Application of p-coumaric acid in prevention and treatment of uric acid nephropathy

Abstract

The invention belongs to the field of medicine health, and particularly relates to application of p-coumaric acid to prevention and treatment of uric acid nephropathy. Specifically, p-coumaric acid (p-CA) takes cathepsin B (CTSB) as a target spot to treat or improve hyperuricemia nephropathy of a subject.

Description

Technical Field

[0001] This invention belongs to the field of medicine and health, specifically relating to the application of coumaric acid in the prevention and treatment of uric acid nephropathy. Background Technology

[0002] Hyperuricemia (HUA) is a metabolic disease caused by purine metabolism disorder, and its occurrence is closely related to excessive uric acid (UA) production or insufficient excretion. Global epidemiological data show that the prevalence of HUA has increased significantly over the past decade. Chronic HUA causes kidney lesions through mechanisms such as renal tubular damage, interstitial inflammation, fibrosis, and glomerulosclerosis, ultimately leading to hyperuricemic nephropathy (HN). This disease may progress to end-stage renal disease (ESRD) or chronic kidney disease (CKD), posing a serious challenge to healthcare systems and socioeconomic stability.

[0003] Currently, clinical treatment for hepatitis Nervous (HN) mainly relies on uric acid-lowering drugs such as allopurinol and benzbromarone. While these drugs can effectively reduce serum uric acid (UA) levels, their efficacy in slowing the progression of HN is limited. Existing therapies do not target the renal pathophysiological characteristics of HN, necessitating the development of innovative treatment strategies. Summary of the Invention

[0004] This invention provides the application of p-CA targeting CTSB in the treatment or improvement of hyperuricemic nephropathy.

[0005] In a first aspect of the invention, use of coumaric acid (p-CA) is provided for the preparation of a pharmaceutical composition for the treatment or improvement of hyperuricemic nephropathy in a subject.

[0006] In another preferred embodiment, the subject's CTSB expression level is increased.

[0007] In another preferred embodiment, the CTSB expression level of the subjects increased by ≥30% compared with that of healthy controls, more preferably by ≥50%, even more preferably by ≥80%, and most preferably by ≥100%.

[0008] In another preferred embodiment, the CTSB expression level of the subject includes the CTSB expression level in the renal tubules and / or interstitium.

[0009] In another preferred embodiment, the CTSB expression level of the subject includes: the CTSB expression level in blood and / or urine.

[0010] In another preferred embodiment, the subject was clinically diagnosed with hyperuricemic nephropathy.

[0011] In another preferred embodiment, the pharmaceutical composition is also used for one or more of the following purposes:

[0012] (Z0) inhibits the activity of CTSB;

[0013] (Z1) improves pathological damage to the kidneys;

[0014] (Z2) improves renal fibrosis;

[0015] (Z3) lowers serum creatinine (Scr) levels;

[0016] (Z4) Reduces blood urea nitrogen (BUN) levels;

[0017] (Z5) Reduces the level of urinary microalbumin;

[0018] (Z6) inhibits pyroptosis.

[0019] In another preferred embodiment, the pharmaceutical composition does not alter the expression level of CTSB.

[0020] In another preferred embodiment, the level includes gene level and / or protein level.

[0021] In another preferred embodiment, the renal pathological damage includes: renal tubular dilatation, renal tubular atrophy, renal tubulointerstitial inflammation, renal tubulointerstitial fibrosis, or a combination thereof.

[0022] In another preferred embodiment, the improvement in renal pathological damage includes: significantly reducing the renal tubular injury score.

[0023] In another preferred embodiment, the significant reduction means that, after administration of the pharmaceutical composition, the renal tubular injury score A1 of the test subject is compared with the renal tubular injury score A0 of the test subject before administration of the pharmaceutical composition, and A1 / A0 is ≤0.8, preferably ≤0.6, more preferably ≤0.5, and most preferably ≤0.3.

[0024] In another preferred embodiment, improving renal fibrosis includes: reducing the expression levels of fibrosis markers.

[0025] In another preferred embodiment, the fibrosis markers include: FN (Fibronectin), COL-1 (Collagen I), COL-3 (Collagen III), α-SMA expression, or a combination thereof.

[0026] In another preferred embodiment, the significant reduction means that, after administration of the pharmaceutical composition, the expression level of the fibrosis marker B1 in the test subject is B1 / B0 ≤ 0.9, more preferably ≤ 0.8, even more preferably ≤ 0.6, and most preferably ≤ 0.5, compared with the expression level of the fibrosis marker B0 in the test subject before administration of the pharmaceutical composition.

[0027] In another preferred embodiment, the inhibition of pyroptosis comprises: significantly reducing GSDMD expression levels.

[0028] In another preferred embodiment, the significant reduction means that, after administration of the pharmaceutical composition, the GSDMD expression level C1 of the test subject is ≤0.9, more preferably ≤0.8, even more preferably ≤0.6, and most preferably ≤0.5, compared with the GSDMD expression level C0 of the test subject before administration of the pharmaceutical composition.

[0029] In another preferred embodiment, p-CA forms hydrogen bonds with Cys26, Gln23, and Gly198 of CTSB.

[0030] In another preferred embodiment, p-CA forms a salt bridge with His110 of CTSB.

[0031] In another preferred embodiment, p-CA exhibits hydrophobic interactions with His199 and Trp221 of CTSB.

