An antimicrobial peptide, its preparation method, and its application in the preparation of formulations for treating pneumonia.

Abstract

The application discloses an antibacterial peptide, a preparation method thereof and application of the antibacterial peptide in preparation of a preparation for treating pneumonia, and belongs to the technical field of biological medicines. The antibacterial peptide is a mutant of endolysin derived from a gram-negative bacteriophage. The bacteriophage endolysin plays an antibacterial / killing effect by degrading bacterial cell walls, and basically does not produce drug resistance. Common pneumonia pathogenic bacteria, i.e., Moraxella catarrhalis, Streptococcus pneumoniae and Staphylococcus aureus, are used as indicator bacteria, three antibacterial peptide mutants EAMP-M1, EAMP-M2 and EAMP-M3 with better antibacterial effects are screened, experiments prove that the three antibacterial peptide mutants have better antibacterial effects on gram-positive bacteria and gram-negative bacteria, can be applied to prevention, treatment or auxiliary antibiotic treatment of common pneumonia infection, and can be used in the field of medical instruments, such as sterilization of surgical instruments, and have a wide and good market application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to an antimicrobial peptide, its preparation method, and its application in the preparation of formulations for treating pneumonia. Background Technology

[0002] Pneumonia, especially bacterial pneumonia, is one of the leading causes of morbidity and mortality worldwide. Currently, antibiotics are the first-line drugs for treating bacterial pneumonia. However, with the overuse and misuse of antibiotics, the emergence and spread of multidrug-resistant bacteria (such as methicillin-resistant Staphylococcus aureus (MRSA) and carbapenem-resistant Klebsiella pneumoniae (CRKP)) has constituted a serious global public health crisis, urgently requiring the development of antimicrobial agents with novel mechanisms of action.

[0003] Bacteriophages, or viruses that infect bacteria, have evolved a highly efficient and precise weapon for lysing host bacteria—endolysins—through a long process of co-evolution. Endolysins are cell wall hydrolases expressed by bacteriophages at the end of infection. Their function is to hydrolyze the peptidoglycan layer of the bacterial cell wall from within, causing the bacteria to lyse due to osmotic imbalance and releasing progeny bacteriophages. Compared with traditional antibiotics, exogenously recombinant bacteriophage endolysins exhibit revolutionary advantages as antibacterial agents:

[0004] Unique mechanism of action: Endolysin acts directly on a highly conserved target, cell wall peptidoglycan. Such targets are not easily mutated, making it extremely difficult to induce antibiotic resistance in bacteria.

[0005] Highly efficient bactericidal speed: Endolysins do not need to enter the bacteria; they can directly attack the cell wall and usually achieve lysis within minutes. Their bactericidal speed is much faster than most traditional antibiotics.

[0006] High specificity: Endolysins are usually highly specific to specific genera or species of bacteria, and can accurately eliminate pathogens without disrupting the normal flora, thereby significantly reducing side effects such as microecological disturbances caused by treatment.

[0007] Effective removal of biofilms: Studies have shown that many endosomalins can effectively penetrate and lyse bacteria in a biofilm state, which is a key factor leading to chronic infections and antibiotic treatment failure.

[0008] Although phage endolysins have shown great potential in treating Gram-positive bacterial infections (such as Streptococcus pneumoniae and Staphylococcus aureus), their clinical application, especially in the local administration of phages for pneumonia, still faces challenges. For example, their in vivo half-life, stability in complex pulmonary secretions, and effective targeting of certain Gram-negative bacteria (whose outer membranes can hinder endolysin access to the peptidoglycan layer) remain technical bottlenecks that need to be overcome.

