High-polysaccharide pumpkin identification primer pair as well as identification method and application thereof

By designing specific primer pairs Primer1 and Primer2, and combining PCR amplification and electrophoresis detection, the problem of tedious and time-consuming traditional screening of high-polysaccharide pumpkins was solved, achieving rapid and accurate identification of high-polysaccharide pumpkins and improving breeding efficiency.

CN120905437APending Publication Date: 2025-11-07NINGBO ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511442267.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-10
Publication Date
2025-11-07

AI Technical Summary

Technical Problem

Traditional methods for screening high-polysaccharide pumpkins are cumbersome, requiring 2-3 months and consuming significant manpower and resources. There is a lack of rapid and accurate molecular marker screening methods.

Method used

Specific primer pairs Primer1 and Primer2 were designed to rapidly identify high-polysaccharide pumpkins via PCR amplification and electrophoresis. Total genomic DNA was extracted from pumpkins using the CTAB method, and PCR amplification was performed using the specific primer pairs. Pumpkins were identified by detecting specific bands of 327 bp and 628 bp via electrophoresis.

Benefits of technology

It enables accurate identification of high-polysaccharide pumpkins at any stage of seed, seedling, and plant growth, saving time and resources, providing reliable results unaffected by the environment, and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120905437A_ABST
    Figure CN120905437A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of plant molecular genetics, and particularly relates to a high-polysaccharide pumpkin identification primer pair and an identification method and application thereof. The invention discloses molecular markers Primer1 and Primer2 for identifying high-polysaccharide pumpkins, and provides two specific primer pairs with high polymorphism for identifying the high-polysaccharide pumpkins, and the nucleotide sequences of the two specific primer pairs are respectively shown as SEQ ID NO.3 to SEQ ID NO.6. The invention also provides a method for identifying the high-polysaccharide pumpkins. The method comprises the following steps: performing PCR amplification on DNA (deoxyribonucleic acid) of radicles, cotyledons, first new leaves or plant young leaves of pumpkin seeds through specific primers, performing agarose electrophoretic separation and EB dyeing, detecting polymorphism on an ultraviolet scenograph, and quickly identifying high-polysaccharide pumpkins according to differences of amplified products on marked polymorphic sites. The method has the advantages of accuracy, stability, low cost, simple operation and the like. Furthermore, the method can be used for pumpkin molecular marker-assisted breeding to improve the breeding efficiency and has a good application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant molecular genetics, and particularly relates to a high polysaccharide pumpkin identification primer pair, an identification method thereof and application thereof. BACKGROUND

[0002] Pumpkin polysaccharide has the effect of reducing blood sugar, which has attracted market attention. Because different pumpkin types and varieties have different polysaccharide contents, breeding high polysaccharide pumpkin varieties is the basis for further development and utilization of pumpkin polysaccharide.

[0003] Traditional high polysaccharide pumpkin screening needs to plant and harvest pumpkin fruits, determine the polysaccharide content by using the phenol sulfuric acid method, and then screen through comparison. From sowing to harvesting needs to wait for 2-3 months, and polysaccharide determination involves multiple links such as sampling, extraction, reaction, reaction termination, determination and calculation, and batch determination process is more complicated.

[0004] Using the molecular marker technology closely linked to phenotypic traits to screen target traits is simple to operate and has good repeatability, and has been applied in crop purity identification and trait screening breeding links, but there is no report on the rapid identification method of high polysaccharide pumpkin. Therefore, specific primers with high polymorphism need to be developed for high polysaccharide pumpkin identification to improve breeding efficiency. SUMMARY

[0005] The purpose of the application is to provide a high polysaccharide pumpkin identification primer pair and an identification method and application thereof. The method provided by the application can not only rapidly identify high polysaccharide pumpkin, but also has accurate, stable, low-cost and simple operation detection method.