[0032] In another preferred embodiment, the inhibition of CTSB activity means that, after administration of the pharmaceutical composition, the CTSB enzyme activity D1 of the test subject is compared with the CTSB enzyme activity D0 of the test subject before administration of the pharmaceutical composition, and the ratio D1 / D0 is ≤0.95, preferably ≤0.9, more preferably ≤0.85, and most preferably ≤0.8.

[0033] In another preferred embodiment, the reduction in serum creatinine (Scr) level means that, after administration of the pharmaceutical composition, the serum creatinine (Scr) level F1 of the test subject is ≤0.8, more preferably ≤0.7, even more preferably ≤0.6, and most preferably ≤0.5, compared with the serum creatinine (Scr) level F0 of the test subject before administration of the pharmaceutical composition.

[0034] In another preferred embodiment, the reduction in blood urea nitrogen (BUN) level means that, after administration of the pharmaceutical composition, the level of blood urea nitrogen (BUN) G1 in the test subject is ≤0.9, more preferably ≤0.8, even more preferably ≤0.7, and most preferably ≤0.6, compared with the level of blood urea nitrogen (BUN) G0 in the test subject before administration of the pharmaceutical composition.

[0035] In another preferred embodiment, the reduction in urinary microalbumin level means that, after administration of the pharmaceutical composition, the urinary microalbumin level H1 of the test subject is H1 / H0 ≤ 0.8, preferably ≤ 0.6, more preferably ≤ 0.5, and most preferably ≤ 0.4, compared with the urinary microalbumin level H0 of the test subject before administration of the pharmaceutical composition.

[0036] In a second aspect of the invention, a pharmaceutical composition is provided, the pharmaceutical composition comprising a first pharmaceutical component and a second pharmaceutical component, the first pharmaceutical component being p-coumaric acid; the second pharmaceutical component being optionally a pharmaceutical component for lowering uric acid levels.

[0037] In another preferred embodiment, the optional pharmaceutical component for lowering uric acid levels comprises: allopurinol, benzbromarone, febuxostat, or a combination thereof.

[0038] In a third aspect of the invention, a pharmaceutical combination for companion diagnostics is provided, the pharmaceutical combination comprising:

[0039] (a) p-Coumaric acid;

[0040] (b) Detection reagent for cathepsin B (CTSB).

[0041] In another preferred embodiment, the CTSB detection reagent comprises: a reagent for detecting CTSB gene levels, a reagent for detecting CTSB protein levels, or a reagent for detecting CTSB gene / protein levels.

[0042] In a fourth aspect of the invention, the use of the pharmaceutical composition described in the second aspect of the invention or the pharmaceutical composition described in the third aspect of the invention is provided for preparing a medicine box for treating hyperuricemic nephropathy.

[0043] In a fifth aspect of the invention, a medicine box is provided, the medicine box comprising the pharmaceutical composition described in the second aspect of the invention or the pharmaceutical composition described in the third aspect of the invention.

[0044] In another preferred embodiment, the medicine box also includes an instruction manual.

[0045] In another preferred embodiment, the instructions direct the use of the kit for the treatment of hyperuricemic nephropathy.

[0046] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here. Attached Figure Description

[0047] Figure 1 The construction of the HN rat model is shown.

[0048] in, Figure 1 A shows a schematic diagram of the HN rat model construction; Figure 1 B shows the serum creatinine (Cr), blood urea nitrogen (BUN), UA, and urinary microalbumin levels in rats of the control group (Con) and the HN model group (HN) (n=6); Figure 1C shows H&E staining, NLRP3 immunohistochemistry, tubular injury score, and NLRP3 positive area of ​​renal tissue; Figure 1 D shows the protein expression and quantification analysis of NLRP3, IL-1β and caspase-1 (normalized to GAPDH) (n=6).

[0049] Figure 2 p-CA was shown to alleviate kidney damage in HN rats.

[0050] Specifically, Figure 2 A shows a schematic diagram of p-CA treatment in HN rats; Figure 2 B shows the levels of Scr, urinary microalbumin, BUN, and UA in each group; Figure 2 C shows PAS and H&E staining and tubular damage scores (n=6).

[0051] Figure 3 p-CA was shown to alleviate fibrosis.

[0052] Specifically, Figure 3 A shows Masson's tricolor and α-SMA immunohistochemistry and the positive area (n=6); Figure 3 B and Figure 3 C shows the expression and quantification of fibrosis marker proteins in renal tissue (n=6); Figure 3 D and Figure 3 E shows the expression and quantification of fibrosis marker proteins in HK-2 cells (n=3); Figure 3 F shows the immunofluorescence and quantification of α-SMA and fibronectin in HK-2 cells (n=3).

[0053] Figure 4 p-CA was shown to be a potent inhibitor of the NLRP3 inflammatory pathway in UA-stimulated HK-2 cells.

[0054] in, Figure 4 A shows a representative immunohistochemical image of NLRP3; Figure 4 B shows the Pearson correlation analysis of serum / urine IL-1β, IL-18 and Scr in HN patients (n=15); Figure 4 C shows the inhibitory effects of 16 natural compounds on UA-stimulated IL-1β secretion in HK-2 cells (ELISA detection, n=3), with p-CA highlighted in red; Figure 4 D shows the chemical structure of p-CA; Figure 4 E shows the effect of p-CA treatment for 48 hours on HK-2 cell viability as detected by the CCK-8 assay; Figure 4 F showed the cytotoxicity of UA (200-1200 μM) treatment for 48 / 72 hours; Figure 4G showed that p-CA pretreatment (50-200 μM) protected the viability of UA-stimulated cells; Figure 4 H shows the dose-dependent inhibition of p-CA on the expression of proteins in the NLRP3 signaling pathway (immunoblotting); Figure 4 I shows the immunofluorescence and quantification of NLRP3 (red) and caspase-1 (green) in HK-2 cells (IM, n=3).