[0009] Therefore, there is an urgent need in the field to develop novel antimicrobial compositions or engineered endolysin mutants based on phage endolysins to address their limitations in stability, delivery efficiency, or antimicrobial spectrum, thereby providing a safer and more effective new treatment strategy for combating drug-resistant pneumonia. Summary of the Invention

[0010] The purpose of this invention is to provide an antimicrobial peptide, its preparation method, and its application in the preparation of formulations for treating pneumonia. The antimicrobial peptide described in this invention is a mutant derived from the endolysin of Gram-negative bacterial bacteriophages. The endolysin exerts its antibacterial / bactericidal effect by degrading the bacterial cell wall and essentially does not induce drug resistance. Using common pneumonia pathogens—Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus—as indicator bacteria, this invention screened and obtained three antimicrobial peptide mutants with good antibacterial effects: antimicrobial peptides EAMP-M1, EAMP-M2, and EAMP-M3.

[0011] To achieve the above objectives, the present invention employs the following technical solution:

[0012] This invention provides an antimicrobial peptide EAMP-M1, the amino acid sequence of which is shown in SEQ ID NO: 3, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO: 4. The antimicrobial peptide EAMP-M1 is a mutant obtained by changing the methionine at position 61 of the antimicrobial peptide with the amino acid sequence SEQ ID NO: 1 to phenylalanine, the threonine at position 196 to proline, and the methionine at position 226 to leucine.

[0013] The present invention also provides an antimicrobial peptide EAMP-M2, the amino acid sequence of which is shown in SEQ ID NO: 5, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO: 6; the antimicrobial peptide EAMP-M2 is an antimicrobial peptide mutant obtained by changing methionine at position 61 to phenylalanine, threonine at position 196 to proline, aspartic acid at position 90 to glutamic acid, and threonine at position 115 to valine.

[0014] The present invention also provides an antimicrobial peptide EAMP-M3, the amino acid sequence of which is shown in SEQ ID NO: 7, and the nucleotide sequence of its encoding gene is shown in SEQ ID NO: 8; the antimicrobial peptide EAMP-M3 is an antimicrobial peptide mutant obtained by changing methionine at position 61 to phenylalanine, threonine at position 196 to proline, methionine at position 226 to leucine, and glutamine at position 249 to lysine.

[0015] The present invention also provides a recombinant expression vector containing the coding gene of the antimicrobial peptide EAMP-M1, or the coding gene of the antimicrobial peptide EAMP-M2, or the coding gene of the antimicrobial peptide EAMP-M3.

[0016] The present invention also provides genetically engineered bacteria containing the coding gene of the antimicrobial peptide EAMP-M1, or containing the coding gene of the antimicrobial peptide EAMP-M2, or containing the coding gene of the antimicrobial peptide EAMP-M3, wherein the genetically engineered bacteria are Pichia pastoris, Bacillus subtilis, or Bacillus licheniformis.

[0017] The present invention also provides a method for preparing the antimicrobial peptide EAMP-M1, the antimicrobial peptide EAMP-M2, or the antimicrobial peptide EAMP-M3, the preparation method comprising the following steps:

[0018] (1) The coding gene corresponding to the antimicrobial peptide was cloned into the expression vector pPIC9K plasmid. Eco R The I and Not I sites were used to transform E. coli, and the recombinant plasmid was obtained after sequencing verification.

[0019] (2) The recombinant plasmid was extracted, linearized by Sal I restriction enzyme digestion, and then transformed into Pichia pastoris for expression and screening;

[0020] (3) The selected transformants with high antibacterial activity, namely the antimicrobial peptide genetically engineered bacteria, are fermented in a fermenter and then centrifuged to obtain antimicrobial peptide EAMP-M1, antimicrobial peptide EAMP-M2, or antimicrobial peptide EAMP-M3.

[0021] The present invention also provides the use of antimicrobial peptides in the preparation of formulations for treating pneumonia, wherein the antimicrobial peptide is at least one of the antimicrobial peptide EAMP-M1, the antimicrobial peptide EAMP-M2, or the antimicrobial peptide EAMP-M3.

[0022] Furthermore, the content of antimicrobial peptides in the formulation is 10 mg / kg to 50 mg / kg.