[0006] In order to achieve the above purpose, the application provides the following technical scheme. The application provides a molecular marker for identifying high polysaccharide pumpkin, wherein the molecular marker is Primer 1 and Primer 2; the nucleotide sequence of the Primer 1 is shown in SEQ ID NO. 1; and the nucleotide sequence of the Primer 2 is shown in SEQ ID NO. 2.

[0007] The application further provides application of the above-mentioned molecular marker in identifying high polysaccharide pumpkin.

[0008] The application further provides a specific primer pair of a molecular marker for identifying high polysaccharide pumpkin, wherein the molecular marker is Primer 1 and Primer 2; the primer pair of the molecular marker Primer 1 is composed of a forward primer with a nucleotide sequence as shown in SEQ ID NO. 3 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 4; and the primer pair of the molecular marker Primer 2 is composed of a forward primer with a nucleotide sequence as shown in SEQ ID NO. 5 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO. 6.

[0009] The application further provides application of the specific primer pair to the high polysaccharide pumpkin.

[0010] The application further provides a kit for identifying high polysaccharide pumpkin, wherein the kit comprises the specific primer pair.

[0011] The application further provides application of the kit to the high polysaccharide pumpkin.

[0012] The application further provides a method for identifying high polysaccharide pumpkin, which specifically comprises the following steps. S1, DNA extraction: sampling seeds or leaves of a to-be-tested pumpkin sample, and extracting total genomic DNA of the pumpkin by using a CTAB method; S2, PCR amplification: using the DNA extracted in the step S2 as a template, mixing samples independently by using the specific primer pair as primers, and performing PCR amplification; S3, PCR product detection: performing electrophoresis detection on the PCR amplification product, and identifying whether the to-be-identified pumpkin is a high polysaccharide pumpkin.

[0013] Preferably, the to-be-tested pumpkin sample in the step S1 is selected from one or more of V1 honey heart, V2 orange long No. 42, V3 Jinli pumpkin and V4 new red chestnut pumpkin. The seeds of the to-be-tested pumpkin sample are selected from radicles or cotyledons; and the leaves of the to-be-tested pumpkin sample are selected from first new leaves or plant young leaf DNA.

[0014] Preferably, the reaction system of the PCR amplification in the step S2 comprises 2.5 mM of dNTP 1.5 μL, 1.5 μL of 10×buffer, 25 mM of MgCl2 1.8 μL, 1 μL (5 mM) of the forward primer and the reverse primer respectively, 10 ng / μL of DNA 5 μL, 1 U of Taq 0.05 μL, and ultra-pure water added to 15 μL. The reaction procedure of the PCR amplification is as follows: pre-denaturation at 94℃ for 1 min, denaturation at 93℃ for 1 min, annealing at 50℃ for 1 min, extension at 72℃ for 2 min, 40 cycles; and extension at 72℃ for 1 min.

[0015] Preferably, the identification in step S3 comprises using 2.5% gel agarose, adding 20 μL ethidium bromide for coloration; if the PCR amplification product simultaneously appears specific bands of 327 bp and 628 bp, the pumpkin sample to be identified is high-polymer pumpkin.

[0016] Advantages of the present application: The present application provides specific primers Primer 1 and Primer 2 with high polymorphism, which are used for PCR amplification of pumpkin materials, and can identify high-polymer content single plants and low-polymer content single plants according to the banding pattern.

[0017] Compared with the conventional screening of high-polymer pumpkin, the method provided by the present application can more accurately identify high-polymer pumpkin at any period of seed, seedling and plant, without waiting for the identification work after the result, and the result is reliable and not affected by the environment, saving manpower, material resources and land resources, and improving the identification efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0019] Figure 1 Figure 1 is a graph of the accumulation rule of different pumpkin pulp polysaccharides; Figure 2 Figure 2 is a PCA analysis graph of the gene expression patterns of 60 pumpkin samples; Figure 3 Figure 3 is a Venn graph of the differentially expressed genes of four kinds of pumpkin fruits across time periods; Figure 4 Figure 4 is a GO enrichment analysis graph of the differentially expressed genes of four kinds of pumpkin fruits across time periods; Figure 5 Figure 5 is the correlation of polysaccharides and gene modules; Figure 6 Figure 6 is a GO enrichment analysis graph of the significantly positively correlated modules and the significantly negatively correlated modules of polysaccharide content; Figure 7 Figure 7 is a correlation analysis graph of 6 candidate genes and the phenotype data of polysaccharide content; Figure 8After amplifying the pumpkin samples with specific primers, the agarose gel electrophoresis image (wherein M1: 50 bp ladder; M2: DL2000; 1-8 are the numbers of pumpkins). DETAILED DESCRIPTION

