SNP (Single Nucleotide Polymorphism) molecular marker related to concentration of butyric acid in rumen of dairy cow, detection primer pair and application of SNP molecular marker

Abstract

The invention discloses a dairy cow rumen butyric acid concentration related SNP molecular marker, a detection primer pair and application thereof, and belongs to the technical field of molecular biology and genetic breeding. The SNP site is located in a fourth intron of an SPINK5 gene, the number of the SNP site is Bovine HD0700017637, and the SNP site is subjected to Agt; the site is subjected to basic group mutation of G, and the site has three genotypes, namely AA, AG and GG. When the genotype of the SNP site is AG and GG, the dairy cow individual has higher rumen butyric acid concentration. The SNP molecular marker can be used for screening and identifying dairy cows with high rumen butyric acid level, and then dairy cow individuals with high rumen butyric acid concentration are selected for cattle herd optimization and assistant breeding.

Description

Technical Field

[0001] This invention relates to a molecular marker for SNPs related to rumen butyrate concentration in dairy cows, a detection primer pair, and their applications, belonging to the fields of molecular biology and genetic breeding technology. Background Technology

[0002] Rumen metabolic efficiency in dairy cows is a key factor affecting dairy product production performance and the economic benefits of dairy farming. The rumen is a vital organ for dairy cows to digest feed and generate volatile fatty acids. Volatile fatty acids, including acetic acid, propionic acid, and butyric acid, are not only core intermediate products of energy metabolism in dairy cows but also major factors influencing dairy product yield and quality. Increasing the concentration of butyric acid in the rumen can not only improve feed conversion ratio and reduce farming costs but also reduce rumen methane emissions, contributing to environmentally friendly farming. However, measuring the butyric acid content in the rumen involves a somewhat painful procedure on the animals, which may affect normal animal production efficiency. Furthermore, the processing steps for rumen fluid are complex, requiring gas chromatography, which is inconvenient.

[0003] In recent years, the development of molecular breeding technology has provided an important means for the precise improvement of dairy cow performance. Through genome-wide association analysis (GWAS), researchers have successfully screened SNP loci closely related to various economic traits in dairy cows. For example, the rs110326785 locus of the NPFFR2 gene was found to be significantly associated with resistance to metritis in dairy cows (CN202510678621.3); the 27108th base of the EBPL gene can be used to breed cattle with high intramuscular fat (CN202411264080.1). However, current research on genetic markers for rumen VFA concentration in dairy cows is still limited, especially molecular markers directly related to rumen butyrate concentration have not been fully explored.

[0004] The SPINK5 gene is a key gene encoding a serine protease inhibitor. Mice lacking SPINK5 exhibit severely impaired congenital skin barrier function, rapidly developing widespread desquamation and erythema after birth, significantly increased transepidermal water loss, and enhanced susceptibility to infection, often dying during the perinatal period due to dehydration and electrolyte imbalance. However, the correlation between SPINK5 and rumen butyrate concentration is currently unknown. Therefore, identifying and screening SNP sites in this gene will provide an important theoretical basis and experimental evidence for increasing rumen butyrate concentration, and will offer crucial molecular markers for ruminant breeding. Summary of the Invention

[0005] Objectives of this invention: The first objective is to provide a SNP molecular marker related to rumen butyrate concentration in dairy cows. The second objective is to provide PCR detection primer pairs and kits for detecting the above-mentioned SNP molecular marker. The third objective is to provide a method for screening dairy cows with high rumen butyrate concentrations. The fourth objective is to provide the application of the above-mentioned SNP molecular marker in assisted breeding of dairy cows with high rumen butyrate concentrations.

[0006] Technical solution: The SNP molecular marker related to rumen butyrate concentration in dairy cows described in this invention is located in the fourth intron of the SPINK5 gene, numbered BovineHD0700017637. The SNP site has an A>G base mutation, and there are three genotypes at this site, namely AA, AG and GG.

[0007] Furthermore, when the genotype of this SNP locus is AG or GG, the individual dairy cows have higher rumen butyrate concentrations.

[0008] The PCR detection primer pair described in this invention is a primer pair for detecting the SNP site BovineHD0700017637, and the nucleotide sequence is shown in SEQ ID NO:2-3.

[0009] The kit described in this invention contains the above-mentioned PCR detection primer pair.

[0010] Furthermore, the kit also contains Gloria Nova HS2X Master Mix and ddH2O.

[0011] The application of the SNP molecular marker, the PCR detection primer pair, and the kit described in this invention in determining the concentration of butyric acid in the rumen of dairy cows.

[0012] The method for screening dairy cows with high rumen butyrate concentrations according to the present invention includes the following steps:

[0013] (1) Extract genomic DNA from the dairy cows to be tested;

[0014] (2) Using the genomic DNA obtained in step (1) as a template, the amplification product is obtained by PCR reaction using the primer pair in claim 3;

[0015] (3) Sequencing the amplification product. When the genotype of the SNP site at position 93 of the amplification product is GG or GA, the dairy cow to be tested belongs to the dairy cow with high rumen butyric acid content.

