Pharmaceutical compositions for delivery of herpes simplex virus glycoprotein C, glycoprotein D and glycoprotein E antigens and related methods
The HSV-2 glycoproteins C, D, and E polynucleotides in the HSV vaccine composition stimulate a strong immune response, solving the problem of low efficiency of existing HSV vaccines and achieving effective prevention and treatment of HSV-2.
Patent Information
- Application Number
- CN202480009347.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2023-10-31
- Filing Date
- 2024-01-26
- Publication Date
- 2025-11-11
AI Technical Summary
Existing herpes simplex virus (HSV) vaccines are inefficient and have limited effectiveness in prevention and treatment, especially in cases of HSV-2 infection, where they lack an effective immune response and protective mechanism.
An HSV vaccine composition is provided, comprising polynucleotides encoding HSV-2 glycoprotein C (gC), glycoprotein D (gD), and glycoprotein E (gE), which, through intramuscular immunization, stimulate the immune system to produce a strong immune response against these antigens, thereby forming a highly efficient immune response.
It significantly improved immune protection against HSV-2, reduced weight loss after viral attack, decreased the severity and duration of genital diseases, improved survival rate, and enhanced the neutralizing capacity of serum and vaginal antibodies.
Smart Images

Figure CN120936374A_ABST
Abstract
Description
Background Technology
[0001] This application claims priority and benefit to U.S. Provisional Patent Application No. 63 / 441,767, filed January 27, 2023; U.S. Provisional Patent Application No. 63 / 517,380, filed August 3, 2023; and U.S. Provisional Patent Application No. 63 / 594,825, filed October 31, 2023, the entire contents of which are incorporated herein by reference.
[0002] Herpes simplex virus (HSV), commonly referred to simply as herpes, is classified into two types: herpes simplex virus type 1 (HSV-1, or oral herpes) and herpes simplex virus type 2 (HSV-2, or genital herpes). According to the World Health Organization, an estimated 3.7 billion people under the age of 50 worldwide (67% of the global population) are infected with HSV-1. HSV-1 prevalence is highest in Africa and lowest in the Americas. An estimated 491 million people aged 15-49 worldwide (13% of the global population) are infected with HSV-2. More women than men are infected with HSV-2 because sexual transmission of HSV from male to female is more efficient than from female to male. HSV-2 prevalence is estimated to be highest in Africa, followed by the Americas. HSV-2 prevalence has also been shown to increase with age, although historically the highest number of new infections has occurred among adolescents. Both HSV-1 and HSV-2 infections are lifelong. Summary of the Invention
[0003] This disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) and related technologies (e.g., methods) for delivering specific herpes simplex virus (HSV) antigen constructs to subjects (e.g., patients). Specifically, this disclosure provides HSV vaccine compositions and related technologies (e.g., methods).
[0004] This disclosure also provides that HSV glycoprotein C (gC) antigen or antigen fragment thereof, HSV glycoprotein D (gD) antigen or antigen fragment thereof, glycoprotein E (gE) antigen or antigen fragment thereof, or combinations thereof, may be used, for example, in HSV antigen constructs and / or HSV vaccines as further disclosed herein, to prevent or treat HSV.
[0005] This disclosure provides, for example, polynucleotides encoding one or more HSV antigens or antigenic fragments thereof. In some embodiments, the polynucleotides described herein encode one or more HSV-2 gC, gD, and / or gE antigens or antigenic fragments thereof (e.g., in a construct). In some embodiments, this polynucleotide may be part of an RNA construct. In some embodiments, the polynucleotide or RNA construct as described herein may be part of a composition (e.g., a pharmaceutical composition, such as an immunogenic composition, such as a vaccine).
[0006] In some implementations, the techniques provided herein are for HSV. Attached Figure Description
[0007] The figures included in this article consist of the following figures, which are for illustrative purposes only and not for limitation.
[0008] Figure 1 This is a schematic diagram of HSV particles.
