Obtaining of corn kernel protein major QTL qHP3.4 and development and application of molecular marker primer of corn kernel protein major QTL qHP3.4

Abstract

The invention belongs to the field of molecular biology, and discloses acquisition of corn kernel protein major QTL qHP3.4 and development and application of molecular marker primers of the corn kernel protein major QTL qHP3.4. The major QTL qHP3.4 for controlling the corn kernel protein is located at the third chromosome of the corn, the major QTL locus is used for controlling the variation of the corn kernel protein, the excellent haplotype SNP marker is closely linked with the major QTL locus and located at the 178174353 basic group of the third chromosome of a corn B73 reference genome, the explained corn kernel protein phenotype contribution rate is 8.42%, and the explained corn kernel protein phenotype contribution rate is 8.42%. The PARMS marker designed by the SNP is used for detecting a corn inbred line group, the operation is simple and convenient, the typing is clear, and the PARMS marker has a good selection effect on yield traits and growth period traits such as corn ear length, ear thickness, hundred-grain weight, single ear grain weight, ear weight, row grain number and the like, and can be used for molecular marker-assisted selection breeding of the corn kernel protein content.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology, specifically relating to the acquisition of the major QTL qHP3.4 of maize kernel protein, and the development and application of its molecular marker primers. Background Technology

[0002] The quality of corn protein is a decisive factor in its nutritional and economic benefits. In feed, low-protein or amino acid-imbalanced corn directly necessitates the addition of over 30% soybean protein to feed formulations, significantly increasing costs and exacerbating dependence on imported protein sources. High-protein corn, on the other hand, can significantly optimize feed conversion efficiency and reduce breeding costs. Nutritionally, as a vital global staple food, its protein quality directly impacts the protein nutrition levels of the population. In processing, as a key raw material for the food industry and bio-based materials, corn protein quality is a crucial factor determining product added value. Therefore, overcoming the bottleneck of corn protein quality is a core strategic lever for simultaneously reducing feed costs, decreasing soybean dependence, ensuring population nutritional security, and enhancing the value of the entire industry chain.

[0003] Although a few genes regulating maize kernel protein content have been reported, the number of functional genes in maize that clearly regulate kernel protein is still relatively small, and the molecular mechanisms of maize kernel protein formation are poorly understood. Therefore, accurately identifying high-protein kernel traits is of significant production and research value, providing support for the creation of high-yield and high-quality maize varieties and identifying target points for breeding high-protein varieties.

[0004] Based on this, this study extensively collected 557 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain, established a population of superior germplasm with different characteristics, completed whole-genome resequencing at a depth of 20X using the DNBSEQ-T7 / PE150 sequencing platform, determined the protein content of kernels using a near-infrared spectroscopy analyzer, and further identified superior allelic variations through association analysis, developed specific functional markers and used them to create intermediate breeding materials, providing superior allelic resources for carrying out high-protein molecular breeding of maize. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent for detecting the base at position 178174353 on the third chromosome of the maize genome and its application in screening breeding for maize kernel protein content.

[0006] Another objective of this invention is to provide the application of a reagent for detecting base 178174353 on chromosome 3 of the maize genome in the preparation of a screening kit for maize kernel protein content.

[0007] The final objective of this invention is to provide a method for screening breeding of maize kernel protein content.

[0008] To achieve the above objectives, the present invention is implemented through the following technical solution:

[0009] Obtaining the major QTL qHP3.4 controlling maize kernel protein:

[0010] 1) Through genome-wide association analysis, this invention detected the major QTL qHP3.4, which regulates maize kernel protein, on chromosome 3 of maize. The total length of this interval is 2622.713 Kb (Chr3:175551640—178174353).

[0011] 2) The applicant developed a functional molecular marker closely linked to the optimal haplotype PARMS marker, with the physical location (Chr3: 178174353). The PARMS marker primers are: qHP3.4R: TTGCGTCCGTATCTGAGGACA, qHP3.4F1 (low protein content haplotype G): GAAGGTGACCAAGTTCATGCTCAGCACAGCACCCATCGG, and qHP3.4F2 (high protein content haplotype T): GAAGGTCGGAGTCAACGGATTCAGCACAGCACCCATCGT.

[0012] 3) The applicant verified, through the maize kernel protein phenotype of the 557 maize inbred line under nine environments, that the superior haplotype qHP3.4 contributed 8.42% to the maize kernel protein phenotype in natural populations and was strongly selected in breeding practice. This superior haplotype provides genetic resources for the creation of high-protein maize lines.

