SSR (Simple Sequence Repeat) molecular marker, primer composition as well as screening method and application of SSR molecular marker

Abstract

The invention provides a torch flower SSR molecular marker, a primer composition and a screening method and application thereof, and relates to the technical field of molecular markers. The torch flower SSR molecular marker totally provides 22 pairs of torch flower SSR primers, amplification bands in torch flowers are clear, the polymorphism is rich, and the repeatability is good. The method can be used for germplasm identification, genetic diversity and genetic relationship analysis of the flare flowers, the result is stable and reliable, the blank of flare flower SSR site information can be filled, and a foundation is laid for flare flower germplasm resource management, breeding, resource genetic diversity or variety genetic relationship analysis and the like.

Description

Technical Field

[0001] This invention relates to the field of molecular marker technology, and particularly to a torch flower SSR molecular marker, primer composition, screening method, and application. Background Technology

[0002] Torchflower (Kniphofia uvaria) is a perennial herbaceous plant belonging to the genus Kniphofia in the family Asphodelaceae. It is widely used in landscaping and the cut flower industry due to its vibrant inflorescences and high ornamental value. In recent years, with the increasing demand for new varieties in the flower market, breakthroughs in the genetic breeding research of torchflower are urgently needed. However, traditional phenotypic selection methods are time-consuming and inefficient, necessitating the support of molecular marker-assisted breeding technology.

[0003] Simple sequence repeats (SSRs), also known as microsatellite DNA, refer to tandem repeat sequences of 1–6 nucleotides in the genome, widely distributed in the genomes of various eukaryotic organisms. Due to their high polymorphism, co-dominant inheritance, and good reproducibility, SSR markers have become core tools for plant genetic diversity analysis, variety identification, and molecular breeding. Currently, SSR markers have been successfully applied to crops such as rice and maize, but their development in ornamental plants, especially staghorn sumac, is insufficient. Public databases lack SSR locus information for staghorn sumac, resulting in limited research data and a lack of highly polymorphic primer sets covering the entire genome.

[0004] It should be noted that the information disclosed in the background section above is only used to enhance the understanding of the background of the present invention, and therefore may include information that does not constitute prior art known to those skilled in the art. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a Torchlidum SSR molecular marker, primer composition, screening method, and application.

[0006] According to a first aspect of the present invention, a torchflower SSR molecular marker is provided, comprising 22 SSR motifs, namely KIN-3, KIN-8, KIN-20, KIN-27, KIN-35, KIN-36, KIN-52, KIN-64, KIN-66, KIN-67, KIN-71, KIN-91, KIN-95, KIN-100, KIN-102, KIN-103, KIN-114, KIN-1 17. KIN-131, KIN-138, KIN-141, KIN-143; among them, KIN-3 is (AGG)6(AGC)5, KIN-8 is (AAAACC)5ctc(CGATCT)4, KIN-20 is (TGC)5agttagagccagagccaga(GGT)5, KIN-27 is (CCACTA)4(ACT)5, and KIN-35 is (CCT)7(CT)6. KIN-36 is (AG)6aaagagaggggggaggggatcaaaatagagagacat(AGA)8(AG)6, KIN-52 is (TC)9, KIN-64 is (TGA)6, KIN-66 is (CCA)5, KIN-67 is (CAG)7, KIN-71 is (GAT)7, KIN-91 is (AGAT)7, KIN-95 is (AAAG)5, KIN-100 For the SSR primitives above, the numbers represent the number of repetitions: (TCTT)7, (AGAT)6 for KIN-102, (ATAG)10 for KIN-103, (AACAA)5 for KIN-114, (CATCT)4 for KIN-117, (TCGGGT)6 for KIN-131, (CGAGGT)4 for KIN-138, (GCTCGG)5 for KIN-141, and (CGGTGG)4 for KIN-143.