[0023] Furthermore, the formulation is an antibacterial agent used to inhibit Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus.

[0024] Furthermore, the preparation is used in combination with antibiotics to treat pneumonia infection.

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] The antimicrobial peptides EAMP-M1, EAMP-M2, and EAMP-M3 obtained in this invention are mutants of phage endolysins. Their core function is to directly act on the highly conserved target site of cell wall peptidoglycan. Such targets are not easily mutated, thus making it extremely difficult to induce bacterial resistance. Using pneumonia pathogens as indicator bacteria, this invention screened antimicrobial peptide mutants with enhanced antibacterial effects against Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus, providing a new approach for developing specific, highly effective, and safe antimicrobial agents. The antimicrobial peptides of this invention can be used for the prevention, treatment, or adjuvant antibiotic treatment of common pneumonia infections; and in the medical device field, such as surgical instrument disinfection; and in the daily chemical field, such as antibacterial hand sanitizers and wound dressings. They have broad and promising market application prospects. Attached Figure Description

[0027] Figure 1 This is a diagram showing the amplification results of the gene fragment of the antimicrobial peptide in this invention;

[0028] Figure 2 The antimicrobial peptides were studied for their inhibitory effects against Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus.

[0029] Figure 3 The images show the heterologous expression of antimicrobial peptides in Pichia pastoris using SDS-PAGE, where numbers 1-3 represent EAMP-M1, EAMP-M2, and EAMP-M, respectively. Detailed Implementation

[0030] The following embodiments are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications may be made without departing from the technical solutions described in the claims. The protection and scope of the claims of the present invention are not limited to the examples provided.

[0031] Unless otherwise specified, the reagents and biological materials used in the following specific examples are commercially available.

[0032] 1. Strains and vectors

[0033] Pichia pastoris GS115, plasmid pPIC9K, Escherichia coli DH5α, Escherichia coli BL21, and plasmid pET 21a(+) were purchased from Invitrogen. Optimized genes were synthesized by Shanghai Jierui Biotechnology Co., Ltd. GeneMorph II random mutation PCR kit was purchased from Stratagene. Commercially available strains of Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus were used.

[0034] 2. Reagents and Culture Media

[0035] Plasmid extraction kits, fragment purification and recovery kits, restriction endonucleases, etc., were purchased from Takara Bio Engineering (Dalian) Co., Ltd.; gene sequencing, ampicillin, IPTG, etc., were purchased from Sangon Biotech (Shanghai) Co., Ltd.; gene cloning homologous recombination reagents were purchased from Nanjing Novizan Co., Ltd.

[0036] LB medium: 1% tryptone, 0.5% yeast extract, 1% NaCl;

[0037] MD medium: 1.34% YNB, 0.4 mg / L biotin, 2% glucose, 2% agar powder;

[0038] (Preparation method: First, mix 2g glucose and 2g agar powder with distilled water and bring the volume to 90mL. Sterilize at 115℃ for 30min. When using, wait for the culture medium to cool to about 60℃ and then add 10mL of pre-prepared and filtered sterilized 10×YNB and 200μL of 0.2g / L biotin.)

[0039] YPD medium (1L): 10g yeast extract, 20g peptone, 20g glucose;

[0040] Fermentation medium (1L): 10g glycerol, 10g yeast extract, 20g tryptone, 11.8g KH2PO4, 3g K2HPO4;

[0041] When the above culture medium is solid, add 2% agar powder and sterilize at 115℃ for 20 minutes.

[0042] 3. Preparation method of Pichia pastoris GS115 electrotransformation competent cells

[0043] (1) Pick a single colony of Pichia pastoris that is growing vigorously in YPD plate and inoculate it into a 5mL YPD liquid test tube. Incubate overnight at 30℃ and 200rpm for 16~18h.

