorescence signal of the amplification product. When the fluorescence signal is 6-carboxyfluorescein, the sorghum to be tested is a drought-resistant variety; when the fluorescence signal is 6-carboxy-2',4',5',7'-tetrachlorofluorescein, the sorghum to be tested is a drought-sensitive variety.

[0018] Preferably, the reaction system used for PCR amplification is as follows:

[0019] 10 μL of 2×KASP Master Mix, 5 μL of genomic DNA at 50 ng / μL, 0.2 μL of 10 μM forward primer F1, 0.2 μL of 10 μM forward primer F2, 0.6 μL of 10 μM universal reverse primer, and ddH2O to bring the total volume to 20 μL.

[0020] Preferably, the reaction procedure for PCR amplification is as follows:

[0021] Pre-denaturation at 95℃ for 10 min, one cycle;

[0022] Denaturation at 95℃ for 15 seconds, annealing and extension at 62℃ for 1 minute, 10 cycles;

[0023] Denaturation at 95℃ for 15 seconds, annealing extension at 57℃ for 1 minute, 32 cycles.

[0024] Preferably, the genomic DNA of the sorghum to be tested is derived from the leaves of the sorghum.

[0025] The fifth aspect of the present invention provides an application of the KASP molecular marker, the primer set, or the KASP molecular marker detection kit, wherein the application refers to its application in the screening and / or molecular identification of drought-resistant sorghum varieties.

[0026] Compared with the prior art, the beneficial effects of the present invention are:

[0027] This invention provides a KASP molecular marker associated with drought resistance in sorghum, the base sequence of which is shown in SEQ ID NO.1. The molecular marker of this invention is closely related to the drought resistance trait of sorghum. In practical applications, simply using the KASP primer set developed in this invention to perform PCR amplification on the leaf DNA of drought-resistant germplasm and detecting its fluorescence signal can achieve early auxiliary prediction and molecular identification of the drought resistance phenotype of sorghum. This method is simple to operate, economical, practical, and has high screening efficiency, enabling rapid identification of potentially high-quality drought-resistant individual plants or a large number of progeny, thereby effectively shortening the sorghum breeding cycle and improving the efficiency and accuracy of drought-resistant breeding.

[0028] Furthermore, compared with traditional molecular marker technologies such as SSR and InDel, the KASP molecular marker method provided by this invention only requires PCR amplification and fluorescence typing, without the need for complex steps such as subsequent sequencing, silver staining, or band reading. It has significant advantages such as simple operation, rapid detection, and low cost, and is especially suitable for high-throughput breeding screening and large-scale identification of field materials. Attached Figure Description

[0029] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0030] Figure 1 Phenotypes of parents LNR-6 and 2381 under drought conditions: a is the single-plant phenotype of LNR-6; b is the field phenotype of LNR-6; c is the single-plant phenotype of 2381; d is the field phenotype of 2381.

[0031] Figure 2 QTL mapping for the F6 population of LNR-6 / 2381.

[0032] Figure 3 The image shows the KASP genotyping diagram of the F6 population of LNR-6 / 2381. a) shows the genotyping diagram of the KASP molecular marker DR1.1 in 48 sorghum plants; b) compares the DI values ​​of plants with different genotypes under drought treatment. Detailed Implementation

[0033] The present invention will be further illustrated below with specific embodiments, but these embodiments do not limit the scope of the invention. Modifications or substitutions to the details and form of the technical solutions of the present invention may be made without departing from the spirit and scope of the invention, but all such modifications or substitutions fall within the protection scope of the present invention.

[0034] To enable those skilled in the art to better understand and implement the technical solutions of this invention, the invention will be further described below with reference to specific embodiments. In the description of this invention, unless otherwise specified, all reagents used are commercially available, and all methods used are conventional techniques in the art.

[0035] The list of abbreviations for this invention is shown in Table 1.

[0036] Table 1. List of abbreviations for this invention

[0037]

[0038] Example 1

[0039] A KASP molecular marker and primers related to drought resistance in sorghum, and their applications, are detailed below:

[0040] 1. Evaluation method for drought resistance of sorghum.

[0041] This invention evaluates the drought resistance of sorghum through field trials conducted in a film-covered greenhouse to effectively isolate the uniformity of water treatment caused by natural rainfall. Two treatment conditions were set up: normal irrigation and drought stress, with yield difference as the primary evaluation indicator. Drip irrigation was used for water management in the experiment.

[0042] Normal irrigation began with drip irrigation on May 10th, followed by drip irrigation every 10 days, with each irrigation consisting of 900m³ of water. 3 / hm 2 The total irrigation volume during the entire growing season was 4500m³. 3 / hm 2 During the drought stress treatment, no regular irrigation was carried out until the soil moisture content in the field dropped below 30%. This water stress state was maintained for another 14 days before re-irrigation. The total irrigation volume for this treatment during the entire growth period was 3780 m³.3 / hm 2 After crop maturity and harvest, yield data for each variety under two water treatment conditions were collected, and drought resistance was evaluated using the drought resistance index proposed by Lan Jusheng. The calculation formula is as follows:

[0043] .