[0009] Figure 2 This provides a schematic overview of the HSV lifecycle. Figure 2 This has been modified based on Ibanez, FJ, et al., "Experimental Dissection of the Lytic Replication Cycles of Herpes Simplex Virus in vitro", Front Microbiol. 2018; 9:2406, which is incorporated herein by reference in its entirety.
[0010] Figures 3A to 3F The expression levels are shown in HEK293T cells transfected with nucleoside-modified RNA (modRNA) encoding HSV-2 gC (gC2), gD (gD2), or gE (gE2) antigens. Commercial transfection reagents were used with 0.2 μg / mL modRNA encoding the gC2 or gD2 antigen construct or 0.4 μg / mL modRNA encoding the gE2 antigen construct. Figures 3A to 3C ) or RNA prepared using LNPs encoding all three antigens in a 1:1:1 quality ratio. Figures 3D to 3F Cells were transfected using [concentrations shown]. Expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies and secondary fluorescently labeled anti-mouse antibodies to detect the corresponding antigens. Representative data from one experiment show the median fluorescence intensity (MFI) of the total HEK293T population of gC2 antigen constructs (Figs. A and D), gD2 antigen constructs (Figs. B and E), and gE2 antigen constructs (Figs. C and F). Data shown are the mean + SD of HEK293T transfections performed in triplicate. 1600: IL2 secretion signal and HSV-2gC antigen. 1601: HSV-2gD secretion signal and HSV-2gD antigen. 1602: IL2 secretion signal and HSV-2gE antigen. 3233: HSV-1gD secretion signal and HSV-2gC antigen. 3234: HSV-2gD secretion signal and HSV-2gD antigen. 3235: HSV-2gD secretion signal and HSV-2gE antigen.
[0011] Figure 4 This diagram illustrates a schematic overview of the study in guinea pigs investigating a vaccine candidate against HSV-2. Guinea pigs were immunized with the HSV-2 vaccine candidate containing 3 μg and 15 μg of total gC2 / gD2 / gE2 RNA, or a PBS control, on days 0 and 28, as summarized in Table 18. Twenty-eight days after the second immunization, on day 56, the animals were bled. On day 60, 5 x 10⁻⁶ PBS was administered. 5 Lethal dose of PFU of HSV-2 strain MS (25 times LD50) 50 To attack guinea pigs. d = day; DRG = dorsal root ganglion; HSV-2 = herpes simplex virus-2; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IM = intramuscular; PFU = plaque-forming unit; RNA-LNP315 = RNA lipid nanoparticles formulated with ALC-0315.
[0012] Figures 5A to 5C Serum IgG antibody titers observed one month after the second immunization in guinea pigs immunized with the HSV-2 vaccine candidate described herein. Serum antibody titers were determined by ELISA on day 56, four weeks after the second immunization with a combination of three polynucleotides encoding glycoprotein C (gC), glycoprotein D (gD), and glycoprotein E (gE), respectively (“trivalent vaccine”). Dose levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. Geometric mean ± 95% CI and individual animal values are shown. P-values were calculated using the Kruskal-Wallis test. * = p-value ≤ 0.05; ** = p-value ≤ 0.01; **** = p-value ≤ 0.0001; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IgG = immunoglobulin G; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. As shown in Figure 5, administration of the HSV-2 vaccine candidate induces inhibition against gC2 ( Figure 5A ), gD2( Figure 5B ) and gE2( Figure 5C Each of them had a high IgG antibody titer, with a 15 μg dose inducing higher titers for gC and gD antigens compared to a 3 μg dose.