[0055] Figure 5 p-CA was shown to inhibit NLRP3 inflammasome activation.

[0056] in, Figure 5 A shows the expression and quantification of NLRP3 pathway proteins in renal tissue (n=6); Figure 5 B shows immunohistochemistry of NLRP3 and caspase-1 and quantification of positive area; Figure 5 C shows the immunofluorescence and quantification of IL-18 and IL-1β (n=6).

[0057] Figure 6 p-CA was shown to alleviate UA-induced pyroptosis and immune inflammatory responses.

[0058] in, Figure 6 A and Figure 6 B shows the expression and quantification of GSDMD protein (in vitro n=3; in vivo n=6); Figure 6 C shows the GSDMD immunofluorescence in HK-2 cells (n=3). Figure 6 D shows the GSDMD immunofluorescence in kidney tissue (n=6). Figure 6 E shows Figure 6 C and Figure 6 Quantitative results of D. Figure 6 F and Figure 6 G shows the levels of IL-18 and IL-1β in cell supernatant as detected by ELISA (n=3); Figure 6 H shows the immunohistochemistry of MPO and CD68 and the quantification of inflammatory cell infiltration (n=6); Figure 6 I shows the expression levels of inflammatory factors IL-6, TNF-α, and MCP-1.

[0059] Figure 7 Network pharmacology analysis revealed that CTSB is a p-CA target.

[0060] in, Figure 7 A shows the p-CA target points predicted by 6 databases; Figure 7 B shows six databases for screening HN-related genes; Figure 7 C shows a differential gene volcano plot of HN rat kidney tissue; Figure 7D shows a heatmap of 50 differentially expressed genes; Figure 7 E shows the intersection of p-CA targets, HN-related genes, and RNA-seq targets; Figure 7 F shows the KEGG pathway enrichment analysis; Figure 7 G shows the functional enrichment analysis of GO; Figure 7 H displays the PPI network analysis (STRING database); Figure 7 I shows the core module of the MCODE algorithm for filtering; Figure 7 J shows 12 algorithms used to identify the top 10 pivot genes; Figure 7 K shows the docking of p-CA with the CTSB molecule (dashed lines indicate hydrogen bonds); Figure 7 L shows the contribution of key amino acids in the p-CA-CTSB binding; Figure 7 M shows the dynamic changes in the number of hydrogen bonds in molecular dynamics simulations; Figure 7 N shows the RMSD curve of the p-CA-CTSB complex; Figure 7 O shows the residue RMSF fluctuation analysis.

[0061] Figure 8 p-CA was shown to directly bind to and inhibit CTSB activity.

[0062] in, Figure 8 A shows the SPR detection of p-CA binding to CTSB (KD = 28.8 μM); Figure 8 B shows the conformational changes of CTSB induced by p-CA as analyzed by CD spectroscopy; Figure 8 C shows the changes in the proportion of the secondary structure of CTSB; Figure 8 D shows the expression and quantitative analysis of CTSB protein in HK-2 cells induced by different concentrations of uric acid (n=3). Figure 8 E shows the effect of different concentrations of p-CA on CTSB protein expression in uric acid-stimulated HK-2 cells and its quantitative analysis (n=3). Figure 8 F shows the expression and quantification results of CTSB protein in the kidney tissue of HN rats in each group; Figure 8 G shows the immunofluorescence and quantification of CTSB in HK-2 cells (n=3); Figure 8 H shows the immunofluorescence and quantification of CTSB in the kidney tissue of HN rats (n=6); Figure 8 I shows the immunohistochemistry of CTSB and the positive area in the kidney tissue of HN rats (n=6); Figure 8 J shows the co-localization immunofluorescence of CTSB and AQP-1 in the kidney tissue of HN rats; Figure 8 K and Figure 8 L shows the in vitro and in vivo assays of CTSB enzyme activity (in vitro n=3; in vivo n=6).

[0063] Figure 9 This demonstrates that UA promotes CTSB activation of NLRP3 through lysosomal membrane permeation (LMP).

[0064] in, Figure 9 A shows the AO staining detection of LMP (n=3); Figure 9 B shows the co-localization immunofluorescence and quantification of CTSB and LAMP1; Figure 9 C shows the subcellular component analysis of CTSB translocation (n=3); Figure 9 D shows the Co-IP verification of the CTSB-NLRP3 interaction; Figure 9 E shows the co-localization immunofluorescence and quantification of CTSB-NLRP3; Figure 9 F shows the AlphaFold3 simulation of the CTSB-NLRP3 binding mode; Figure 9 G shows the effect of CTSB siRNA on inflammation / fibrosis markers (n=3); Figure 9 H shows the immunohistochemistry of CTSB in renal tissue of HN patients; Figure 9 I shows the correlation between urinary CTSB and renal function indicators (n=15); Figure 9 J shows a working model of how p-CA improves HN by targeting CTSB.