[0020] The present application provides a molecular marker for identifying high polysaccharide pumpkin, which is Primer1 and Primer1; the nucleotide sequence of Primer1 is as shown in SEQ ID NO. 1; and the nucleotide sequence of Primer2 is as shown in SEQ ID NO. 2.

[0021] Primer1: TTCGCTTTAACCATGGTGCAGTAATTGTAGATCATGTAGTTCTTTTGGACCCAGTTCATCTTTCCTTGGCTGTCGGAATCCAGTTCCTGAGAGAACCACGACTTGTGGTCGGAGGTCGGCGACGAATTCGACCCACAAGACGACTGTCCCGATGACCAAATGCAGGCGTTTTCATTGAAGTTTCTGTAAGATGCGGTGAACGGAGCCTGAGTCCAATCGGTCTTCACTAACCCACCTCGGGTTGCCCAATCATCGGCGTTCCAGAGACTGGATTGAAGCCTCATCGACTGATTTTTGGGGAATGCAACGCCAATCACCTCATGGTTA (SEQ ID NO. 1); Primer2: TTCCCCGTCTCAGGCGAAAAAATCAATTTGTATACAATTTTGGATGTAGAAATGAAATTAGTAATGTTGCTGAATCTAGAATGCGAATTGATCAGATTATCAAATGGATGGAGAGCTGGGGGAGGCCAGTGAAAGCCATAGGACCAACTCTTCCATCAGCCTACTTAGACAAAAGGTTAGAGGACGACAAGTACTATGGGCTGAGCCTGTTCGATCCAAACAAGGATGAGTGTCTAAAATGGCTAGACAACAAGCCCCCTGGCTCTGTTCTATATGTGTCTTATGGAAGTCTGGTTGTACTGGGAGAAGAACAGCTCAAGAACATGGCTCTTGGATTCAAGGAAAGTGGCAAATTCTTCTTGTGGGTTGTGAGGGAAACCGAATCTCAGAATCTTCCTCCCAATTTCATGGAGAGTGTTGGGGAGAAGGGTCTTATGGTCAGCTGGTGTTCCCAGCTCCAGGTCCTGGCACACCCAGCGGTCGGATGCTTCTTGACACACTGCGGCTGGAACTCGACACTCGAGGCACTATCCTTGGGCGTACCGGTGGTGGCTTTCCCACAGTGGGCTGATCAGGTGACTAATGCCAAGTTCTTAGAAGATGTCTGGAAGGTGGGAAAAAAGAGGGA (SEQ ID NO. 2).

[0022] The application designs a specific primer pair of a molecular marker for identifying high polysaccharide pumpkin according to the above-mentioned molecular marker, wherein the primer pair of the molecular marker Primer1 is composed of a forward primer with a nucleotide sequence shown in SEQ ID NO. 3 and a reverse primer with a nucleotide sequence shown in SEQ ID NO. 4; and the primer pair of the molecular marker Primer2 is composed of a forward primer with a nucleotide sequence shown in SEQ ID NO. 5 and a reverse primer with a nucleotide sequence shown in SEQ ID NO. 6.