[0044] (2) Transfer the overnight culture to a small Erlenmeyer flask (100 mL Erlenmeyer flask) containing 20 mL of fresh YPD liquid medium at an inoculation rate of 2%~5%. OD after inoculation 600Approximately 0.2~0.4, incubate at 30℃ with shaking at 200 rpm for 6~8 hours until the bacterial cell OD reaches 0.2~0.4. 600 Reaching 1.3~1.5;

[0045] (3) Transfer the cultured bacterial solution to a 50mL centrifuge tube, centrifuge at 4℃ and 6000rpm for 2min, and then discard the supernatant.

[0046] (4) Add 20 mL of pre-cooled sterile water to resuspend and wash the bacterial cells, centrifuge at 4°C and 6000 rpm for 2 min, and discard the supernatant;

[0047] (5) Repeat step 4;

[0048] (6) Add 10 mL of ice-cold 1M sorbitol to resuspend the bacterial cells, centrifuge at 4℃ and 6000 rpm for 2 min and discard the supernatant.

[0049] (7) Add 1 mL of ice-cold sorbitol to resuspend the competent cells, and dispense 100 μL / tube into sterile 1.5 mL EP tubes.

[0050] 4. Electroconversion method for Pichia pastoris GS115

[0051] (1) Add 15 μL of linearized DNA fragment (pPIC9K vector, linearized by SalI digestion and purified) with a concentration greater than 100 ng / μL to 100 μL of yeast competent cells, mix well and incubate on ice for 5 min.

[0052] (2) Transfer the mixture of competent cells and DNA into an electroporation vessel and incubate on ice for 5 min;

[0053] (3) Wipe the electric converter dry with paper, and then perform an electric shock conversion. The electric shock conditions are 1.5kV and 5msec.

[0054] (4) Immediately after the electric shock, add 1 mL of cooled 1M sorbitol, transfer the liquid into a 1.5 mL EP tube, and incubate in a 30°C incubator for 1 h;

[0055] (5) Centrifuge at 6000 rpm for 3 min, leave 200 μL of liquid to resuspend the bacteria, and then take 100 μL of the bacteria and spread them onto MD plates. Each sample is spread onto 2 plates.

[0056] (6) Invert the transformation plate at 30℃ for 2 days to grow transformants.

[0057] 5. Primary screening of the 48-well plate small system for converters

[0058] (1) Transfer the transformants on the MD plate to the gridded YPD plate with a toothpick. After 2-3 days, when the colony diameter reaches 2-3 mm, pick up an appropriate amount of bacteria with a white pipette tip and inoculate it into a sterile well plate (48-well plate, glycerol fermentation medium, 1 mL liquid volume). Cover and seal with a sterile breathable membrane and incubate with shaking at 200 rpm and 30°C.

[0059] (2) After 24 hours of inoculation, add 50 μL of diluted methanol (methanol: sterile water = 1:5, volume ratio) for induction. Then add 50 μL of diluted methanol (methanol: sterile water = 1:5) every 24 hours for a total of two times (induction for 48 hours).

[0060] (3) After stopping the culture, the supernatant was collected by centrifugation at 4000 rpm at 4℃, and the enzyme activity was initially determined using a small system;

[0061] (4) Select high enzyme activity transformants and confirm their enzyme activity level using a large system;

[0062] (5) Preserve the high enzyme activity transformants with 30% glycerol.

[0063] Example 1: Gene optimization of antimicrobial peptides and construction of recombinant genetically engineered bacteria

[0064] This invention references the amino acid sequence of phage lysozyme (GenBank: WPJ48867.1), as shown in SEQ ID NO: 1, with a molecular weight of 28.68 kDa and containing 264 amino acids. The corresponding nucleotide sequence was obtained through base optimization technology, and the gene sequence was artificially synthesized, as shown in SEQ ID NO: 2, and is suitable for expression in Pichia pastoris.