[0065] Figure 10 The study showed that p-CA-dependent CTSB inhibits the NLRP3 pathway.

[0066] in, Figure 10 A shows the CTSB enzyme activity assay (n=3); Figure 10 B and Figure 10 C shows the effects of CTSB inhibitors, siRNA, and p-CA on the expression of inflammatory and fibrotic marker proteins in uric acid-induced HK-2 cells (n=3); Figure 10 D shows a schematic diagram of p-CA and CA-074Me treatment in HN rats; Figure 10 E showed renal function indicators and CTSB activity in HN rats; Figure 10 F and Figure 10 G shows the Masson and H&E staining and quantitative results of kidney tissue from HN rats (n=6); Figure 10 H shows the immunofluorescence of NLRP3 in kidney tissue of HN rats (n=6); Figure 10 I and Figure 10 J shows the expression and quantification results of NLRP3 pathway and fibrosis marker proteins in the kidney tissue of HN rats (n=6). Detailed Implementation

[0067] Through extensive and in-depth research, the inventors unexpectedly discovered for the first time that p-coumaric acid (p-CA) can effectively treat or improve hyperuricemic nephropathy by targeting CTSB. Specifically, although p-CA does not regulate CTSB protein or gene expression in vitro or in vivo, it can treat HN by significantly inhibiting CTSB activity and improving renal fibrosis. This invention was completed based on this discovery.

[0068] the term

[0069] To facilitate a clearer understanding of this disclosure, certain terms are first defined. As used herein, unless otherwise expressly specified herein, each of the following terms shall have the meaning given below. Other definitions are set forth throughout the application.

[0070] As used herein, the term “and / or” refers to and covers any and all possible combinations of one or more of the related listed items.

[0071] As used herein, the terms “comprising,” “including,” and “containing” are used interchangeably and include not only closed definitions but also semi-closed and open definitions. In other words, the terms include “consisting of” and “substantially consisting of”.

[0072] Where a numerical range is provided, unless the context clearly indicates otherwise, it should be understood that every intermediate integer of the value 20, every tenth of every intermediate integer of the value, any other intermediate value between the upper and lower limits of the range, and any other intermediate value within the specified range are included in this invention. The upper and lower limits of these smaller ranges may be independently included within the smaller range and also covered by this invention, but are subject to any express exclusions within the specified range. For example, "1 to 50" includes "2 to 25", "5 to 20", "25 to 50", "1 to 10", etc.

[0073] Unless the context clearly indicates otherwise, it should be understood that data in the accompanying drawings of this invention are expressed as mean ± SEM. Unless the context clearly indicates otherwise, it should be understood that in the accompanying drawings of this invention, *P<0.05,**P<0.01,***P<0.001,****P<0.0001 vs. control group. Unless the context clearly indicates otherwise, it should be understood that in the accompanying drawings of this invention, #P<0.05,##P<0.01,###P<0.001,####P<0.0001 vs. UA / HN group. In a specific embodiment, #P<0.05,##P<0.01,###P<0.001,####P<0.0001 vs. UA group. In a specific embodiment, #P<0.05,##P<0.01,###P<0.001,####P<0.0001 vs. HN group. In specific implementations, #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs UA800 group. In specific implementations, #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs UA+NC-siRNA group. In specific implementations, #P<0.05, ##P<0.01, ###P<0.001, ####P<0.0001 vs UA+NC-siRNA / HN group.

[0074] As used in this article, the terms "hyperuricemic nephropathy" and "uric acid nephropathy" can be used interchangeably.

[0075] Hyperuricemia Nephropathy

[0076] Hyperuricemic nephropathy (HN) is kidney damage caused by long-term elevated serum uric acid (SUA) levels (men >420 μmol / L, women >360 μmol / L). This damage includes direct damage to kidney tissue from uric acid crystal deposition, or indirect damage through mechanisms such as inflammation and oxidative stress. It is a common metabolic disease characterized by tubulointerstitial inflammation and fibrosis, but currently, effective treatment strategies are lacking.

[0077] p-coumaric acid

[0078] Plant-derived natural products have always been an important source for drug development due to their unique molecular structures, distinctive biological activities, natural abundance, and good safety profiles, resulting from evolutionary selection. Notably, over 50% of FDA-approved small molecule drugs are derived from natural products. Among them, phenolic compounds, as the most abundant secondary metabolites in plants, have shown potential in the treatment of various chronic diseases.

[0079] p-Coumaric acid (p-CA) is a dietary phenolic compound abundant in plant-based foods and possesses various biological activities. Previous studies have not explored the therapeutic potential of p-CA for hyperuricemic nephropathy (HN).

[0080] Uses of the present invention

[0081] This invention provides the application of coumaric acid in the treatment of hyperuricemic nephropathy (HN).

[0082] p-CA improves the pathological process of hepatitis Nervous (HN) by inhibiting cathepsin B (CTSB) released by uric acid (UA)-induced lysosomal membrane permeation (LMP), providing a new target and treatment strategy for HN.

[0083] p-CA directly binds to the lysosomal cysteine ​​protease CTSB, altering its spatial conformation and inhibiting its activity. UA-mediated increase in lysosomal membrane permeability (LMP) allows CTSB to escape into the cytoplasm, where it interacts with NLRP3 to activate the NLRP3-ASC-caspase-1-GSDMD-N-IL-18 / IL-1β signaling cascade, driving inflammation and fibrosis. Pharmacological inhibition or gene silencing of CTSB by p-CA can effectively block this pathway and delay disease progression.