[0023] The application further provides a method for identifying high polysaccharide pumpkin, specifically comprising the following steps: S1, DNA extraction: sampling seeds or leaves of the pumpkin sample to be tested (the seeds of the pumpkin sample to be tested are selected from one or more of V1 honey heart, V2 orange long 42, V3 Jinli pumpkin and V4 new red chestnut pumpkin, and the leaves of the pumpkin sample to be tested are selected from the first piece of new leaf or plant young leaf DNA); the total genomic DNA of the pumpkin is extracted by CTAB method; S2, PCR amplification: using the DNA extracted in step S2 as a template, the specific primer pair of claim 3 is mixed independently as a primer, and PCR amplification is carried out; the reaction system of PCR amplification includes: 1.5 μL of 2.5 mM dNTP, 1.5 μL of 10×buffer, 1.8 μL of 25 mM MgCl2, 1 μL (5 mM) of forward primer and reverse primer, 5 μL of 10 ng / μL DNA, 0.05 μL of 1 U Taq, and ultra-pure water added to 15 μL; the reaction program of the PCR amplification is as follows: pre-denaturation at 94℃ for 1 min, denaturation at 93℃ for 1 min, annealing at 50℃ for 1 min, extension at 72℃ for 2 min, 40 cycles; extension at 72℃ for 1 min.

[0024] S3, PCR product detection: electrophoresis detection is carried out on the PCR amplification product, and whether the pumpkin to be identified is a high polysaccharide pumpkin is identified. The identification includes using 2.5% high-resolution standard gel agarose, adding 20 ul bromide ethidium staining; if the PCR amplification product appears 327 bp and 628 bp specific bands at the same time, the pumpkin sample to be identified is a high polysaccharide pumpkin.

[0025] In one aspect, the application provides a kit for identifying a high polysaccharide pumpkin, characterized in that the kit comprises the specific primer pair described above.

[0026] In another aspect, the application also provides the application of the above-mentioned molecular marker in the auxiliary breeding of high polysaccharide pumpkins.

[0027] The application also provides the application of the above-mentioned kit in the identification of high polysaccharide pumpkins.

[0028] In order to further illustrate the application, the technical solutions provided by the application are described in detail below in combination with the drawings and examples, but they should not be understood as limiting the scope of protection of the application.

[0029] The production process, experimental method or detection method involved in the embodiments of the present application, if not specifically stated, are conventional methods in the prior art, and their names and / or abbreviations belong to conventional names in the art, which are very clear and explicit in the related application field. The skilled person in the art can understand the conventional process steps and apply the corresponding equipment according to the conventional conditions or the conditions recommended by the manufacturer.

[0030] The various instruments, equipment, raw materials or reagents used in the embodiments of the present application do not have special restrictions on the source, and are conventional products that can be purchased through normal commercial channels. They can also be prepared according to the conventional methods well known to those skilled in the art.

[0031] Example 1 Screening of high-polymer pumpkin-related genes (1) Changes in polysaccharide content of fruits of four pumpkin varieties at different development stages The polysaccharide content of fruits of four pumpkin varieties V1 Mi Mei Xin, V2 Orange Chang 42, V3 Jin Li Pumpkin and V4 Xin Hong Ban Li Pumpkin at 0 d, 20 d, 30 d, 40 d and 60 d different development stages increased with the increase of growth days. As shown in Table 1, the polysaccharide content of V1 Mi Mei Xin was significantly higher than that of the other three varieties, V2 Orange Chang 42 and V3 Jin Li Pumpkin were in the middle, and the polysaccharide content of V4 Xin Hong Ban Li Pumpkin was significantly lower than that of the other three varieties. Therefore, the pulp samples of four pumpkin varieties at different growth days were selected for RNA-seq differential expression analysis and WGCNA analysis, and candidate genes were selected. Figure 1

[0032] (2) Quality evaluation analysis of transcriptome data The correlation coefficient PCA of gene expression patterns of 60 pumpkin samples of 4 pumpkin varieties at 5 development stages and 3 biological replicates is shown in FIG. 2. Figure 2 PC1 explained 36.99% of the variation, and PC2 explained 13.08% of the variation. The two principal components explained about 50% of the variation, and the interpretation rate was high, indicating that there was obvious structure or pattern between the samples, which could be effectively explained by the two principal components. Specifically, the samples of the four varieties formed different clusters in the figure, indicating that the varieties had a significant effect on gene expression; within the varieties, the samples at different time points were distributed along a certain direction, indicating that the development period had a certain effect on gene expression; the three biological replicates were consistent, and further analysis of differentially expressed genes could be carried out for different varieties and time points.