[0013] Figures 6A to 6CThe vaginal IgG antibody titer in guinea pigs is shown one month after the second immunization with the HSV-2 modRNA vaccine described herein. Vaginal antibody titers were determined by ELISA on day 56, four weeks after the second immunization with the trivalent vaccine. Dose levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. Geometric mean ± 95% CI and individual animal values are shown. P-values were calculated using the Kruskal-Wallis test. * = p ≤ 0.05; ** = p ≤ 0.01; *** = p ≤ 0.001; **** = p ≤ 0.0001; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; IgG = immunoglobulin G; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. As shown in Figure 6, high vaginal IgG titers target gC2 ( Figure 6A ), gD2( Figure 6B ) and gE2( Figure 6C Each of the following is used to induce, where a 15 μg dose induces a higher titer for gE antigen compared to a 3 μg dose.
[0014] Figure 7 Serum neutralizing antibody titers against HSV-2 in guinea pigs one month after the second immunization with the HSV-2 modRNA vaccine described herein are shown. Neutralizing antibody titers were determined using a serum HSV-2 plaque reduction assay and defined as the highest serum dilution with 5% human complement that reduced the number of HSV-2 plaques by 50%. Samples were collected on day 56, four weeks after the second immunization. Dose levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. Geometric mean ± 95% CI and individual animal values are shown. P-values were calculated using the Mann-Whitney test. * = p-value ≤ 0.05; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid; GMT = geometric mean; CI = confidence interval. Figure 7 The results showed that high neutralizing titers were observed at both 3 μg and 15 μg doses, with the 15 μg dose inducing a higher neutralizing antibody titer compared to the 3 μg dose.
[0015] Figures 8A to 8C This study illustrates weight loss in guinea pigs treated with the HSV-2 vaccine described herein following HSV-2 virus challenge. On day 60, weight loss was assessed using PBS (…). Figure 8A ), 3μg ( Figure 8B) or 15μg ( Figure 8C Approximately one month after a second immunization with the trivalent vaccine or PBS, and up to 14 days after viral challenge with a lethal intravaginal dose of HSV-2, the relative weight changes in guinea pigs were observed. Dosage levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. As shown in Figure 8, administration of a 3 μg dose of HSV-2 vaccine reduced weight loss compared to the PBS negative control, and a 15 μg dose of HSV-2 vaccine further reduced weight loss.
[0016] Figure 9 The survival of guinea pigs immunized with the HSV-2 vaccine described herein up to day 48 after HSV-2 virus challenge is shown. The survival probability of guinea pigs up to 48 days after lethal intravaginal challenge with HSV-2 is shown approximately one month after a second immunization with 3 μg or 15 μg of the trivalent vaccine or PBS. Dosage levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. P-values were calculated using the Mantel-Cox test. ** = p-value ≤ 0.01; PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; HSV-2 = herpes simplex virus-2; RNA = ribonucleic acid. Figure 9 As shown, administration of a 3 μg dose of HSV-2 vaccine significantly increased the survival of guinea pigs, and administration of a 15 μg dose further increased survival.
[0017] Figures 10A to 10C Individual evaluations of genital disease in guinea pigs administered the RNA composition described herein are shown up to day 48 following challenge with a lethal intravaginal dose of HSV-2. Results are shown approximately one month after a second vaccination with the HSV-2 modRNA vaccine on day 60. Figure 10A This shows the average number of days with genital diseases during this period and Figure 10B The average severity of genital lesions is shown over the number of days the animal had genital disease. Mean ± SEM values and individual animal values are shown. Figure 10CThe mean number of days of urinary retention is shown. Dose levels represent the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. P-values were calculated using the Mann-Whitney test. Black circles with red outlines are associated with animals that died after viral challenge in the PBS group. * = p-value ≤ 0.05; HSV-2 = herpes simplex virus-2; SEM = standard error of the mean; PBS = phosphate-buffered saline; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; RNA = ribonucleic acid. Because most animals in the PBS control group died within two weeks of viral challenge, disease scores measured by the number of days of genital lesions and / or the severity of genital lesions were underrepresented in this group, and no statistical analysis was performed for this group. As shown in Figure 10, administration of the HSV-2 vaccine described herein reduces the number of days with observed genital lesions, decreases the severity of observed lesions, and reduces the number of days with urinary retention.