[0044] in: DI i This represents the drought resistance index of the i-th material; Y di This represents the yield of the i-th material under drought stress conditions; Y ci This represents the yield of the i-th material under normal irrigation conditions; This represents the average yield of all tested materials under drought treatment.

[0045] This method comprehensively considers the absolute yield performance of materials under drought stress and their stability under control conditions, and can objectively reflect the drought resistance level of materials. It is suitable for high-throughput drought resistance identification and screening of superior drought-resistant germplasm.

[0046] 2. Location of QTLs and determination of molecular markers.

[0047] 2.1 Group building.

[0048] Based on the above evaluation criteria for sorghum drought resistance, drought-resistant germplasm resource LNR-6 and drought-sensitive germplasm resource 2381 were selected from existing resources. (See attached text.) Figure 1 Meanwhile, starting in 2021, RIL populations for both species were constructed through emasculated hybridization. Table 2 shows the process of obtaining the family pedigree.

[0049] Table 2. Process of family pedigree acquisition

[0050]

[0051] 2.2 Field trials and phenotypic statistics.

[0052] The F6 group was planted at the Shenyang experimental base in May 2024. The specific planting method was the same as described above, and the phenotypic identification method was the same as described above for evaluating the drought resistance of sorghum.

[0053] 2.3. The positioning of QTL.

[0054] Based on the aforementioned sorghum drought resistance evaluation system, this invention screened 30 drought-resistant and 30 drought-resistant plants with extreme phenotypes, constructing drought-tolerant and drought-intolerant mixed pools respectively, and performing whole-genome resequencing analysis using both parental materials. Sequencing was performed on the Illumina platform, and after strict quality control, a total of 68.08 Gb of high-quality clean data was obtained. The sequencing data were aligned to the sorghum reference genome BTx623-T2T Genome v1.0 using the Burrows-Wheeler Aligner. The results showed that the sequencing depth of both parents was approximately 10×, the average coverage depth of the mixed pool samples was approximately 30×, and the 1× genome coverage of all samples exceeded 90% (see Table 3).

[0055] Subsequent variant detection was performed using the Genome Analysis Toolkit, and SNPs were screened based on the following parameters: QD < 2.0, MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, and ReadPosRankSum < -8.0. A total of 2,116,830 single nucleotide polymorphism sites and 206,941 insertion / deletion variants were identified.

[0056] By calculating the SNP-index and InDel-index of offspring mixed pools among parents, Δ(SNP-index) and Δ(InDel-index) distribution maps were further constructed, and the Gprime analysis function was used to detect significant regions based on the nonparametric weighted G′ statistic. The results located the key QTL interval controlling drought resistance in sorghum to the 64.56Mb~67.25Mb segment of chromosome 5, and named it... Drought Resisting1 Abbreviated as DR1 ,See Figure 2 .

[0057] Table 3. Positioning of QTL

[0058]

[0059] 2.4 Development of tags.

[0060] according to DR1 The physical location information of the locus was obtained, and VCF variation data of the region corresponding to Chr05:66157724 on chromosome 5 were extracted. It was found that this locus has SNP differences between the two parental materials and has clear allele differentiation characteristics, making it suitable for molecular marker development. Based on this variation locus, a KASP marker was designed and named DR1.1.

[0061] The nucleotide sequence corresponding to marker DR1.1 is shown in SEQ ID NO.1 and SEQ ID NO.2, where the bolded portion at 150bp in SEQ ID NO.1 and SEQ ID NO.2 is a C / G base polymorphism site. The sequence is as follows:

[0062] SEQ ID NO.1:

[0063] CCCTTGCACCCATAGTAGAAGGCGGTCAACGCACAGTCTTGGAACAACTCCACGGCGGCCATCTGGACGGCGTACAAGACTCCCAGGAGCAGAGCCCCCGACGCCATGTCGCTACGGGCGCATATCTTGGCCTGCCAGTAAATCGGCCTC AATATGGCGGCGAGCACGCTCATCACGGAAACAAAGAGCATGGCACGCCTCCGCCTGCCCTTCACCAGCTGCCACGCCCGCCTGACTGCTGCACCAGCGCCATGGCGGTGCCTAGCTGCAGCTGCAGATTCATCCAGGGCCACGATGACG.

[0064] SEQ ID NO.2:

[0065] CCCTTGCACCCATAGTAGAAGGCGGTCAACGCACAGTCTTGGAACAACTCCACGGCGGCCATCTGGACGGCGTACAAGACTCCCAGGAGCAGAGCCCCCGACGCCATGTCGCTACGGGCGCATATCTTGGCCTGCCAGTAAATCGGCCTG AATATGGCGGCGAGCACGCTCATCACGGAAACAAAGAGCATGGCACGCCTCCGCCTGCCCTTCACCAGCTGCCACGCCCGCCTGACTGCTGCACCAGCGCCATGGCGGTGCCTAGCTGCAGCTGCAGATTCATCCAGGGCCACGATGACG.