[0033] (3) Differential expression gene analysis of four pumpkin fruits at different development stages ​Compared with low polysaccharide pumpkin V2, V3 and V4, 2478 genes were significantly up-regulated and 2295 genes were significantly down-regulated in high polysaccharide pumpkin V1 at 0 day; 4842 genes were significantly up-regulated and 5372 genes were significantly down-regulated at 20 days; 4869 genes were significantly up-regulated and 4504 genes were significantly down-regulated at 30 days; 5045 genes were significantly up-regulated and 5355 genes were significantly down-regulated at 40 days; and 5512 genes were significantly up-regulated and 6068 genes were significantly down-regulated at 60 days.

[0034] The number of differentially expressed genes common to the four varieties across time periods is shown in Table 1. Figure 3 As shown in Table 1, 222 genes were significantly up-regulated and 230 genes were significantly down-regulated in V1 vs V2 and V3, and 257 genes were significantly up-regulated and 195 genes were significantly down-regulated in V4 vs V1 and V2.

[0035] (4) GO enrichment of differentially expressed genes in four pumpkin fruits The GO enrichment analysis results of differentially expressed genes common to the four varieties across time periods are shown in Table 1. Figure 4 After comparison, 32 GO entries were up-regulated in V1 vs V2 and V3 and down-regulated in V4 vs V1 and V2, of which 17 GO entries were related to polysaccharide metabolism; 6 GO entries were up-regulated in V4 vs V1 and V2 and down-regulated in V1 vs V2 and V3, mainly related to photosynthesis, carbon metabolism and polysaccharide metabolism.

[0036] (5) Screening of differentially expressed genes Nineteen candidate genes were screened, as shown in Table 1. Nine candidate genes were up-regulated in V1 vs V2 and V3 and down-regulated in V4 vs V1 and V2, seven candidate genes were only up-regulated in V1 vs V2 and V3, and three candidate genes were only down-regulated in V4 vs V1 and V2. They mainly included endo-1, 4-beta-D-glucanase, pyruvate kinase, fructose-bisphosphate aldolase, sucrose-phosphate synthase, galacturonic acid transferase, UDP glycosyltransferase, anthocyanin 3-O-glucosyltransferase, etc., and were closely related to glycolysis, sucrose synthesis, pectin synthesis, galactose metabolism and other processes, and were closely related to polysaccharide metabolism and synthesis.

[0037] Table 1 Target genes screened by differential expression significance

[0038] (6) WGCNA analysis The correlation between the polysaccharide content phenotype traits at different development periods of 0 d, 20 d, 30 d, 40 d and 60 d and the gene modules was analyzed, and the results are shown in Figure 5 Five modules were significantly positively correlated with polysaccharide content, namely MEyellow, MEpurple, MElightyellow, MEdarkturquoise and MEdarkorange, and one module MERoralblue was significantly negatively correlated with polysaccharide content. These modules will be used as target modules for further analysis.