[0018] Figure 11 The cumulative disease score is shown in guinea pigs administered the RNA composition described herein, up to day 48 following challenge with a lethal intravaginal dose of HSV-2. Results are shown at day 60, approximately one month after the second vaccination. The mean number of days with genital disease is shown for each group over the 48-day period. The dose level represents the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. Animals that died from viral disease were not assigned scores within several days post-mortem. HSV-2 = Herpes simplex virus-2; PBS = Phosphate-buffered saline. gC2 = Glycoprotein C from herpes simplex virus-2; gD2 = Glycoprotein D from herpes simplex virus-2; gE2 = Glycoprotein E from herpes simplex virus-2; RNA = Ribonucleic acid. Figure 11 The results showed that administration of 3 μg of HSV-2 vaccine significantly reduced the mean cumulative days of illness, and administration of 15 μg further reduced the mean cumulative days of illness.
[0019] Figures 12A to 12C Vaginal viral titers in guinea pigs administered the HSV-2 vaccine described herein are shown at 2 and 4 days post-challenge. Two days post-lethal intravaginal challenge with HSV-2 ( Figure 12A ) and 4 days ( Figure 12B Vaginal HSV-2 titers were determined by phage plaque assay. Results are plotted as mean ± SEM and individual animal values. The mean number of days of genital shedding of HSV-2 DNA was analyzed by PCR and is shown in ( ). Figure 12CThe HSV-2 vaccine dose level represents the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. The p-value was calculated using the Kruskal-Wallis test. SEM = standard error of the mean; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; HSV-2 = herpes simplex virus-2; DNA = deoxyribonucleic acid; RNA = ribonucleic acid.
[0020] Figures 13A to 13B The DRG and spinal cord DNA copy numbers in guinea pigs administered the HSV-2 vaccine disclosed herein are shown on day 48 post-viral challenge. DRG and spinal cord HSV-2 DNA copy numbers in guinea pigs challenged with a lethal intravaginal dose of HSV-2 on day 48 post-viral challenge were analyzed by qPCR. For immunized animals, GAPDH expression and DRG ( ) are shown relative to day 48 post-viral challenge. Figure 13A ) and spinal cord ( Figure 13B HSV-2 genome copies in [data missing]. Mean ± SEM and individual animal values are shown. The HSV-2 vaccine dose level represents the total RNA content of the three RNAs encoding the corresponding gC2, gD2, and gE2 antigens in a 1:1:1 ratio. P-values were calculated using the Mann-Whitney test. DRG = dorsal root ganglion; SEM = standard error of mean; gC2 = glycoprotein C from herpes simplex virus-2; gD2 = glycoprotein D from herpes simplex virus-2; gE2 = glycoprotein E from herpes simplex virus-2; HSV-2 = herpes simplex virus-2; DNA = deoxyribonucleic acid; RNA = ribonucleic acid.