[0065] The antimicrobial peptide gene was amplified using primers EF1 and ER1, and then ligated into the EcoRI and NotI sites of the expression vector pPIC9K via homologous recombination. This ligation was then used to transform *E. coli* DH5α. After sequencing verification, the correct recombinant vector was extracted and purified, linearized by SalI restriction enzyme digestion, and transformed into *Pichia pastoris* GS115 host cells. Transformants, i.e., the engineered strains of the antimicrobial peptide gene, were screened on MD plates.

[0066] EF1: AGAGGCTGAAGCTTACGTA GAATTC ATGGCTATTTTGAAGATTGG

[0067] (SEQ ID NO:9);

[0068] ER1: ATGTCTAAGGCGAATTAATTC GCGGCCGC TTAAGAAAAAGACTTGTAAGC

[0069] (SEQ ID NO:10).

[0070] Transfer the transformants from MD plates to YPD plates using toothpicks. After incubating at 30°C for 3 days, use a white pipette tip to pick up an appropriate amount of cells and inoculate them into a sterile well plate (48-well plate, glycerol fermentation medium, 1 mL). Cover and seal with a sterile breathable membrane and incubate with shaking at 200 rpm and 30°C. Add 50 μL of diluted methanol (methanol: sterile water = 1:5, final methanol concentration 1%) every 24 hours for induction, for a total of two additions (induction for 48 hours). After stopping the culture, centrifuge at 4°C and 4000 rpm to collect the supernatant for later use.

[0071] Staphylococcus aureus and Streptococcus pneumoniae were inoculated into LB liquid medium and cultured at 37°C with shaking at 200 rpm until the late stationary phase (approximately 16-20 hours). The bacterial culture was then appropriately diluted and added to LB solid medium that had been melted and cooled to approximately 50°C. The mixture was then poured into plates. After the plates solidified, wells were punched, and 50-100 μL of antimicrobial peptide fermentation broth was added to each well. The plates were then incubated at 37°C, and the diameter of the inhibition zones was observed to verify the antimicrobial activity of the antimicrobial peptide fermentation broth.

[0072] Example 2: Screening of antimicrobial peptide mutants and determination of antibacterial activity

[0073] Referring to the antimicrobial peptide gene and preliminary antibacterial activity assay method obtained in Example 1, a random mutagenesis method was used for multiple rounds of mutagenesis and screening. After extensive screening and assays, three relatively good antimicrobial peptide mutants, EAMP-M1, EAMP-M2, and EAMP-M3, were obtained. After sequencing analysis, the amino acid sequence of EAMP-M1 is shown in SEQ ID NO: 3, and the nucleotide sequence of its corresponding encoding gene is shown in SEQ ID NO: 4; the amino acid sequence of EAMP-M2 is shown in SEQ ID NO: 5, and the nucleotide sequence of its corresponding encoding gene is shown in SEQ ID NO: 6; the amino acid sequence of EAMP-M3 is shown in SEQ ID NO: 7, and the nucleotide sequence of its corresponding encoding gene is shown in SEQ ID NO: 8.

[0074] After repeated measurements, its inhibition zone diameter was as follows: Figure 2 As shown, the antimicrobial peptides EAMP-M1, EAMP-M2, and EAMP-M3 all significantly enhanced the antibacterial effects against three common pneumonia pathogens.

[0075] Example 3: Fermentation and preparation of antimicrobial peptides EAMP-M1, EAMP-M2, and EAMP-M3 in a 30L fermenter