[0013] The scope of protection of this invention also includes:

[0014] Application of reagents for detecting base position 178174353 on chromosome 3 of the maize genome in screening breeding for maize kernel protein content trait.

[0015] Application of reagents for detecting base 178174353 on chromosome 3 of the maize genome in the preparation of screening kits for maize kernel protein content traits.

[0016] In the above-described application, if the base at position 178174353 of chromosome 3 of the maize genome is detected to be T, then the maize is determined to be a high-protein sample with a protein content greater than or equal to 12%.

[0017] If the above-described application detects a G at position 178174353 on chromosome 3 of the maize genome, then the maize sample is determined to be a low-protein sample with a protein content of less than 12%.

[0018] In the above applications, the preferred reagent is a primer.

[0019] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by this invention: qHP3.4R: TTGCGTCCGTATCTGAGGACA, qHP3.4F1 (low protein haplotype G): GAAGGTGACCAAGTTCATGCTCAGCACAGCACCCATCGG and qHP3.4F2 (high protein haplotype T): GAAGGTCGGAGTCAACGGATTCAGCACAGCACCCATCGT.

[0020] A method for screening and breeding maize kernel protein content includes detecting base 178174353 on chromosome 3 of the maize genome using conventional methods in the art. These conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry.

[0021] Application of reagents for detecting base 178174353 on chromosome 3 of the maize genome in screening breeding for maize kernel protein content and yield traits.

[0022] Application of reagents for detecting base 178174353 on chromosome 3 of the maize genome in screening breeding for maize kernel protein content and growth period traits.

[0023] The reference genome of maize used in this invention is Zm-B73-REFERENCE-NAM-5.0.

[0024] Compared with the prior art, the present invention has the following advantages:

[0025] This invention, for the first time, finely mapped a novel major QTL controlling maize kernel protein based on genome-wide association analysis. The major QTL was located on chromosome 3, within a region of 2622.713 kb (Chr3:175551640—178174353). This locus is a major QTL controlling phenotypic variation in maize kernel protein content, explaining 8.42% of the phenotypic contribution. PARMS markers developed based on its optimal allele can be used for marker-assisted selection breeding. Attached Figure Description

[0026] Figure 1 Box plots showing the normal distribution of maize kernel protein content in 557 inbred line populations under 9 environmental conditions.

[0027] Figure 2This is a distribution map of BLUP values ​​for grain protein content in the associated population.

[0028] Figure 3 This is a schematic diagram of the association analysis of the qHP3.4 site under waterlogging stress in Gucheng (GC), Hubei Province in 2024.

[0029] Association analysis of 13.2 million polymorphic variation sites with a minimum allele frequency greater than 0.05 at the qHP3.4 locus with grain protein content phenotype in 557 different inbred lines. Each dot represents a polymorphic site.

[0030] Figure 4 This is a schematic diagram of the association analysis of the qHP3.4 site in the normal growth environment of Gucheng (GC), Hubei Province in 2024;

[0031] Association analysis of 13.2 million polymorphic variation sites with a minimum allele frequency greater than 0.05 at the qHP3.4 locus with grain protein content phenotype in 557 different inbred lines. Each dot represents a polymorphic site.

[0032] Figure 5 This is a schematic diagram of the association analysis of the qHP3.4 site in the HN environment of Lingshui, Hainan in 2024;

[0033] Association analysis of 13.2 million polymorphic variation sites with a minimum allele frequency greater than 0.05 at the qHP3.4 locus with grain protein content phenotype in 557 different inbred lines. Each dot represents a polymorphic site.

[0034] Figure 6 A schematic diagram illustrating the superior haplotype effect of qHP3.4;

[0035] The protein content of 217 qHP3.4 (haplotype T) inbred lines and 340 qhp3.4 (haplotype G) inbred lines was compared. Each box represents the median and interquartile range, extended to the maximum and minimum values. The significance of the differences was estimated by one-way ANOVA.

[0036] Figure 7 This is a stratified haplotype frequency analysis plot of the qHP3.4 protein content gradient.

[0037] Figure 8 A schematic diagram illustrating the genetic effects of qHP3.4 on other traits;

[0038] Scatter dots represent the distribution of protein content in families. qHP3.4 represents the favorable haplotype T of qHP3.4, and qhp3.4 represents the unfavorable haplotype G of qHP3.4. Each box represents the median and interquartile range, extended to the maximum and minimum values. Error bars represent SD. The significance of differences was estimated by one-way ANOVA.