[0039] GO enrichment was performed on the five modules significantly positively correlated with polysaccharide content and the MERoralblue module, and the results are shown in Figure 6 Among the 888 GO entries commonly enriched by the genes of the positively correlated modules, 11 were significantly enriched; the genes of the MERoralblue module were commonly enriched in 437 GO entries. After comparison, 11 GO entries in the modules significantly positively correlated with polysaccharide content were related to polysaccharide metabolism, including cell carbohydrate metabolic process, cell glucan metabolic process, polysaccharide metabolic process and glycosyltransferase molecular function. Only 3 entries in the module negatively correlated with polysaccharide content were related to cell wall formation, including actin cytoskeleton, microtubulin binding and cytoskeletal protein binding, which affected polysaccharide synthesis and cell wall formation by affecting vesicle transport and cellulose synthase localization. Among the 11 GO entries significantly positively correlated with polysaccharide metabolism, 47 candidate genes were commonly involved in 2-10 entries, and Venn analysis was performed on the candidate genes screened by differential expression in the foregoing, and finally 6 common candidate genes were obtained (Table 2), which were mainly endo-1, 4-beta-D-glucanase (111466454, 111485684, 111468091, 111468092, 111469845) and UDP glycosyltransferase 111492134. As shown in Figure 7 , the expression levels of 4 XTH genes and 1 UGT gene were positively correlated with polysaccharide content, and they were determined as target genes. The expression levels of 111485684 (XTH23) and 111492134 (UGT) were significantly positively correlated with polysaccharide content, and primers were designed using BLAST-Primer.

[0040] Table 2 Candidate genes screened by up-regulation of DGE and WGCNA positive correlation

[0041] Example 2 Method for screening high polysaccharide pumpkin (1) Sampling Eight pumpkin materials with known polysaccharide content were selected. No. 1 was high polysaccharide pumpkin V1 honey heart; No. 2-4 were high polysaccharide parents; the polysaccharide content was > 90 mg / g, and the phenotype was identified as high polysaccharide pumpkin. No. 5 was low polysaccharide pumpkin V4 new red chestnut; No. 6-8 were low polysaccharide parents; the polysaccharide content was < 60 mg / g, and the phenotype was identified as low polysaccharide pumpkin (Table 3). Take 1 g of pumpkin young leaves and store at -80℃.

[0042] Table 3 Number, type and polysaccharide content (mg / g) of 7 test pumpkin parents

[0043] (2) DNA extraction Referring to the CTAB method (Murray HG, Thompson WF. Rapid isolation of higher weight DNA. Nucleic Acids Res, 1980, 8:4321), total genomic DNA of pumpkin new leaves was extracted.

[0044] (3) PCR amplification Two pairs of specific primers in Table 4 were mixed independently for PCR amplification; The mixing system of each pair of specific primers was 15 μL, including 1.5 μL dNTP (2.5 mM), 1.5 μL 10×buffer, 1.8 μL MgCl2 (25 mM), 1 μL (5 mM) of forward primer and reverse primer, 5 μL DNA (10 ng / ul), 0.05 μL Taq (1 U), and ultrapure water added to 15 μL.

[0045] The PCR amplification program was: pre-denaturation 94℃ 1 min; denaturation 93℃ 1 min, annealing 50℃ 1 min, extension 72℃ 2 min (40 cycles); extension 72℃ 1 min.

[0046] Table 4 Specific molecular information of two pairs

[0047] (4) PCR product detection 2.5% high-resolution standard gel agarose (DNA fragment separation range 40-1000 bp) was used. Add 20 μL EB (ethidium bromide, bromide) for color development. Add 2 μL Loading Dye to the PCR product obtained after amplification, voltage 200 v, electrophoresis for 2-3 hours. After electrophoresis, observe the bands with a gel imaging system and record the size of each marker fragment.

[0048] (5) Data collection and analysis The single clone with both the 327 bp site of Primer 1 and the 628 bp site of Primer 2 is determined as high polysaccharide.

[0049] Phenotype identification and molecular identification result comparison: the results of screening high polysaccharide by Primer 1 and Primer 2 are compared with the laboratory phenotype results to verify the consistency, and the comparison results are shown in Table 3.

[0050] Figure 8 (A) and (B) are the amplification of specific Primer 1 and Primer 2 in 8 pumpkins respectively. Among them, M1: 50 bp ladder; M2: DL2000; 1-8 are the material number of pumpkin; long vertical arrow: mark the detected single clone consistent with V1 honey heart high polysaccharide pumpkin zone type; short vertical arrow: mark the detected single clone consistent with V4 new red chestnut low polysaccharide pumpkin zone type. Compared with the observation results of polysaccharide content determined by the laboratory, Primer 1 and Primer 2 can accurately identify high polysaccharide pumpkin.