[0084] Using multi-omics techniques, cathepsin B (CTSB) was identified as the target of p-CA. Mechanistically, p-CA inhibits the release of CTSB induced by UA-induced changes in lysosomal membrane permeability (LMP), thereby blocking the NLRP3 / ASC / caspase-1 / GSDMD-N / IL-18 / IL-1β signaling axis and alleviating inflammatory responses, pyroptosis, and fibrosis.

[0085] This invention not only establishes that CTSB can be used as a target for the treatment of HN, but also reveals the clinical translational value of p-CA as a CTSB inhibitor.

[0086] p-CA can significantly inhibit CTSB activity, but it does not regulate CTSB protein or gene expression in vitro or in vivo.

[0087] The main advantages of this invention include:

[0088] (a) This invention provides the application of coumaric acid in the treatment of hyperuricemic nephropathy (HN). p-CA targets CTSB, directly binds to CTSB and alters its conformation and activity, thereby improving hyperuricemic nephropathy.

[0089] (b) p-CA is the first natural CTSB inhibitor with low toxicity and high safety profile. It can significantly reduce NLRP3 inflammasome-mediated renal inflammation and fibrosis in hepatitis N (HN), thereby treating HN. These results provide a potentially effective pharmacological strategy for the treatment of HN.

[0090] (c) In this invention, CTSB expression was significantly increased in the renal tubules and interstitium of HN patients, suggesting that CTSB can serve as a potential biomarker for the diagnosis and treatment of HN and plays a key role in HN inflammation and fibrosis.

[0091] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are weight percentages and parts by weight.

[0092] Example 1: p-CA alleviates kidney damage in HN rats.

[0093] like Figure 1 As shown in A, a rat model of HN was established by administering potassium oxonate (1.5 g / kg) in combination with adenine (0.1 g / kg) dissolved in 0.5% CMC-Na solution by gavage for 3 consecutive weeks. This model has been widely verified to simulate progressive HN.

[0094] HN rats exhibited significant renal dysfunction: serum uric acid (SUA), creatinine (Scr), blood urea nitrogen (BUN), and urinary microalbumin levels were significantly elevated. Figure 1 B), accompanied by severe renal tubular injury ( Figure 1 C). Immunohistochemical analysis showed that NLRP3 expression was significantly upregulated in the kidney tissue of HN rats, mainly located in the renal tubules (C). Figure 1 C). Western blot analysis revealed high expression of NLRP3, caspase-1, and ASC proteins in kidney tissue, confirming NLRP3 inflammasome activation in HN rats. Figure 1 D).

[0095] To evaluate the in vivo protective effect of p-CA, such as Figure 2 As shown in Figure A, HN rats were treated with p-CA by gavage for 3 weeks at doses of 50 mg / kg (low dose) and 100 mg / kg (high dose).

[0096] The results are as follows Figure 2As shown in Figure B, three weeks after modeling, the levels of Scr, BUN, urinary microalbumin, and SUA in HN rats were significantly increased, while p-CA treatment significantly reduced the first three indicators and also had a slight reducing effect on SUA.

[0097] Typical tubulointerstitial damage features of HN rats were observed by PAS and H&E staining. Figure 2 C). p-CA dose-dependently improves UA-induced renal tubular pathological damage (based on HE staining damage score). This indicates that p-CA can alleviate pathological damage, reduce proteinuria, and improve renal function in HN rats.

[0098] Example 2: p-CA alleviates UA-induced renal fibrosis.

[0099] The treatment group was given p-CA (50 or 100 mg / kg) by gavage, while the control group was given an equal volume of 0.5% CMC-Na solution.

[0100] like Figure 3 As shown in Figure A, Masson's trichrome staining revealed that p-CA significantly reduced collagen deposition in the renal interstitium of HN rats. Furthermore, α-SMA, a key marker of renal fibrosis, showed significantly increased expression in the kidneys of HN rats, primarily located in the tubulointerstitial region, while p-CA treatment dose-dependently reduced its expression.

[0101] Western blot analysis showed that p-CA could dose-dependently inhibit the expression of type III collagen, fibronectin, α-SMA, and type I collagen in renal tissue. Figure 3 B and Figure 3 C). Consistent results were obtained in HK-2 cell experiments. Figure 3 D and Figure 3 E).

[0102] Immunofluorescence staining further confirmed the inhibitory effect of p-CA on fibrosis markers. Figure 3 F).

[0103] In summary, p-CA exhibits significant anti-fibrotic effects both in vivo and in vitro.

[0104] Example 3: p-CA inhibits NLRP3 inflammasome activation.

[0105] Preliminary immunohistochemistry showed that NLRP3 expression in the renal tissue of HN patients was higher than that in the control group. Figure 4 A). Analysis of serum and urine levels of NLRP3 inflammasome activation markers IL-1β and IL-18 showed a significant positive correlation between their levels and renal function indicators (Scr and BUN). Figure 4 B).