[0039] Figure 9 A schematic diagram illustrating the development and utilization of the optimal haplotype functional marker for qHP3.4;

[0040] In the diagram: Green: qHP3.4F2 type has high grain protein content; Blue: qHP3.4F1 type family has low grain protein content. Detailed Implementation

[0041] Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the field; unless otherwise specified, the reagents or materials described are all publicly available.

[0042] The reference genome for maize in this invention is Zm-B73-REFERENCE-NAM-5.0 (MaizeGDB GenomeCenter).

[0043] Example 1:

[0044] Obtaining the major QTL qHP3.4 of corn kernel protein:

[0045] 1. Materials and Methods

[0046] 1.1 Materials

[0047] A total of 557 backbone inbred lines from maize producing areas in Southwest China and the Huang-Huai-Hai Plain were collected. A population of superior germplasm with different characteristics was established. The whole genome was resequencing at a depth of 20X based on the DNBSEQ-T7 / PE150 sequencing platform, and 13.2 million high-quality SNP markers were obtained.

[0048] 1.2 Experimental Methods

[0049] 1.2.1 Phenotypic Identification

[0050] The protein content of corn kernels was determined using a near-infrared spectroscopy analyzer. Each sample was measured twice, and the average value was taken.

[0051] 1.2.1 Genome-wide association analysis of maize kernel protein loci

[0052] For the raw sequencing data after sequencing, data quality control was performed to obtain high-quality clean data. This clean data was then aligned to a reference genome for variant detection. The reference genome used was AGPv5, downloaded from http: / / plants.ensembl.org / Zea_mays / Info / Index. BWA software was used to align PE reads with the B73 reference genome sequence, obtaining alignment results in AM format. The SAM format file was converted to BAM format using samtools software. Then, the reads in the BAM file were sorted using the SortSam tool in Picard, and PCR duplicates were removed to obtain the final BAM file suitable for variant calling. Finally, the HaplotypeCaller module of GATK was used for variant detection, including SNPs and InDels. Q and K were calculated using STRUCTURE and TESSEL 5.0 software, respectively. After correction, the P-value was set to 1.0 × 10⁻⁶. -5 As a significance threshold for GWAS results. 1.2.2 Development of optimal haplotype molecular markers

[0053] Based on the B73 genome and differentially expressed site information provided by qHP3.4 sequencing, specific primers were designed, and PARMS detection technology was employed. This technology is a PCR detection technique developed based on the specific resolution of single-base variant sites (SNPs). PARMS SNP PCR uses five primers for the reaction, including two universal fluorescent primers included in the PARMS 2X Master Mix. The remaining three are label-specific primers, which need to be custom-designed and synthesized according to the experimental objectives. Of these three, one is a locus-specific primer, and the other two are allele-specific primers for the SNP. A specific universal adapter sequence of 21 bases is added to the 5' end of each of these two primers for matching and amplification with the universal fluorescent primer. The adapter sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the adapter sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0054] 1.2.3 Genotype Analysis

[0055] Small-scale DNA extraction from maize was performed using the CTAB (Cetyltrimethyl Ammonium Bromide) method (Saghai-Maroof et al 1984), followed by PARMS SNP detection.

[0056] 2. Results and Analysis

[0057] 2.1 Identification of grain protein content in 557 inbred line related populations

[0058] Grain protein data from 557 inbred line populations in nine environments across two years (2022-2024) were collected in Shihezi (XJ), Lingshui (HN), Ezhou (EZ), and Gucheng (GC) in Hubei Province. The results are shown in Table 1. The phenotypic variation in grain protein content ranged from 7.56% to 16.26%. Figure 1 It can be seen that the protein content under the nine environments follows a normal distribution, and the population phenotypic variation is rich.

[0059] Table 1. Phenotypic Statistical Analysis of Associated Groups

[0060]

[0061]

[0062] Normal represents the normal growth group, and Stress represents waterlogging stress treatment. The BLUP values ​​of grain protein content in the associated population materials under nine environments were calculated, combined with... Figure 2 It can be seen that the protein content exhibits a clear normal distribution. Among them, there are 2 inbred lines with a protein content ≥14%, 35 inbred lines with a protein content between 13% and 14%, 142 inbred lines with a protein content between 12% and 13%, 255 inbred lines with a protein content between 11% and 12%, 115 inbred lines with a protein content between 10% and 11%, and 8 inbred lines with a protein content <10%.