[0007] According to a second aspect of the present invention, a Torchlidum SSR molecular marker primer composition is provided, comprising 22 pairs of SSR molecular marker primers:

[0008] Primer pairs K1, K2, K3, K4, K5, K6, K7, K8, K9, K10, K11, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K1 ...1, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K19, K10, K11, K11, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K19, K10, K Primer pair K14 as shown in SEQ ID NO. 27 and 28, primer pair K15 as shown in SEQ ID NO. 29 and 30, primer pair K16 as shown in SEQ ID NO. 31 and 32, primer pair K17 as shown in SEQ ID NO. 33 and 34, primer pair K18 as shown in SEQ ID NO. 35 and 36, primer pair K19 as shown in SEQ ID NO. 37 and 38, primer pair K20 as shown in SEQ ID NO. 39 and 40, primer pair K21 as shown in SEQ ID NO. 41 and 42, and primer pair K22 as shown in SEQ ID NO. 43 and 44.

[0009] According to a third aspect of the present invention, a kit for identifying the germplasm, genetic diversity, or phylogenetic relationships of *Rhus typhae* is provided, comprising one or more primer pairs in the *Rhus typhae* SSR molecular marker primer composition as described above.

[0010] According to a fourth aspect of the present invention, the application of the above-described Torchflower SSR molecular marker primer composition in Torchflower germplasm identification, resource genetic diversity, or varietal phylogenetic analysis is provided.

[0011] According to a fifth aspect of the present invention, a method for screening the Torchlea SSR molecular marker primer composition as described above is provided, comprising:

[0012] S1, collect leaves of Torchflower and extract leaf DNA;

[0013] S2. Based on the flanking sequences of the SSR site, primers were designed and multiple pairs of SSR primers were synthesized.

[0014] S3, using the leaf DNA obtained in step S1 as a DNA template, the DNA template is amplified by PCR using the SSR primers obtained in step S2 to obtain the amplification product.

[0015] S4. The amplification products were detected by agarose gel electrophoresis to screen for polymorphic SSR primers.

[0016] In an exemplary embodiment of the present invention, in step S3, the PCR amplification conditions are: 95°C pre-denaturation for 5 min, 34 cycles, 95°C denaturation for 30 s, 56°C annealing for 30 s, and 72°C extension for 45 s.

[0017] In an exemplary embodiment of the present invention, in step S3, the total PCR amplification reaction system is 10 μL, including: 1 μL DNA template with a concentration of 50-100 ng / μL, 0.3 μL each of upstream and downstream primers with a concentration of 5-15 μM, preferably 10 μM, 5 μL PCR Mix, and the remainder is ultrapure water.

[0018] In an exemplary embodiment of the present invention, in step S2, the primer design parameters are set as follows: primer length 18-27 bp, product size 100-280 bp, and annealing temperature 57-63°C.

[0019] The beneficial effects of the Torchly Flower SSR molecular marker, primer composition, screening method, and application in this invention are as follows:

[0020] In the embodiments of this invention, the SSR and primer composition for *Tricholoma salsa* provided by this invention amplifies clear bands with rich polymorphism and good reproducibility in *Tricholoma salsa*. It can be used for germplasm identification, genetic diversity, and phylogenetic analysis of *Tricholoma salsa*, with stable and reliable results. It can fill the gap in *Tricholoma salsa* SSR locus information, laying the foundation for germplasm resource management, breeding, resource genetic diversity, and varietal phylogenetic analysis of *Tricholoma salsa*.

[0021] It should be understood that the above general description and the following detailed description are exemplary and explanatory only, and are not intended to limit this disclosure. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of this disclosure, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of this disclosure and should not be regarded as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort.

[0023] Figure 1The image shows an electrophoresis diagram of some primers used in Example 1 of this invention, where A is KIN-64, B is KIN-100, C is KIN-67, and D is KIN-36. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of the embodiments of this disclosure clearer, the technical solutions in the embodiments of this disclosure will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0025] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0026] Example 1

[0027] This embodiment provides a method for screening Torchlea SSR primer compositions, including:

[0028] (1) Extracting DNA from Torchflower leaves

[0029] The extraction method was as follows: 0.1g of fresh leaves from *Rhus typhae* were ground into a fine powder using liquid nitrogen. The powder was then quickly transferred into a 1.5mL centrifuge tube pre-filled with 700μL of CTAB cell extraction buffer. The tube was then placed in a 65℃ constant temperature water bath for 30 minutes, during which time it needed to be inverted and mixed several times. Next, 800μL of a 24:1 chloroform-isoamyl alcohol mixture was added, and the mixture was thoroughly shaken for 10 minutes. The mixture was then centrifuged at 10000rpm for 10 minutes. The supernatant was transferred to a new 1.5mL centrifuge tube, and 60μL of 5mol / L sodium chloride solution and 1mL of pre-chilled anhydrous ethanol were added. After mixing, the mixture was incubated at -20℃ for 30 minutes. Then, it was centrifuged at 10000rpm for 5 minutes, the supernatant was discarded, and the mixture was soaked in 1mL of 70% ethanol for at least 2 hours. After removing the ethanol solution, the precipitate was dried at room temperature. Finally, 50μL of TE buffer was added to dissolve the precipitate. After determining the quality and concentration of DNA (method: the concentration of extracted DNA was determined using an ultra-micro spectrophotometer), the relevant data were recorded. All sample DNA was diluted to the same concentration with ddH2O, aliquoted, and frozen at -20℃ for later use.

[0030] (2) Design of Torchflower SSR primer pairs

[0031] Based on the flanking sequence information of SSR loci determined by transcriptome sequencing, primers were designed using Primer 5.0 software. The primer parameters were set as follows: primer length 18–27 bp, product size 100–280 bp, and annealing temperature 57–63℃. A total of 200 primer pairs were synthesized, and the primers were synthesized by Xiamen Qingke Primer Synthesis Co., Ltd.

[0032] (3) Screening of Torchflower SSR primer compositions

[0033] Five random DNA samples from *Rhus typhina* were selected as templates, and PCR amplification was performed on the five *Rhus typhina* samples using 200 primer pairs synthesized in step (2). The suitability of the SSR primers was pre-screened and evaluated using agarose gel electrophoresis.

[0034] Specifically, the PCR reaction system (10 μL) is as follows: 1 μL DNA template, 0.3 μL each of forward and reverse primers, 5 μL Taq enzyme, and ultrapure water to make up the volume. The reaction program is: 95℃ pre-denaturation for 5 min, 34 cycles, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, and 72℃ extension for 45 s.

[0035] Of the 200 primer pairs designed, 40 pairs were able to amplify clear bands by agarose gel electrophoresis. Finally, 22 pairs of SSR primers with clear amplification bands, rich polymorphism, and good reproducibility were selected.

[0036] Specifically, the agarose gel electrophoresis procedure is as follows: Take two plates, one long and one short, wash them with water, place them properly, and wash them twice with a paper towel soaked in 95% ethanol; coat the long plate with affinity silane (affinity silane: take a 1.5mL centrifuge tube, add 1.5μL of affinity silane, and fill the 1.5mL centrifuge tube with 95% ethanol and 0.5% glacial acetic acid; coat the short plate with stripping silane, and repeat after coating; rinse the sealing strip and comb with tap water, place the sealing strip on the edge of the long plate, place it properly, cross your hands and place the short plate on top of the long plate, and then clamp it; prepare the stock solution: take a 100mL beaker, pour in 60mL of urea, 300μL of APS, and TEMED. 30 μL. Turn the knob up and pour the stock solution along the gap between the long and short plates. After pouring, insert the back of a comb into the gap and wait 1.5 hours for solidification. Remove the clamps, clean off any gel debris, place the gel plate on top, screw on the white knob, and add 1×TBE; pre-electrophoresis for 20 minutes, load 2–3 μL of sample, and electrophoresis for 1 hour. Figure 1 The image shows an electrophoresis diagram of some of the primers, where A is KIN-64, B is KIN-100, C is KIN-67, and D is KIN-36.

[0037] Table 1 shows the information of the 22 pairs of SSR primers obtained through screening, including the SSR sites and upstream and downstream primer sequences.