[0021] Figures 14A to 14F This diagram shows the expression levels in HEK293T cells transfected with RNA encoding the HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens. Cells were transfected using commercial transfection reagents with 0.2 μg / mL modRNA encoding the gC2 and gD2 antigen constructs and 0.4 μg / mL modRNA encoding the gE2 antigen construct. The expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies and secondary fluorescently labeled anti-mouse antibodies to detect the corresponding antigens. Representative data from one experiment show the expression levels of the gC2 antigen construct (…). Figures 14A to 14C ), gD2 antigen construct ( Figures 14D to 14E ) and gE2 antigen construct ( Figure 14FThe median fluorescence intensity (MFI) of the total HEK293T population. Data shown are the mean + SD of three HEK293T transfections. 1600: IL2 secretion signal and HSV-2gC antigen (version 2). 1873: IL2 secretion signal and HSV-2gC antigen (version 4). 2537: HSV-1gD secretion signal and HSV-2gC antigen (version 1). 2538: HSV-1gD secretion signal and HSV-2gC antigen (version 2). 2541: HSV-1gB secretion signal and HSV-2gC antigen (version 2). 2547: HSV-2gE secretion signal and HSV-2gC antigen (version 2). 1601: HSV-2gD secretion signal and HSV-2gD antigen (version 2). 1602: IL2 secretion signal and HSV-2gE antigen (version 2). 2138: HSV-2gE secretion signal and HSV-2gC antigen (Version 4). 2140: HSV-1gD secretion signal and HSV-2gC antigen (Version 4). 2141: HSV-1gB secretion signal and HSV-2gC antigen (Version 4). 2539: HSV-1gD secretion signal and HSV-2gC antigen (Version 4). 2540: HSV-1gB secretion signal and HSV-2gC antigen (Version 1). 2546: HSV-2gE secretion signal and HSV-2gC antigen (Version 1). 2548: HSV-2gE secretion signal and HSV-2gC antigen (Version 4). 2784: HSV-2gC secretion signal and HSV-2gC antigen (Version 2). 2785: HSV-2gC secretion signal and HSV-2gC antigen (Version 2). 1876: IL2 secretion signal and HSV-2gC antigen (version 3). 1874: HSV-2gD secretion signal and HSV-2gD antigen (version 1). 1877: HSV-2gD secretion signal and HSV-2gD antigen (version 3). 1659: HSV-2gD secretion signal and HSV-2gD antigen (version 2). 1660: HSV-2gD secretion signal and HSV-2gE antigen (version 2). 2143: HSV-1gD secretion signal and HSV-2gE antigen (version 4). 1913: HSV-2gE secretion signal and HSV-2gE antigen (version 2). 2553: HSV-1gD secretion signal and HSV-2gE antigen (version 2).
[0022] Figures 15A to 15FThe transfection rate and expression levels in HEK293T cells transfected with RNA encoding HSV-2 gC (gC2), gD (gD2), and gE (gE2) antigens are shown. Cells were transfected using commercial transfection reagents with 0.2 μg / mL modRNA encoding the antigens. The expression of gC2, gD2, and gE2 proteins was detected by flow cytometry using primary monoclonal mouse antibodies and secondary fluorescently labeled anti-mouse antibodies to detect the corresponding antigens. The expression of gC2 (gD2) is shown as an antigen plot. Figure 15A ) and gE2( Figure 15B The percentage of cells expressing the protein and the levels of gC2, gD2, and gE2 in the total HEK293T population (respectively) Figure 15C , Figure 15D and Figure 15E The median fluorescence intensity (MFI) is representative data from one experiment. The data shown are the average + SD of three HEK293T transfections. Data are from up to n = 7 experiments. Figure 15F Cumulative total HEK expression data from the experiments are shown for the gC2 (1600, IL2 secretion signal and HSV-2gC antigen (version 2)), gD2 (1601, HSV-2gD secretion signal and HSV-2gD antigen (version 2)), or gE2 (1602, IL2 secretion signal and HSV-2gE antigen (version 2)) constructs. The RNA constructs characterized in Figure 15 showed similar or improved expression compared to the 1600 (IL2 secretion signal and HSV-2gC antigen (version 2)), 1601 (HSV-2gD secretion signal and HSV-2gD antigen (version 2)), and 1602 (IL2 secretion signal and HSV-2gE antigen (version 2)) constructs. 1597: IL2 secretion signal and HSV-2gC antigen; 1598: HSV-2gD secretion signal and HSV-2gD antigen; 1599: IL2 secretion signal and HSV-2gE antigen.
[0023] Figures 16A to 16B Part A of Example 5 is shown. Figure 16A ) and Part B ( Figure 16B The flowchart is as follows: DL = Dose level; P = Placebo (isotonic NaCl solution); V = BNT163 vaccine.
[0024] Figure 17 The dose escalation pattern in Part A of Example 5 is described. Abbreviations: d = day; DL = dose level; IRC = Internal Review Committee.