[0016] Furthermore, the PCR reaction procedure is as follows: pre-denaturation at 94°C for 3 minutes; denaturation at 95°C for 15 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 10 seconds, 35 cycles; and extension at 72°C for 5 minutes.

[0017] The application of the SNP molecular marker described in this invention in rumen butyrate-assisted breeding of dairy cows with high concentrations of butyrate.

[0018] Beneficial Effects: Compared with existing technologies, this invention has the following significant advantages: Utilizing genome-wide association analysis, this invention screened the SPINK5 gene as a candidate gene for high rumen butyrate concentration in Holstein cattle. Furthermore, it identified an A>G mutation SNP site, BovineHD0700017637, located on the fourth intron of SPINK5, which is significantly correlated with rumen butyrate content in Holstein cattle (P<1.03x10⁻¹¹). For the rumen butyrate concentration trait, the GG and GA genotypes at the above SNP site are the dominant alleles, meaning individuals with the GG and GA genotypes have higher rumen butyrate concentrations. These can be used to screen and identify dairy cows with high rumen butyrate levels, and subsequently, to select individuals with high rumen butyrate concentrations for herd optimization and assisted breeding. Attached Figure Description

[0019] Figure 1 SNP site screening results.

[0020] Figure 2 The relationship between different genotypes at the BovineHD0700017637 locus and individual rumen butyrate levels in the experimental population.

[0021] Figure 3 To validate the rumen butyrate levels in individuals with different genotypes at the BovineHD0700017637 locus in the population.

[0022] Figure 4 SEQ ID NO:1 amplification electrophoresis image.

[0023] Figure 5 Sequencing results of the SNP (BovineHD0700017637) associated with rumen butyrate concentration in dairy cows. Detailed Implementation

[0024] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0025] Example 1: Screening of SNP sites

[0026] 1. Using genome-wide association analysis, the SPINK5 gene was screened as a candidate gene for detecting butyrate content in the rumen of Holstein cattle.

[0027] (1) Samples were collected from 506 Holstein cows in mid-lactation who were fed the same diet at four large-scale dairy farms in Weifang City, Shandong Province, Binzhou City, Shandong Province, Lianyungang City, Jiangsu Province, and Bengbu City, Anhui Province, China. Peripheral blood and rumen fluid samples were collected from each cow.

[0028] (2) After extracting genomic DNA from the blood, genotyping was performed using the Bovine 100K SNP chip on the Illumina platform to obtain SNP locus genotype information for each cow. The concentration of butyric acid in the rumen fluid was quantitatively determined using gas chromatography.

[0029] (3) Using GEMMA software and a mixed linear model, genome-wide association analysis was performed on the rumen butyrate levels of the above 506 dairy cows and the genotypes of the SNP loci obtained by typing. The P-value was corrected by multiple tests using the FDR method.

[0030] (4) Figure 1 As shown, genome-wide association analysis identified for the first time a SNP site, BovineHD0700017637 (A>G), located in the fourth intron of SPINK5, which was highly significantly correlated with rumen butyrate concentration in Holstein dairy cows (P<1.03x10⁻¹). -11 ).

[0031] 2. Determine the dominant genotype for rumen hyperbutyrate levels at SNP sites in the SPINK5 gene.

[0032] (1) The SNP site BovineHD0700017637 was selected as the linkage genetic marker site in the SPINK5 gene region. All 506 dairy cows were genotyped according to the base mutation type at this site and divided into three genetic groups: AA, AG, and GG.

[0033] (2) The rumen VFA content of dairy cows in the three genetic groups AA, AG and GG were counted respectively. The Kruskal-Wallis test (non-parametric) and one-way ANOVA (parametric method) were used to evaluate the differences between groups. Based on this, the ability and application feasibility of BovineHD0700017637 locus (SPINK5 gene region marker) to distinguish rumen fermentation phenotype (butyric acid concentration) were confirmed.

[0034] (3) Figure 2As shown, the wild-type homozygous AA genotype had the lowest rumen butyrate concentration, which was significantly lower (P<0.0001) than the heterozygous AG genotype and significantly lower (P<0.0001) than the homozygous mutant GG genotype. However, there was no significant difference in rumen butyrate content between the AG and GG genotypes (P=0.433). In conclusion, in the Holstein cattle population, individuals with the AG and GG genotypes have higher rumen butyrate concentrations.

[0035] Example 2: Validation of the correlation between SNP sites and rumen butyrate concentration in dairy cows

[0036] (1) To verify the relationship between the BovineHD070001763 locus and rumen butyrate concentration in Holstein cattle, samples were collected from 96 Holstein cows in mid-lactation and fed the same diet at a large-scale dairy farm in Weinan City, Shaanxi Province, China. To reduce confounding factors from environmental and dietary differences, all individuals were kept under the same feeding and management conditions. Peripheral blood and rumen fluid samples were collected from each cow. Blood DNA was extracted for microarray analysis, and rumen butyrate concentration was determined.