[0076] Genetically engineered strains of antimicrobial peptides EAMP-M1, EAMP-M2, and EAMP-M3 were streaked onto YPD plates and cultured at 30°C for 3 days to produce single colonies. Healthy single colonies were selected and streaked again on YPD plates. Then, single colonies of Pichia pastoris were inoculated into 50 mL of BMGY medium and cultured at 30°C and 200 rpm for 24 h. Finally, 2% of the inoculum was added to 300 mL of BMGY medium and cultured at 30°C and 200 rpm until the OD600 reached 5. This culture was then used as seed culture for inoculating fermenters. Fermentation production process: BSM medium, pH 4.8, temperature 30℃, stirring speed 500rpm, ventilation 1.5 (v / v), dissolved oxygen controlled above 20%. The fermentation process is divided into three stages: (1) Cell culture stage: seed liquid is introduced at a ratio of 8%, cultured at 30℃ for 20-24h to deplete the glycerol in the fermentation broth; (2) Starvation stage: when the carbon source glycerol is depleted, no carbon source is added temporarily, and the starvation stage ends when the dissolved oxygen rises to 80%; (3) Induction expression stage: pH is adjusted to the required value with ammonia or phosphoric acid, methanol is added for induction, and dissolved oxygen is kept above 20%, and the induction time is 160-200h; after fermentation, the fermentation broth is processed by plate and frame filter and then sprayed dry into powder by spray tower for application testing.

[0077] The fermented antimicrobial peptide broth was subjected to SDS-PAGE protein gel analysis, and the results are as follows: Figure 3 As shown, the protein molecular weight of the antimicrobial peptide is 28.68 kDa, and the band size in the image matches the theoretical value, proving that the expression was successful.

[0078] Example 4: Therapeutic effect of antimicrobial peptides on a mouse model of pneumonia

[0079] The three antimicrobial peptide spray-dried powders from Example 3 above were mixed and dissolved in sterile physiological saline.

[0080] (1) Experimental design

[0081] After culturing the pneumonia-causing bacteria Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus, a mixture was prepared in a specific ratio and administered to mice via inhalation. Infected mice were randomly divided into the following groups (n=10 per group):

[0082] Model control group: infection + normal saline;

[0083] Positive control group: Infection + vancomycin (20 mg / kg, intranasal instillation (same as infection method), twice daily);

[0084] Low-dose group of the composition: Infection + low-dose antimicrobial peptide composition (10 mg / kg, three antimicrobial peptides mixed in equal amounts, intranasal instillation (same as infection method), twice daily);

[0085] Medium-dose group of the composition: Infection + medium-dose antimicrobial peptide composition (20 mg / kg, three antimicrobial peptides mixed in equal amounts, intranasal instillation (same as infection method), twice daily);

[0086] High-dose combination group: Infection + high-dose antimicrobial peptide composition (40 mg / kg, three antimicrobial peptides mixed in equal amounts, intranasal instillation (same as infection method), twice daily);

[0087] Blank control group: No infection + normal saline;

[0088] Dosage timing: The first treatment usually begins 12 hours after infection (simulating post-treatment dosing), followed by 1-2 doses daily for 2-3 days.

[0089] Record: Observe and record the mice's weight, activity level, fur condition, and survival status daily.

[0090] (2) Sample collection and analysis (48 or 72 hours after infection)

[0091] Bronchoalveolar lavage fluid (BALF) collection: Expose the trachea, insert the indwelling needle cannula and ligate it.

[0092] Irrigate the lungs with 0.8 mL of pre-cooled sterile PBS, gently aspirate 3 times, and recover the lavage fluid (usually 0.6-0.7 mL can be recovered). Repeat once and combine the lavage fluids.

[0093] Centrifuge the cells in BALF (4°C, 1500 rpm, 10 min), aliquot the supernatant and store at -80°C for subsequent analysis of inflammatory factors (ELISA detection); use the cell pellet for cell classification and counting on smears.

[0094] (3) Detection indicators and results:

[0095] Table 1. Mouse survival rate and bacterial load

[0096] ,

[0097] Experimental results showed that high doses of the antimicrobial peptide composition could significantly improve the survival rate of mice and reduce the bacterial load in the lungs by four orders of magnitude, achieving an effect almost equivalent to that of antibiotics. This indicates that a certain dose of the antimicrobial peptide composition can effectively inhibit pneumonia pathogens.

[0098] Table 2. Levels of inflammatory factors (pg / mL) in bronchoalveolar lavage fluid (BALF) of mice in each group.