[0051] In summary, using the specific molecules described in the present application for PCR amplification, then separating by agarose electrophoresis, EB staining, and detecting polymorphism on the ultraviolet perspective instrument, according to the difference of the amplification product at the marker polymorphism site, high polysaccharide pumpkin can be quickly identified, which saves time and effort, the identification result is accurate, and has great practical application value.

[0052] Although the above embodiment has made a detailed description of the present application, it is only a part of the embodiments of the present application, not all the embodiments, and people can also obtain other embodiments according to the present embodiment without creativity, which all belong to the protection scope of the present application.

Claims

1. A molecular marker for identifying high-polymer squash, characterized by, The molecular marker is Primer 1 and Primer 2; the nucleotide sequence of the Primer 1 is shown as SEQ ID NO. 1; and the nucleotide sequence of the Primer 2 is shown as SEQ ID NO.

2.

2. Use of the molecular marker in claim 1 in identifying high polysaccharide pumpkin.

3. A pair of specific primers of a molecular marker for identifying high-polymer squash, characterized in that, The molecular marker is Primer 1 and Primer 2; The primer pair of the molecular marker Primer 1 is composed of a forward primer with the nucleotide sequence shown as SEQ ID NO. 3 and a reverse primer with the nucleotide sequence shown as SEQ ID NO. 4; The primer pair of the molecular marker Primer 2 is composed of a forward primer with the nucleotide sequence shown as SEQ ID NO. 5 and a reverse primer with the nucleotide sequence shown as SEQ ID NO.

6.

4. Use of the specific primer pair in claim 3 in identifying high polysaccharide pumpkin.

5. A kit for identifying high-polymer squash, characterized by, The kit comprises the specific primer pair in claim 3.

6. Use of the kit in claim 5 in identifying high polysaccharide pumpkin.

7. A method of identifying high-polymer squash, characterized by, The method comprises the following steps: S1, DNA extraction: sampling the seeds or leaves of the pumpkin sample to be tested, and extracting the total genomic DNA of the pumpkin by using the CTAB method; S2, PCR amplification: using the total genomic DNA of the pumpkin extracted in step S2 as a template, and using the specific primer pair in claim 3 as primers to independently mix samples and perform PCR amplification; S3, PCR product detection: performing electrophoresis detection on the PCR amplified product to identify whether the pumpkin to be identified is a high polysaccharide pumpkin.

8. The method of claim 7, wherein, The pumpkin sample to be tested in step S1 is selected from one or more of V1 honey heart, V2 orange long No. 42, V3 Jinli pumpkin, and V4 new red chestnut pumpkin; The seeds of the pumpkin sample to be tested are selected from radicles or cotyledons; and the leaves of the pumpkin sample to be tested are selected from the first new leaves or plant young leaves DNA.

9. The method of claim 7, wherein, The reaction system of the PCR amplification in step S2 comprises: 2.5 mM of dNTP 1.5 μL, 1.5 μL of 10×buffer, 25 mM of MgCl2 1.8 μL, 1 μl (5 mM) of the forward primer and the reverse primer, 10 ng / μL of DNA 5 μL, 1 U of Taq 0.05 μL, and ultra-pure water added to 15 μL; The reaction program of the PCR amplification is: pre-deformation 94℃ 1 min, deformation 93℃ 1 min, annealing 50℃ 1 min, extension 72℃ 2 min, 40 cycles; and extension 72℃ 1 min.

10. The method of claim 7, wherein, The identification in step S3 comprises using 2.5% gel agarose and adding 20 μL of ethidium bromide for color development; if the PCR amplified product simultaneously appears specific bands of 327 bp and 628 bp, then the pumpkin sample to be identified is a high polysaccharide pumpkin.