[0025] Figures 18A to 18DThe expression levels of HSV-2gC (gC2), gD (gD2), or gE (gE2) antigen constructs in HEK293T cells transfected with RNA are shown. 1600: IL2 secretion signal and HSV-2gC antigen. 2787: HSV-2gD secretion signal and HSV-2gC antigen. 2542: HSV-1gB secretion signal and HSV-2gC antigen. 2786: HSV-2gC secretion signal and HSV-2gC antigen. 1602: IL2 secretion signal and HSV-2gE antigen. 1911: HSV-2gD secretion signal and HSV-2gE antigen. 2143: HSV-1gD secretion signal and HSV-2gE antigen. 2552: HSV-1gD secretion signal and HSV-2gE antigen. 2554: HSV-1gD secretion signal and HSV-2gE antigen. 2788: HSV-2gE secretion signal and HSV-2gE antigen. 2790: HSV-2gE secretion signal and HSV-2gE antigen. 2791: HSV-2gE secretion signal and HSV-2gE antigen. 2792: HSV-2gE secretion signal and HSV-2gE antigen.
[0026] Figures 19A to 19CThe images show the secretion levels in HEK293T cells transfected with RNA encoding HSV-2gC (gC2), gD (gD2), or gE (gE2) antigen constructs. 1600: IL2 secretion signal and HSV-2gC antigen. 1873: IL2 secretion signal and HSV-2gC antigen. 1876: IL2 secretion signal and HSV-2gC antigen. 2138: HSV-2gE secretion signal and HSV-2gC antigen. 2140: HSV-1gD secretion signal and HSV-2gC antigen. 2141: HSV-1gB secretion signal and HSV-2gC antigen. 2537: HSV-1gD secretion signal and HSV-2gC antigen. 2538: HSV-1gD secretion signal and HSV-2gC antigen. 2539: HSV-1gD secretion signal and HSV-2gC antigen. 2540: HSV-1gB secretion signal and HSV-2gC antigen. 2541: HSV-1gB secretion signal and HSV-2gC antigen. 2542: HSV-1gB secretion signal and HSV-2gC antigen. 2546: HSV-2gE secretion signal and HSV-2gC antigen. 2547: HSV-2gE secretion signal and HSV-2gC antigen. 2548: HSV-2gE secretion signal and HSV-2gC antigen. 2784: HSV-2gC secretion signal and HSV-2gC antigen. 2785: HSV-2gC secretion signal and HSV-2gC antigen. 2786: HSV-2gC secretion signal and HSV-2gC antigen. 2787: HSV-2gD secretion signal and HSV-2gC antigen. 3233: HSV-1gD secretion signal and HSV-2gC antigen. 1601: HSV-2gD secretion signal and HSV-2gD antigen. 1659: HSV-2gD secretion signal and HSV-2gD antigen. 3234: HSV-2gD secretion signal and HSV-2gD antigen. 1602: IL2 secretion signal and HSV-2gE antigen. 1911: HSV-2gD secretion signal and HSV-2gE antigen. 1660: HSV-2gD secretion signal and HSV-2gE antigen. 1913: HSV-2gE secretion signal and HSV-2gE antigen. 2143: HSV-1gD secretion signal and HSV-2gE antigen. 2552: HSV-1gD secretion signal and HSV-2gE antigen. 2553: HSV-1gD secretion signal and HSV-2gE antigen. 2554: HSV-1gD secretion signal and HSV-2gE antigen. 2788: HSV-2gE secretion signal and HSV-2gE antigen. 2790: gE2 secretion signal and gE2 antigen. 2791: gE2 secretion signal and HSV-2gE antigen. 2792: gE2 secretion signal and gE2 antigen.3235: gD2 secretion signal and HSV-2gE antigen. Detailed Implementation
[0027] Some definitions
[0028] Generally, unless otherwise expressly stated, the terms used herein are as they are understood in the art. Explicit definitions of certain terms are provided below; the meaning of these and other terms will be apparent to those skilled in the art from the context throughout this specification.