[0099] ,

[0100] As shown in Table 2, the levels of key pro-inflammatory factors (TNF-α, IL-6, IL-1β, KC) in the BALF of the model control mice were significantly elevated, indicating that the lung infection model was successfully established and triggered a severe inflammatory response. The antimicrobial peptide composition provided by this invention reduced the levels of pro-inflammatory factors to varying degrees at all dosage groups. The therapeutic effects of the medium and high dose groups were comparable to those of the positive control drug vancomycin, and the high dose group even outperformed the vancomycin group in some indicators (such as TNF-α).

[0101] It is noteworthy that the reduction in pro-inflammatory factors was not solely due to a decrease in bacterial count, as the high-dose group of the composition showed a stronger trend in reducing IL-1β and KC levels than the vancomycin group. This suggests that, in addition to directly reducing inflammation through direct antibacterial / bactericidal action, the composition of this invention can also directly regulate the host's immune response and suppress excessive 'cytokine storm'. Regarding the anti-inflammatory factor IL-10, there were no significant differences or slight increases between the treatment groups and the model control group, but these were not statistically significant. This indicates that the composition of this invention can intelligently inhibit harmful excessive pro-inflammatory responses without significantly interfering with the body's beneficial anti-inflammatory repair mechanisms, demonstrating its excellent immunomodulatory balance.

[0102] Example 5: A highly effective antibacterial and disinfectant hand sanitizer containing an antimicrobial peptide composition and its preparation method

[0103] Hands are a major medium for the spread of pathogens, especially drug-resistant bacteria. Currently available alcohol-based hand sanitizers have limited effectiveness against certain bacteria or spore-forming bacteria, and long-term use can easily lead to dry and irritated skin. Disinfectants based on antimicrobial peptides promise to provide a broad-spectrum, gentle, and less likely to induce drug resistance alternatives.

[0104] (1) Preparation of hand sanitizer formula:

[0105] Basic formula: 60% deionized water, 30% ethanol (v / v), 2% glycerin (as a humectant), 0.5% carbomer (as a gel matrix), and triethanolamine (as needed to adjust the pH to neutral).

[0106] Experimental group: The antimicrobial peptide composition of the present invention (three antimicrobial peptides mixed in equal amounts) was added to the basic formula, with a final concentration of 0.1% (w / v).

[0107] Positive control group: Does not contain the antimicrobial peptide composition of the present invention, but has an ethanol content of 62% (reaching the alcohol concentration of conventional hand sanitizers).

[0108] Negative control group: Base gel without ethanol and the antimicrobial peptide composition of the present invention.

[0109] (2) Rapid sterilization effect evaluation (following a method similar to EN1500 standard):

[0110] The volunteers immersed their fingertips in a mixed bacterial solution containing Moraxella catarrhalis, Streptococcus pneumoniae, and Staphylococcus aureus (~10^8 CFU / mL) for 1 minute.

[0111] After drying, wash hands for 30 seconds or 1 minute using a certain dose (3 mL) of the above-mentioned experimental group, positive control group and negative control group hand sanitizer according to the standard method.

[0112] Rinse fingers with neutralizing solution and collect the wash solution for dilution and plate counting.

[0113] Preliminary assessment of skin irritation:

[0114] Using in vitro skin models (such as EpiDerm™ artificial epidermis) or rabbit skin irritation experiments, we evaluated whether the hand sanitizer formulation of this invention reduced the toxicity or irritation to skin cells compared to high-concentration alcohol hand sanitizers.

[0115] (4) Results and Analysis

[0116] Table 3 Skin disinfection effect

[0117] ,

[0118] Experimental results demonstrate that the negative control group had almost no bactericidal effect; the positive control group (high concentration of alcohol) achieved approximately 98% disinfection within 1 minute; the hand sanitizer in the experimental group of this invention (containing only 30% alcohol) showed a disinfection effect comparable to the positive control group within 1 minute, indicating that its performance is comparable to 62% alcohol hand sanitizer, but with a significantly lower alcohol content. Furthermore, in vitro skin model experiments showed that the hand sanitizer of this invention had a significantly smaller impact on skin cell vitality than the 62% alcohol control group, making it safer and gentler on the skin.