[0038] Table 1. Results of SSR site selection and primer design

[0039]

[0040]

[0041] Example 2

[0042] Detection of the effectiveness and polymorphism of the SSR molecular marker primer composition for *Rhus chinensis*:

[0043] (1) Fifteen samples of *Rhus typhina* were selected as experimental materials. Leaf DNA was extracted using the method in step (1) of Example 1 as a DNA template. PCR amplification was performed using 22 primer pairs selected in step (3) of Example 1. The 10 μL PCR system consisted of: 1 μL DNA template (concentration 50–100 ng / μL), 0.3 μL each of forward and reverse primers (concentration 5–15 μM), 5 μL PCR Mix, and ultrapure water to a final volume of 10 μL. The PCR amplification program was as follows: 95℃ pre-denaturation for 5 min, 34 cycles, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, and 72℃ extension for 45 s. The PCR Mix could be obtained from commercially available products.

[0044] (2) Add bromophenol blue indicator to the amplified product and heat at 95℃ for 5 min to complete the denaturation. Take 2.6 μL of the amplified product, separate the sample by polyacrylamide gel electrophoresis, and take a picture for archiving after silver staining.

[0045] (3) Data collection was performed on clearly visible polymorphic bands in the SSR amplification products using a 0-1 binary encoding method. Based on the gel imaging results, the bands were manually read and statistically analyzed. Clear bands were marked as "1", and bands without bands or that were indistinct were marked as "0". All data were compiled into a data matrix, and the data were converted using the GenAlEx 6.5 plugin. Genetic diversity indicators such as allele and polymorphic information content were also assessed. The polymorphism analysis results of SSR marker sites are shown in Table 2.

[0046] Specifically, the observed homozygosity Obs-Hom, observed heterozygosity Obs-Het, expected homozygosity Exp-Hom, and Nei gene index were calculated for each locus using Popgene32 software, and the polymorphism information content (PIC) for each locus was calculated using Powermarke software.

[0047] Table 2

[0048]

[0049]

[0050] Table 2 shows that 98 allele loci were detected in 15 *Torchella fuciformis* germplasms using 22 primer pairs. The average number of alleles per primer pair was 4.455. Observed heterozygosity (Obs-Het) ranged from 0.000 to 1.000. Expected heterozygosity (Exp-Het) ranged from 0.1364 to 0.6583 (mean 0.3848). The maximum polymorphism information content (PIC) was 0.8327 (KIN-138), and the minimum was 0.3929 (KIN-100). Of the 22 primers, 20 had PIC values ​​higher than 0.5, and only 2 had PIC values ​​< 0.5, indicating that these loci possess abundant genetic variability. The Nei gene index was 0.5684, the mean expected heterozygosity (Exp-Het) was 0.6152, the observed heterozygosity (Obs-Het) was 0.5139, and the polymorphism information content (PIC) was 0.6031. Through numerical analysis of SSR loci genetic diversity, we observed that loci KIN-3, KIN-20, KIN-36, KIN-64, KIN-95, KIN-103, KIN-131, KIN-138, and KIN-143 all exhibited high diversity in terms of alleles and polymorphism information content.

[0051] The above description does not cover all embodiments. The detailed description of embodiments in this disclosure is not intended to limit the scope of the claimed disclosure, but merely to illustrate selected embodiments. All other embodiments obtained by those skilled in the art based on the embodiments in this disclosure without inventive effort are within the scope of protection of this disclosure.

Claims

1. A torch flower SSR molecular marker, characterized in that, Includes 22 SSR primitives, namely KIN-3, KIN-8, KIN-20, KIN-27, KIN-35, KIN-36, KIN-52, KIN-64, KIN-66, KIN- 67. KIN-71, KIN-91, KIN-95, KIN-100, KIN-102, KIN-103, KIN-114, KIN-117, KIN-131, KIN-138, KIN-141, KIN-143; among them, KIN-3 is (AGG)6 (AGC)5, KIN-8 is (AAAACC)5ctc (CGATCT)4, KIN-20 is (TGC)5agttagagccagagccaga (GGT)5, KIN-27 is (CCACTA)4 (ACT)5, KIN-35 is (CCT)7 (CT)6, KIN-36 is (AG)6aaagagaggggggaggggatcaaaatagagagacat (AGA)8 (AG)6, KIN-52 is (TC)9, KIN-64 is (TGA)6, KIN-66 is (CCA)5, KIN-67 is (CAG)7, KIN-71 is (GAT)7, KIN-91 is (AGAT)7, KIN-95 is (AAAG)5, KIN-100 is (TCTT) )7, KIN-102 is (AGAT)6, KIN-103 is (ATAG)10, KIN-114 is (AACAA)5, KIN-117 is (CATCT)4, KIN-131 is (TCGGGT)6, KIN-138 is (CGAGGT)4, KIN-141 is (GCTCGG)5, KIN-143 is (CGGTGG)4. In the above SSR primitives, the numbers represent the number of repetitions.