[0063] 2.2 Identification and Genetic Effect Analysis of Major-Affect QTL qHP in Maize Kernel Protein

[0064] This application identifies a novel major QTL controlling maize kernel protein based on genome-wide association analysis. This major QTL is located on chromosome 3, and the total length of this region is 2622.713 Kb (Chr3:175551640—178174353), named qHP 3.4. Figure 3 , 4 5).

[0065] qHP3.4 locus lead SNP 178174353(T / G) A significant association was found at p = 1.49E-06, located at base 178174353 on chromosome 3 of the maize genome (maize B73 reference genome Zm-B73-REFERENCE-NAM-5.0, referred to in this invention as the maize B73V5 reference genome), explaining 8.42% of the phenotypic contribution.

[0066] PARMS primers were designed for the above SNP sites as follows:

[0067] (1) Label the leadSNP for peak SNPs closely linked to qHP3.4. 178174353(T / G) A 200 bp sequence was extracted from each of the bases upstream and downstream of position 178174353 on chromosome 3 of the maize B73V5 reference genome. Following primer design principles, the PARMS marker detection primer sequences were obtained as follows:

[0068] qHP3.4F1: GAAGGTGACCAAGTTCATGCT CAGCACAGCACCCATCGG;

[0069] qHP3.4F2: GAAGGTCGGAGTCAACGGATT CAGCACAGCACCCATCGT;

[0070] qHP3.4R:TTGCGTCCGTATCTGAGGACA;

[0071] The underlined part of the reverse primer is the fluorescent adapter sequence.

[0072] (2) Using the genomic DNA of the maize inbred line population as a template, the above primers were used to perform real-time PCR amplification. The FAM and HEX signals were scanned using a Tecan F200 and the results were output. Finally, the genotype was converted.

[0073] Using the primers described above, the sequence amplified from the low-protein material Zheng58 (parent parent Zhengdan 958) is:

[0074] GAAGGTGACCAAGTTCATGCTCAGCACAGCACCCATCGGCTGTCCTCAGATACGGACGCAA

[0075] The amplification product sequence of the high-protein material HZ32 (parent of Huayu 3) is:

[0076] GAAGGTCGGAGTCAACGGATTCAGCACAGCACCCATCGTCTGTCCTCAGATACGGACGCAA

[0077] Amplification system:

[0078]

[0079]

[0080] Amplification parameters:

[0081]

[0082] According to SNP 178174353(T / G) The maize grains were divided into two haplotypes, named qHP3.4 and qhp3.4, and then further divided into two groups under nine different environmental conditions to compare the differences in maize kernel protein content between the two haplotypes. Among these, 217 inbred lines were SNPs. 178174353(T / T) Alternatively known as the qHP3.4 allele, 340 materials were SNPs. 178174353(G / G) This can also be referred to as the qhp3.4 allele. Under nine different environmental conditions, the average protein content of the qHP3.4 haplotype inbred lines was significantly higher than that of the qhp3.4 haplotype (p<0.05). Figure 6 The qHP3.4 high-protein favorable allele can increase grain protein content by 0.4-0.81% under various environmental conditions. The superior haplotype qHP3.4 accounts for 18.02% in materials with protein content >12%, 15.30% in materials with protein content 11%-12%, 3.23% in materials with protein content 10%-11%, and 0.85% in materials with protein content <10%. Figure 7 This indicates that qHP3.4 is a key gene locus for improving maize kernel protein content, and it has been enriched in high-protein materials, showing great potential for genetic improvement of high protein content. Based on multi-year, multi-environmental yield and growth period data, BLUP analysis showed that the two haplotypes of the qHP3.4 locus exhibited highly significant differences in several key agronomic traits related to growth period and yield (p < 0.01). Figure 8Statistical analysis showed that, regarding growth period traits (including tasseling, silking, and pollination), compared to haplotype qhp3.4, the average number of days for tasseling was 66 days for haplotype qHP3.4 and 65 days for haplotype qhp3.4, with a difference of 1 day (p = 1.17E-05); the average number of days for silking was 69 days for haplotype qHP3.4 and 68 days for haplotype qhp3.4, with a difference of 1 day (p = 5.43E-06); and the average number of days for silking was 70 days for haplotype qHP3.4 and 68 days for haplotype qhp3.4, with a difference of 2 days (p = 5.25E-07). These results indicate that haplotype qHP3.4 has a significant negative regulatory effect on maize growth period, leading to a delay in maize growth. Regarding yield-related traits such as 100-grain weight (HKW), ear diameter (EarDiameter), ear length (Ear Length), number of rows per ear (KNR), number of grains per row (KRN), and single-ear grain weight (KWPE), the average 100-grain weight of haplotype qHP3.4 was 23.89 g, while the average for haplotype qhp3.4 was 25.12 g (p = 1.75E-09); the average ear weight of haplotype qHP3.4 was 58.12 g, while the average for haplotype qhp3.4 was 67.60 g (p = 1.12E-11); the average single-ear grain weight of haplotype qHP3.4 was 46.08 g, while the average for haplotype qhp3.4 was 55.17 g (p = 1.12E-11); and the average ear length of haplotype qHP3.4 was 1... The average spike diameter of haplotype qHP3.4 was 2.92 cm, while the average value of haplotype qHP3.4 was 13.10 cm (p = 0.0092); the average spike diameter of haplotype qHP3.4 was 3.38 cm, while the average value of haplotype qHP3.4 was 3.44 cm (p = 0.006); the average number of grains per row of haplotype qHP3.4 was 21.53, while the average value of haplotype qHP3.4 was 22.12 (p = 4.08E-06). The results indicate that this locus negatively regulates yield-related traits and to some extent demonstrates that there is a certain linkage burden between the superior allele regulating grain protein content and the locus related to growth period and yield. qHP3.4 is a pleiotropic gene locus.