[0029] To facilitate understanding of this invention, certain terms are defined below. The following terms and additional definitions of other terms are set forth throughout this specification.
[0030] About: When used herein to refer to a value, the term “about” refers to a value similar to the value in the context. Generally, those skilled in the art will understand the extent of variation covered by “about” in that context. For example, in some embodiments, the term “about” may cover a range of values within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the value in question.
[0031] Agent: As used herein, the term "agent" can refer to a physical entity or phenomenon. In some embodiments, an agent may be characterized by specific characteristics and / or effects. In some embodiments, an agent may be a compound, molecule, or entity of any chemical class, including, for example, small molecules, peptides, nucleic acids, sugars, lipids, metals, or combinations or complexes thereof. In some embodiments, the term "agent" may refer to a compound, molecule, or entity comprising a polymer. In some embodiments, the term may refer to a compound or entity comprising one or more polymer moieties. In some embodiments, the term "agent" may refer to a compound, molecule, or entity that substantially does not contain a particular polymer or polymer moieties. In some embodiments, the term may refer to a compound, molecule, or entity lacking or substantially containing no polymer or polymer moieties.
[0032] Amino acid: In its broadest sense, as used herein, the term "amino acid" refers to a compound and / or substance that can be incorporated into, is incorporated into, or has been incorporated into a polypeptide chain, for example, by forming one or more peptide bonds. In some embodiments, an amino acid has the general structure H₂N–C(H)(R)–COOH. In some embodiments, an amino acid is a naturally occurring amino acid. In some embodiments, an amino acid is a non-natural amino acid; in some embodiments, an amino acid is a D-amino acid; in some embodiments, an amino acid is an L-amino acid. "Standard amino acid" refers to any one of the twenty standard L-amino acids commonly found in naturally occurring peptides. "Non-standard amino acid" refers to any amino acid other than a standard amino acid, whether it is synthesized or derived from a natural source. In some embodiments, amino acids, including carboxyl and / or amino-terminal amino acids in polypeptides, may contain structural modifications compared to the general structure described above. For example, in some embodiments, amino acids may be modified compared to the general structure by methylation, amidation, acetylation, polyethylene glycolation, saccharification, phosphorylation, and / or substitution (e.g., amino, carboxylic acid groups, one or more protons and / or hydroxyl groups). In some embodiments, this modification may, for example, alter the cycling half-life of a peptide containing the modified amino acid compared to a peptide containing the same unmodified amino acid in other respects. In some embodiments, this modification does not significantly alter the relevant activity of a peptide containing the modified amino acid compared to a peptide containing the same unmodified amino acid in other respects. It will be clear from the context that in some embodiments, the term "amino acid" may be used to refer to a free amino acid; in some embodiments, it may be used to refer to the amino acid residues of a peptide.