[0106] After 48 hours of evaluation in UA-stimulated HK-2 cells, the amount of IL-1β secreted in the cell supernatant (reflecting the degree of NLRP3 inflammasome activation) was used as the primary evaluation indicator. The results are as follows: Figure 4 As shown in Figure C, among the 16 phenolic compounds with significant anti-inflammatory activity (chlorogenic acid, ferulic acid, caffeic acid, phlorizin, ellagic acid, p-coumaric acid (p-CA), curcumin, gallic acid, fisetin, resveratrol, butazone, gastrodin, kaempferol, rosmarinic acid, proanthocyanidins, and pterostilbene), three compounds showed almost no inhibitory activity, while compound number 3, p-CA (… Figure 4 D) showed significantly stronger inhibitory activity.

[0107] CCK-8 assays confirmed that 50-200 μmol / L p-CA had no effect on cell viability, while UA reduced cell viability in a time- and dose-dependent manner. Figure 4 E, Figure 4 F, Figure 4 G). Subsequent experiments involved treatment with 800 μM UA for 48 hours.

[0108] Western blot analysis showed that p-CA dose-dependently inhibited UA-induced upregulation of ASC, NLRP3, IL-18, caspase-1, and IL-1β proteins. Figure 4 H). Immunofluorescence results further validated the inhibitory effect of p-CA on caspase-1 and NLRP3 expression. Figure 4 I). These results collectively demonstrate that p-CA can effectively inhibit the NLRP3 inflammatory pathway.

[0109] Further investigation was conducted to determine whether the nephroprotective effect of p-CA was related to the inhibition of the NLRP3 inflammasome. Consistent with the results of cell experiments, p-CA dose-dependently reduced the expression of ASC, NLRP3, IL-18, caspase-1, and IL-1β in the kidneys of HN rats. Figure 5 A). Immunohistochemistry and immunofluorescence showed that p-CA could dose-dependently reduce the expression of caspase-1, NLRP3, IL-1β, and IL-18, mainly located in the tubules and interstitium, in HN kidneys. Figure 5 B and Figure 5 C). Notably, no significant systemic toxicity was observed in the p-CA treatment group of rats (serum ALT / AST levels remained stable, and there was no significant weight loss).

[0110] Example 4: p-CA alleviates UA-induced pyroptosis and inhibits immune inflammatory cell infiltration.

[0111] Analysis of the GEO database (GSE190205 and GSE2622687) and RNA-seq data revealed significantly increased GSDMD expression in the kidney tissues of HN mice and rats.

[0112] Western blotting and immunofluorescence confirmed that p-CA dose-dependently inhibited UA-induced upregulation of GSDMD-N expression. Figure 6 A, Figure 6 B Figure 6 C Figure 6 D、 Figure 6 E). ELISA analysis showed that p-CA can dose-dependently inhibit the release of IL-18 and IL-1β in UA-stimulated HK-2 cells (E). Figure 6 F and Figure 6 G). Immunohistochemistry showed that p-CA significantly reduced MPO in the renal interstitium of HN rats. + (neutrophils) and CD68 + (Macrophage) infiltration Figure 6 H). Western blot confirmed that p-CA can reduce the levels of IL-6, MCP-1, and TNF-α in renal tissue. Figure 6 I). These results indicate that p-CA can alleviate pyroptosis and subsequent inflammatory responses both in vivo and in vitro.

[0113] Example 5: Identification of CTSB as a target of p-CA based on network pharmacology and transcriptomics strategies.

[0114] Multidimensional bioinformatics methods were used to screen potential binding targets of p-CA in HN. First, potential bioavailable targets were predicted based on p-CA structure using six databases, including TCMSP and SuperPRED, resulting in 407 candidate targets. Figure 7 A). Simultaneously, HN-related genes were collected from six databases, including DisGeNET, resulting in 2013 potential HN targets. Figure 7 B).

[0115] To supplement the prediction results, RNA-seq transcriptome analysis was performed on rat kidney tissue, revealing 894 upregulated genes and 973 downregulated genes in the HN group. Figure 7 C). The heatmap shows the expression patterns of 50 randomly selected differentially expressed genes (DEGs). Figure 7 D). Venn diagram analysis identified 20 common targets in p-CA targets, HN-related genes, and RNA-seq data. Figure 7 E). Pathway enrichment analysis showed that p-CA significantly regulates the NOD-like receptor signaling pathway with NLRP3 as its core node ( Figure 7 F). GO analysis indicates that these targets are primarily involved in biological processes such as inflammatory responses and oxidative stress. Figure 7G), consistent with the conclusion observed in in vitro and in vivo experiments that p-CA inhibits the NLRP3 pathway. Protein-protein interaction (PPI) network analysis was performed using the STRING database (connection fraction > 0.4), and 12 algorithms from the CytoHubba plugin and the MCODE plugin were used to screen core genes. Integrated analysis identified cathepsin B (CTSB) as a key hub gene. Figure 7 H, Figure 7 I and Figure 7 J). Analysis of the GEO datasets (GSE190205 and GSE2622687) confirmed the upregulation of CTSB protein levels in the kidney tissue of HN mice.

[0116] The possibility of direct binding between p-CA and CTSB was assessed through molecular docking. Figure 7 p-CA forms hydrogen bonds with Cys26, Gln23, and Gly198 within the CTSB active pocket, forms a salt bridge with His110, and exhibits hydrophobic interactions with His199 and Trp221. Notably, the CTSB active site contains a conserved catalytic binary (Cys-His) and a shielding ring structure. A mutation in His110 to alanine (His110A) disrupts the salt bridge with Asp22 and increases the elasticity of the shielding ring, thereby inhibiting CTSB activity. These results suggest that p-CA may inhibit CTSB enzyme activity through interactions with key catalytic residues such as Cys and His.