[0119] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. An antibacterial peptide EAMP-M1, characterized in that, The amino acid sequence of the antibacterial peptide EAMP-M1 is shown as SEQ ID NO: 3, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO: 4; the antibacterial peptide EAMP-M1 is an antibacterial peptide mutant obtained by changing the methionine at position 61 to phenylalanine, the threonine at position 196 to proline, and the methionine at position 226 to leucine of the antibacterial peptide with the amino acid sequence of SEQ ID NO:

1.

2. An antibacterial peptide EAMP-M2, characterized in that, The amino acid sequence of the antibacterial peptide EAMP-M2 is shown as SEQ ID NO: 5, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO: 6; the antibacterial peptide EAMP-M2 is an antibacterial peptide mutant obtained by changing the methionine at position 61 to phenylalanine, the threonine at position 196 to proline, the aspartic acid at position 90 to glutamic acid, and the threonine at position 115 to valine of the antibacterial peptide with the amino acid sequence of SEQ ID NO:

1.

3. An antibacterial peptide EAMP-M3, characterized in that, The amino acid sequence of the antibacterial peptide EAMP-M3 is shown as SEQ ID NO: 7, and the nucleotide sequence of the encoding gene is shown as SEQ ID NO: 8; the antibacterial peptide EAMP-M3 is an antibacterial peptide mutant obtained by changing the methionine at position 61 to phenylalanine, the threonine at position 196 to proline, the methionine at position 226 to leucine, and the glutamine at position 249 to lysine of the antibacterial peptide with the amino acid sequence of SEQ ID NO:

1.

4. A recombinant expression vector containing the encoding gene of the antibacterial peptide EAMP-M1 of claim 1, or the encoding gene of the antibacterial peptide EAMP-M2 of claim 2, or the encoding gene of the antibacterial peptide EAMP-M3 of claim 3.

5. A genetically engineered bacterium containing a gene encoding the antibacterial peptide EAMP-M1 according to claim 1, or a gene encoding the antibacterial peptide EAMP-M2 according to claim 2, or a gene encoding the antibacterial peptide EAMP-M3 according to claim 3, characterized in that, The genetically engineered bacteria are Pichia pastoris, Bacillus subtilis, or Bacillus licheniformis.

6. A method for preparing the antibacterial peptide EAMP-M1 of claim 1 or the antibacterial peptide EAMP-M2 of claim 2 or the antibacterial peptide EAMP-M3 of claim 3, characterized in that, The preparation method comprises the following steps: (1) The coding gene of the antibacterial peptide is cloned into the expression vector pPIC9K plasmid Eco RI and Not I sites, and the recombinant plasmid is obtained by transforming E. coli and sequencing verification. (2) The recombinant plasmid is extracted, linearized after Sal I enzyme digestion, and transformed into Pichia pastoris for expression and screening; (3) The transformant with high antibacterial activity, i.e., the antibacterial peptide genetically engineered bacteria, is subjected to fermentation tank fermentation, and the antibacterial peptide EAMP-M1 or the antibacterial peptide EAMP-M2 or the antibacterial peptide EAMP-M3 is obtained after centrifugal treatment.

7. Use of an antibacterial peptide for the preparation of a formulation for the treatment of pneumonia caused by an infection with Moraxella catarrhalis, Streptococcus pneumoniae or Staphylococcus aureus, characterised in that, The antibacterial peptide is at least one of the antibacterial peptide EAMP-M1 of claim 1, the antibacterial peptide EAMP-M2 of claim 2, and the antibacterial peptide EAMP-M3 of claim 3.

8. Use according to claim 7, characterized in that, The preparation is combined with antibiotics for treating pneumonia.

Images