[0037] (2) The rumen VFA content of dairy cows in the AA, AG, and GG genetic groups was statistically analyzed. The Kruskal-Wallis test (non-parametric) and one-way ANOVA (parametric method) were used to assess differences between groups. Based on this, the discriminatory power and feasibility of the Bovine HD0700017637 locus in distinguishing rumen butyrate concentration in Holstein cattle were confirmed. The results are shown in […]. Figure 3 .

[0038] (3) The test results showed that three genotypes existed in the validation Holstein dairy cattle population. Among all the validation populations, the GG genotype had the highest rumen butyrate concentration, which was significantly higher than that of the AA genotype (P<0.01), followed by the AG genotype, which was also significantly higher than that of the AA genotype (P<0.05). However, there was no significant difference in rumen butyrate concentration between the AG and GG genotypes (P=0.6665), consistent with the results in Example 1. This indicates that the BovineHD0700017637 locus in the SPINK5 gene can be used to predict rumen butyrate concentration in Holstein cattle.

[0039] Example 3: Method for detecting the genotype of the SNP locus BovineHD0700017637

[0040] (1) Select the Holstein cattle population of interest, collect venous blood, and extract genomic DNA using a kit.

[0041] (2) PCR primers were designed upstream and downstream of the BovineHD0700017637 site based on the bovine SPINK5 gene sequence (GenBank accession number NC_037334.1):

[0042] Forward primer: 5'-atcattttccctcgtgcatc-3' (SEQ ID NO:2);

[0043] Reverse primer: 5'-agggcgaggactgtgttcta-3' (SEQ ID NO:3).

[0044] (3) PCR amplification and sequencing for genotyping analysis

[0045] The PCR amplification system consisted of 25 μL, including 0.5 μL (10 μmol / L) each of the corresponding upstream and downstream primers, 12.5 μL of GloriaNovaHS2X Master Mix (high-fidelity Taq enzyme), 1.0 μL (50 ng) of DNA template, and 10.5 μL of ddH2O.

[0046] The PCR reaction program was as follows: 94℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 10 seconds, for 35 cycles; 72℃ extension for 5 minutes. The PCR product was 332 bp in length, and the agarose gel results are shown below. Figure 4 As shown.

[0047] The specific sequence is as follows:

[0048] 5'-atcattttccctcgtgcatccaagtcttccatccctcacataaggccgaaaatcactacatatatcctgaagaacagagaaa ggaacgtgac a tttaccatcctgatggtaatgcttacaacactgccttcagaaattttatagagcccagtggccctctgcccaggacacac cagctacctggagcagtgccagtgtgtagaagcaggtcattaagtgctgtgtaattcacatggttaactatagagctcatttacttgtttat catttgttagtaaacgtggatagcctgtgatgtgctagaaccaagttagaacacagtcctcgccct-3' (SEQ ID NO: 1).

[0049] In the sequence, the underlined position indicates the SNP (BovineHD0700017637) site associated with the concentration of butyrate in the rumen of dairy cows.

[0050] The PCR products were then subjected to Sanger sequencing, and the sequencing results were viewed and analyzed using Chromas software. Figure 5 This demonstrates the different genotypes of the SNP locus BovineHD0700017637.

Claims

1. A bovine rumen butyrate concentration-related SNP molecular marker, characterized in that, The SNP site is located in the fourth intron of the SPINK5 gene, numbered BovineHD0700017637. The SNP site has an A>G base mutation, and there are three genotypes at this site, namely AA, AG and GG.

2. The SNP molecular marker according to claim 1, characterized in that, When the genotype of this SNP locus is AG or GG, dairy cows have higher rumen butyrate concentrations.

3. A PCR detection primer pair, characterized in that, The primer pair is for detecting the SNP site BovineHD0700017637, and the nucleotide sequence is shown in SEQ ID NO:2-3.

4. A reagent kit, characterized in that, The kit contains the PCR detection primer pair as described in claim 3.

5. The reagent kit according to claim 4, characterized in that, The kit also contains GloriaNova HS 2XMaster Mix and ddH2O.

6. The application of the SNP molecular marker according to any one of claims 1 to 2, the PCR detection primer pair according to claim 3, and the kit according to any one of claims 4 to 5 in determining the concentration of butyric acid in the rumen of dairy cows.

7. A method for screening dairy cows with high rumen butyrate concentrations, characterized in that, Includes the following steps: (1) Extract genomic DNA from the dairy cows to be tested; (2) Using the genomic DNA obtained in step (1) as a template, the amplification product is obtained by PCR reaction using the primer pair in claim 3; (3) Sequencing the amplification product. When the genotype of the SNP site at position 93 of the amplification product is GG or GA, the dairy cow to be tested belongs to the dairy cow with high rumen butyric acid content.

8. The method according to claim 7, characterized in that, The PCR reaction procedure was as follows: 94℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 10 seconds, 35 cycles; 72℃ extension for 5 minutes.

9. The application of the SNP molecular marker according to any one of claims 1 to 2 in rumen butyrate-assisted breeding of dairy cows.

Images