[0066] Among them, when the genotype is CC, the sorghum is a drought-resistant variety; when the genotype is GG, the sorghum is a drought-sensitive variety.

[0067] 3. Design of molecular marker primer sets.

[0068] The molecular marker primer set consists of forward primer F1, forward primer F2, and universal reverse primer R. The nucleotide sequence of forward primer F1 is shown in SEQ ID NO.3; the nucleotide sequence of forward primer F2 is shown in SEQ ID NO.4; and the nucleotide sequence of universal reverse primer R is shown in SEQ ID NO.5. Detailed sequences are shown in Table 4 below.

[0069] Table 4 Design of Molecular Marker Primers

[0070]

[0071] Note: In Table 3, the lowercase parts are the connector sequences FAM and HEX.

[0072] 4. Correlation analysis between KASP fluorescent gene typing and drought resistance phenotype in sorghum.

[0073] 4.1 To verify the association between the developed KASP marker and drought resistance in sorghum, 48 individual plant samples were randomly selected. Leaf samples approximately 1 cm in length and width were collected during the seedling stage and placed in 2 mL 96-well deep-well plates for freeze-drying. Steel balls were then added, and the mixture was thoroughly ground into powder at 50 Hz.

[0074] 4.2 Genomic DNA was extracted from the samples using a modified CTAB method.

[0075] 4.3. Allele-specific PCR amplification was performed using a set of KASP molecular marker primers designed for the DR1.1 site. The PCR reaction system is shown in Table 5, and the PCR procedure is shown in Table 6.

[0076] Table 5 PCR reaction system

[0077]

[0078] Table 6 PCR Reaction Procedure

[0079]

[0080] 4.4 The amplified products were read for fluorescence signals by the KASP genotyping detection system. Cluster analysis was performed based on the FAM and HEX fluorescence intensity distributions to determine the genotype. Figure 3 The results showed that 22 of the materials exhibited HEX fluorescence signals, with a genotype of G / G; and 26 materials exhibited FAM fluorescence, with a genotype of C / C.

[0081] Further one-way ANOVA showed that the drought resistance index of the C / C genotype was significantly higher than that of the G / G genotype. Figure 3The result of b indicates that materials carrying the C allele exhibit stronger drought resistance. Therefore, this KASP marker DR1.1 demonstrates good predictive ability for drought resistance phenotypes in sorghum, showing its potential application in molecular-assisted selection breeding.

[0082] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0083] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.

Claims

1. The application of a primer set marked with KASP molecules in detecting drought resistance in sorghum, characterized in that, The primer set includes forward primer F1, forward primer F2, and universal reverse primer R; The sequence of forward primer F1 is shown in SEQ ID NO.3; the sequence of forward primer F2 is shown in SEQ ID NO.4; and the sequence of universal reverse primer R is shown in SEQ ID NO.

5. The base sequence of the KASP molecular marker is shown in SEQ ID NO.1 and SEQ ID NO.2, and the base at the 150bp position is C or G; The application targets a sorghum population that is a recombinant inbred line population with sorghum LNR-6 and sorghum 2381 as parents.

2. The application as described in claim 1, characterized in that, The 5' end of forward primer F1 is linked to 6-carboxyfluorescein; the 5' end of forward primer F2 is linked to 6-carboxy-2',4',5',7'-tetrachlorofluorescein.

3. The application as described in claim 2, characterized in that, The method for testing the drought resistance of sorghum includes the following steps: (1) Extract genomic DNA from the sorghum stalks to be tested; (2) Using genomic DNA of sorghum as a template, PCR amplification was performed using the primer set described above to obtain the amplification product; (3) Detect the fluorescence signal of the amplification product. When the fluorescence signal is 6-carboxyfluorescein, the sorghum to be tested is drought-resistant; when the fluorescence signal is 6-carboxy-2',4',5',7'-tetrachlorofluorescein, the sorghum to be tested is drought-sensitive.

4. The application as described in claim 3, characterized in that, The reaction system used for PCR amplification is as follows: 10 μL of 2×KASP Master Mix, 5 μL of genomic DNA at 50 ng / μL, 0.2 μL of 10 μM forward primer F1, 0.2 μL of 10 μM forward primer F2, 0.6 μL of 10 μM universal reverse primer R, and ddH2O to bring the total volume to 20 μL.

5. The application as described in claim 3, characterized in that, The reaction procedure for PCR amplification is as follows: Pre-denaturation at 95℃ for 10 min, one cycle; Denaturation at 95℃ for 15 seconds, annealing and extension at 62℃ for 1 minute, 10 cycles; Denaturation at 95℃ for 15 seconds, annealing extension at 57℃ for 1 minute, 32 cycles.

6. The application as described in claim 3, characterized in that, The genomic DNA of the sorghum being tested was derived from sorghum leaves.