[0117] The binding stability of p-CA and CTSB was verified using molecular dynamics simulations (MDS). The MM / GBSA method calculated the binding free energy to be -15.38 ± 1.83 kcal / mol, indicating a stable interaction. Energy decomposition analysis showed that His110 contributed the most to the binding. Figure 7 L), consistent with docking predictions. Hydrogen bond analysis showed that p-CA and CTSB can form 0-6 hydrogen bonds (average 2). Figure 7 M). Root mean square deviation (RMSD) analysis shows that the system reaches equilibrium after initial fluctuations. Figure 7 N), while root mean square fluctuations (RMSF) show that p-CA binding reduces the flexibility of most regions of the CTSB. Figure 7 O), confirming that p-CA can stably bind to CTSB and may inhibit its enzyme activity.

[0118] Example 6: p-CA directly binds to CTSB and regulates its spatial conformation and enzyme activity.

[0119] Surface plasmon resonance (SPR), the gold standard for molecular interaction detection, was used for further validation. SPR analysis showed that p-CA and CTSB directly bind, with a dissociation constant (KD) of 28.8 μM. Figure 8A). Allosteric regulation can induce protein conformational rearrangement, thereby modulating its activity. Considering the unique structure of the CTSB active site, it is speculated that p-CA may induce conformational changes in CTSB. Circular dichroism (CD) analysis revealed a significant change in the CD spectrum in the 190-225 nm wavelength region when p-CA binds to CTSB in a 1:1 molar ratio. Figure 8 B). Quantitative analysis of secondary structure showed that p-CA decreased the proportion of β-sheets and α-helices in CTSB, while increasing the proportion of random coils and β-turns. Figure 8 C) confirmed that p-CA can induce conformational changes in CTSB.

[0120] To investigate the functional significance of this conformational change, the effects of p-CA on CTSB expression profiles and enzyme activity were evaluated. Western blot showed that UA treatment dose-dependently upregulated CTSB expression in HK-2 cells. Figure 8 D), but p-CA does not change this effect ( Figure 8 E). qRT-PCR confirmed that p-CA did not affect UA-induced upregulation of CTSB mRNA. The primer sequences (5'-3') used for qRT-PCR were as follows: Human CTSB-F: TGTTCTTGCGACTCTTGG (SEQ ID NO: 5); Human CTSB-R: GAAGGTTGACGAGGATGAC (SEQ ID NO: 6); Human GAPDH-F: ACAACTTTGGTATCGTGGAAGG (SEQ ID NO: 7); Human GAPDH-R: GCCATCACGCCACAGTTTC (SEQ ID NO: 8). In the HN rat model, p-CA also did not alter the high expression of CTSB protein in the kidneys. Figure 8 F). Immunofluorescence ( Figure 8 G and Figure 8 H) and immunohistochemistry Figure 8 I) The results are consistent.

[0121] Co-IF staining revealed that CTSB co-localized with the proximal tubule marker AQP-1. Figure 8 Immunohistochemistry of serial kidney tissue sections and KPMP single-cell RNA-seq data further confirmed that CTSB is mainly expressed in renal tubular epithelial cells.

[0122] Enzyme activity assays based on RR-AFC fluorescent substrates showed that p-CA significantly inhibited UA-stimulated HK-2 cells ( Figure 8 K) and HN rat kidneys ( Figure 8 CTSB enzyme activity is enhanced in L). In summary, p-CA inhibits CTSB enzyme activity by altering its spatial conformation without affecting its expression level.

[0123] Example 7: CTSB can serve as a potential biomarker for the diagnosis and treatment of HN.

[0124] Lysosomal dysfunction marker LMP can lead to the release of contents. Given the aberrant expression and altered activity of CTSB, this study investigates whether UA induces the translocation of CTSB from the lysosome to the cytoplasm by LMP.

[0125] Acridine orange (AO) staining showed that UA stimulation significantly reduced red fluorescence (intact lysosomes) and enhanced green fluorescence (cytoplasmic monomers) in HK-2 cells. Figure 9 A) indicates the occurrence of LMP. Confocal microscopy analysis of the co-localization of CTSB and the lysosomal marker protein LAMP1 revealed that UA treatment caused CTSB to diffuse from the lysosomes into the cytoplasm. Figure 9 B), and the lysosomes exhibited a swollen morphology. Western blot analysis of subcellular components further confirmed that UA increased the cytoplasmic distribution of CTSB and reduced its lysosomal localization. Figure 9 C).

[0126] Although the understanding of CTSB's role in the regulation of the NLRP3 inflammasome is deepening, its specific molecular mechanisms remain unclear. Co-IP experiments have confirmed the interaction between CTSB and NLRP3 in UA-stimulated HK-2 cells and HN rat kidney tissue. Figure 9 D). Confocal immunofluorescence showed a significant increase in CTSB and NLRP3 colocalization after UA treatment. Figure 9 E). Using AlphaFold3 to construct a CTSB-NLRP3 complex model, it was found that the LRR domain and the HD2 subdomain in the NACHT domain of NLRP3 are the main interaction interfaces. Figure 9 F). Key residue analysis showed that Leu621, Lys619, and Asn656 of the NLRP3 HD2 subdomain interact with Asn73, Ser66, and Asp125 of CTSB, respectively; and residues such as Asp750 and Glu745 of the LRR domain form intermolecular forces with Lys128 and Lys131 of CTSB.