2. A Torchlidum SSR molecular marker primer composition, characterized in that, Includes 22 pairs of SSR molecular marker primers: Primer pairs K1, K2, K3, K4, K5, K6, K7, K8, K9, K10, K11, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K19, K10, K11, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K19, K10, K11, K12, K13, K14, K15, K16, K17, K18, K19, K10, K11, K12, K13, K14, K15, K16, K17, K18, K19, K10, K11, K12, K13, K14, K15, K16, K17, K18, K19, K10, K11, K12, K13, K14, K15, K16, K14, K15, K16, K17, K18, K19, K11, K11, K11, K11, K11, K11, K12, K1 ... Primer pair K14 as shown in SEQ ID NO. 27 and 28, primer pair K15 as shown in SEQ ID NO. 29 and 30, primer pair K16 as shown in SEQ ID NO. 31 and 32, primer pair K17 as shown in SEQ ID NO. 33 and 34, primer pair K18 as shown in SEQ ID NO. 35 and 36, primer pair K19 as shown in SEQ ID NO. 37 and 38, primer pair K20 as shown in SEQ ID NO. 39 and 40, primer pair K21 as shown in SEQ ID NO. 41 and 42, and primer pair K22 as shown in SEQ ID NO. 43 and 44.

3. A kit for germplasm identification, genetic diversity analysis, or phylogenetic analysis of *Torchella asiatica*, characterized in that, It includes one or more primer pairs in the Torchflower SSR molecular marker primer composition described in claim 1.

4. The application of the Torchflower SSR molecular marker primer composition as described in claim 2 in Torchflower germplasm identification, resource genetic diversity or varietal phylogenetic analysis.

5. A method for screening the Torchlius SSR molecular marker primer composition as described in claim 2, characterized in that, include: S1, collect leaves of Torchflower and extract leaf DNA; S2. Based on the flanking sequences of the SSR site, primers were designed and multiple pairs of SSR primers were synthesized. S3, using the leaf DNA obtained in step S1 as a DNA template, the DNA template is amplified by PCR using the SSR primers obtained in step S2 to obtain the amplification product. S4. The amplification product is detected and screened to obtain polymorphic SSR primers.

6. The screening method for the Torchly Flower SSR molecular marker primer composition according to claim 5, characterized in that, In step S3, the PCR amplification conditions are: 95℃ pre-denaturation for 5 min, 34 cycles, 95℃ denaturation for 30 s, 56℃ annealing for 30 s, and 72℃ extension for 45 s.

7. The screening method for the Torchly Flower SSR molecular marker primer composition according to claim 6, characterized in that, In step S3, the total PCR amplification reaction system is 10 μL, including: 1 μL DNA template with a concentration of 50-100 ng / μL, 0.3 μL each of upstream and downstream primers with a concentration of 5-15 μM, 5 μL PCR Mix, and the remainder is ultrapure water.

8. The screening method for the Torchly Flower SSR molecular marker primer composition according to claim 5, characterized in that, In step S2, the primer design parameters are set as follows: primer length 18-27 bp.

9. The screening method for the Torchly Flower SSR molecular marker primer composition according to claim 8, characterized in that, In step S2, the primer design parameters also include: product size 100-280 bp, annealing temperature 57-63℃.

10. The screening method for the Torchly Flower SSR molecular marker primer composition according to claim 5, characterized in that, In step S4, the amplification products are detected by agarose gel electrophoresis.

Images