[0083] Example 2:

[0084] Application of excellent haplotype molecular marker primers for major QTL of maize kernel protein qHP3.4:

[0085] From a population of 557 inbred lines, 55 inbred lines were randomly selected, with 8 plants from each family pooled together. DNA was extracted, and the grain protein content of the samples (as shown in Table 2) was determined using a near-infrared spectroscopy analyzer. Each sample was measured twice, and the average value was taken. Comparison showed that when the allele at position 178174353 was T, the sample was a high-protein material; when the allele at position 178174353 was G, the sample was a low-protein material. High-protein samples had a protein content ≥12%, and low-protein samples had a protein content <12%.

[0086] The above results confirm that the developed functional markers can be used for marker-assisted selection in the genetic improvement of maize kernel protein traits, providing selection targets for creating new high-protein maize germplasm and breeding new high-protein varieties. The leader SNP with the most significant phenotypic differences at the qHP3.4 locus under nine different environments was selected. 178174353(T / G) PARMS markers were designed, and genotyping was performed on 55 randomly selected inbred lines from the associated population (see Table 2). Comparison with the resequencing genotyping results showed that the PARMS marker-based genotyping results were 100% consistent with the resequencing results (see Table 2). Figure 9 .exist Figure 9 In the diagram, green dots indicate that the adapter primer sequence is HEX fluorescent, meaning that the qHP3.4F2 family has a high grain protein content; blue dots indicate that the adapter primer sequence is FAM fluorescent, meaning that the qHP3.4F1 family has a low grain protein content. This demonstrates that the PARMS marker can effectively distinguish between the two haplotypes.

[0087] Table 2. Evaluation of Protein Content in Corn Kernels

[0088]

[0089]

[0090]

Claims

1. Application of reagents for detecting base 178174353 on chromosome 3 of the maize genome in screening breeding for maize kernel protein content trait.

2. Application of reagent for detecting base 178174353 on chromosome 3 of maize genome in the preparation of a screening kit for maize kernel protein content trait.

3. The application according to claim 1 or 2, characterized in that: If the base at position 178174353 of chromosome 3 of the maize genome is detected to be T, the sample to be tested is determined to be a high-protein sample, and the protein content of the high-protein sample is greater than or equal to 12%.

4. The application according to claim 1 or 2, characterized in that: If the base G is detected at position 178174353 on chromosome 3 of the maize genome, the sample to be tested is determined to be a low-protein sample, and the protein content of the low-protein sample is less than 12%.

5. The application according to claim 1 or 2, characterized in that: The reagent mentioned is a primer.

6. The application according to claim 5, wherein the primer is: qHP3.4R TTGCGTCCGTATCTGAGGACA、 qHP3.4F1 : GAAGGTGACCAAGTTCATGCTCAGCACAGCACCCATCGG and qHP3.4F2 :GAAGGTCGGAGTCAACGGATTCAGCACAGCACCCATCGT.

7. A method for screening and breeding maize kernel protein content traits, comprising detecting base 178174353 on chromosome 3 of the maize genome using conventional methods in the art, wherein the conventional methods include, but are not limited to: sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, and mass spectrometry method.

8. The application according to claim 1 or 2, wherein the property includes yield.

9. The application according to claim 1 or 2, wherein the trait includes reproductive period.

Images