[0127] To verify the role of CTSB in UA-mediated NLRP3 activation and subsequent inflammation, pyroptosis, and fibrosis, CTSB expression was knocked down using siRNA, and gene silencing was performed using CTSB-specific siRNA (si-CTSB) and negative control siRNA (NC siRNA). CTSB siRNA sequences: sense strand 5′-GGUCAACUAUGUCAACAAATT-3′ (SEQ ID NO:1), antisense strand 5′-UUUGUUGACAUAGUUGACCTT-3′ (SEQ ID NO:2); NC siRNA sequences: sense strand 5′-UUCUCCGAACGUGUCACGUTT-3′ (SEQ ID NO:3), antisense strand 5′-ACGUGACACGUUCGGAGAATT-3′ (SEQ ID NO:4). Results are as follows: Figure 9 As shown in Figure G, CTSB silencing alleviates UA-induced upregulation of inflammasome components (ASC / NLRP3 / caspase-1), effector molecules (GSDMD-N / IL-1β / IL-18), and fibrosis markers (type I / III collagen, etc.). These results reveal that UA triggers cytoplasmic release of CTSB via LMP, which interacts with NLRP3 to activate inflammasomes, thereby driving the inflammatory response and fibrosis process. Figure 9 J).

[0128] Clinical correlation analysis showed that CTSB expression was significantly elevated in the renal tubules and interstitium of HN patients. Figure 9 H). ELISA testing revealed a positive correlation between serum and urinary CTSB levels and Scr and BUN in HN patients. Figure 9 I) suggests that CTSB may serve as a potential biomarker for the diagnosis and treatment of HN.

[0129] Example 8: p-CA exerts anti-inflammatory and anti-fibrotic effects by targeting CTSB to regulate the NLRP3 / caspase-1 / GSDMD axis.

[0130] To confirm whether CTSB is a necessary condition for p-CA to exert its protective effect, the CTSB-specific inhibitor CA-074Me was used for verification.

[0131] In UA-stimulated HK-2 cells, both 15 μM CA-074Me and 200 μM p-CA significantly inhibited CTSB activity and downregulated the expression of inflammation, pyroptosis, and fibrosis-related proteins. Figure 10 A and Figure 10 B). CTSB siRNA transfection experiments showed that while gene silencing reduced inflammasome pathway activation, it weakened the inhibitory effect of p-CA. Figure 10C) indicates that the anti-inflammatory and anti-fibrotic effects of p-CA depend on CTSB.

[0132] In vivo experiments further compared the therapeutic effects of p-CA (100 mg / kg) and CA-074Me (50 mg / kg). Figure 10 D). Both significantly improved renal function indicators (Scr / BUN / urinary microalbumin) in HN rats. Figure 10 E) Reduces renal tubular damage and fibrosis (Masson and H&E staining) Figure 10 F and Figure 10 G), and inhibited renal NLRP3 expression (immunofluorescence) ( Figure 10 H) and downstream signaling molecules (Western blot) Figure 10 I and Figure 10 J). Notably, the CA-074Me treatment group experienced systemic toxicities such as slowed weight gain and abnormal liver function, while p-CA demonstrated superior safety. These results confirm that p-CA alleviates inflammation and fibrosis by specifically targeting the CTSB. Figure 10 J).

[0133] All documents mentioned in this invention are incorporated herein by reference as if each document were individually incorporated by reference. Furthermore, it should be understood that after reading the foregoing teachings of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of coumaric acid (p-CA), characterized in that, This is used to prepare a pharmaceutical composition for treating or improving hyperuricemic nephropathy in a subject.

2. The use as described in claim 1, characterized in that, The subjects showed increased CTSB expression levels.

3. The use as described in claim 1, characterized in that, The pharmaceutical composition is also used for one or more of the following purposes: (Z0) inhibits the activity of CTSB; (Z1) improves pathological damage to the kidneys; (Z2) improves renal fibrosis; (Z3) lowers serum creatinine (Scr) levels; (Z4) Reduces blood urea nitrogen (BUN) levels; (Z5) Reduces the level of urinary microalbumin; (Z6) inhibits pyroptosis.

4. The use as described in claim 3, characterized in that, The improvement in renal pathological damage includes: significantly reducing the renal tubular injury score.

5. The use as described in claim 3, characterized in that, Improving renal fibrosis includes reducing the expression levels of fibrosis markers.

6. The use as described in claim 3, characterized in that, The inhibition of pyroptosis includes: significantly reducing GSDMD expression levels.

7. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises a first pharmaceutical component and a second pharmaceutical component, wherein the first pharmaceutical component is p-coumaric acid; and the second pharmaceutical component is optionally a pharmaceutical component for lowering uric acid levels.

8. A drug combination for companion diagnostics, characterized in that, The drug combination comprises: (a) p-Coumaric acid; (b) Detection reagent for cathepsin B (CTSB).

9. The use of the pharmaceutical composition of claim 7 or the pharmaceutical composition of claim 8, characterized in that, This is used to prepare a medicine box for treating hyperuricemic nephropathy.

10. A medicine box, characterized in that, The medicine box contains the pharmaceutical composition of claim 7 or the pharmaceutical composition of claim 8.

Images