[0033] Antibody Agent: As used herein, the term "antibody agent" refers to an agent that specifically binds to a particular antigen. In some embodiments, the term encompasses polypeptides or polypeptide complexes that include structural components sufficient to confer specific binding to immunoglobulins. For example, in some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes one or more structural components that are recognized by those skilled in the art as complementarity-determining regions (CDRs); in some embodiments, an antibody agent is or comprises a polypeptide whose amino acid sequence includes at least one CDR (e.g., at least one heavy chain CDR and / or at least one light chain CDR) that is substantially identical to a CDR found in a reference antibody. In some embodiments, the included CDR is substantially identical to a reference CDR because it is sequence-identical or contains between 1 and 5 amino acid substitutions compared to the reference CDR. In some embodiments, the included CDR is substantially identical to a reference CDR because it exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments, the included CDR is substantially identical to a reference CDR because it exhibits at least 96%, 96%, 97%, 98%, 99%, or 100% sequence identity with the reference CDR. In some embodiments, the included CDR is substantially identical to a reference CDR because, compared to the reference CDR, at least one amino acid in the included CDR is deleted, added, or substituted, but the included CDR has an amino acid sequence that is otherwise identical to the reference CDR. In some embodiments, the included CDR is substantially identical to a reference CDR because, compared to the reference CDR, 1-5 amino acids in the included CDR are deleted, added, or substituted, but the included CDR has the same amino acid sequence as the reference CDR in other respects. In some embodiments, the included CDR is substantially identical to a reference CDR because, compared to the reference CDR, at least one amino acid in the included CDR is substituted, but the included CDR has the same amino acid sequence as the reference CDR in other respects. In some embodiments, the included CDR is substantially identical to a reference CDR because, compared to the reference CDR, 1-5 amino acids in the included CDR are deleted, added, or substituted, but the included CDR has the same amino acid sequence as the reference CDR in other respects. In some embodiments, the antibody agent is or includes a polypeptide whose amino acid sequence comprises structural components recognized by those skilled in the art as variable domains of immunoglobulins.In some embodiments, the antibody agent is or comprises a polypeptide whose amino acid sequence comprises structural components recognized by those skilled in the art as corresponding to CDRs 1, 2, and 3 of the antibody variable domain; in some such embodiments, the antibody agent is or comprises a polypeptide or set of polypeptides whose amino acid sequence together comprises structural components recognized by those skilled in the art as corresponding to the heavy chain and light chain variable region CDRs, such as heavy chain CDRs 1, 2, and / or 3 and light chain CDRs 1, 2, and / or 3. In some embodiments, the antibody agent is a polypeptide protein having a binding domain homologous or substantially homologous to an immunoglobulin binding domain. In some embodiments, the antibody agent may be or comprise a multiclonal antibody formulation. In some embodiments, the antibody agent may be or comprise a monoclonal antibody formulation. In some embodiments, the antibody agent may comprise one or more constant region sequences specific to a particular organism such as a camel, human, mouse, primate, rabbit, or rat; in many embodiments, the antibody agent may comprise one or more constant region sequences specific to humans. In some embodiments, the antibody agent may comprise one or more sequence components recognized by those skilled in the art as humanized sequences, primate-like sequences, chimeric sequences, etc. In some embodiments, the antibody agent may be a typical antibody (e.g., it may contain two heavy chains and two light chains). In some embodiments, the antibody agent may be selected from, but is not limited to, the following formats: intact IgA, IgG, IgE, or IgM antibodies; bispecific or multispecific antibodies (e.g., ...). (etc.); antibody fragments, such as Fab fragments, Fab' fragments, F(ab')2 fragments, Fd' fragments, Fd fragments and isolated CDRs or collections thereof; single-chain Fv; peptide-Fc fusions; single-domain antibodies (e.g., shark single-domain antibodies, such as IgNAR or fragments thereof); camel-like antibodies; masking antibodies (e.g. Small modular immunotherapies (SMIPs) TM Single-chain or tandem bivalent antibodies VHH; Microantibodies; Ankylosing spondylogenetics or DARTs; TCR-like antibodies; MicroProteins; and In some embodiments, the antibody may lack the covalent modifications (e.g., glycan linkages) it would have naturally. In some embodiments, the antibody may contain linkages to covalent modifications (e.g., glycans, payloads (e.g., detectable portions, therapeutic portions, catalytic portions, etc.) or other dangling groups (e.g., polyethylene glycol, etc.).
[0034] Antigen: Those skilled in the art will understand from this specification that the term "antigen" refers to a molecule recognized by the immune system, such as the adaptive immune system in certain embodiments, to elicit an antigen-specific immune response. In some embodiments, an antigen-specific immune response may be or include the production of antibodies and / or antigen-specific T cells. In some embodiments, the antigen is a peptide or polypeptide containing at least one epitope against which an immune response can be elicited. In one embodiment, the antigen is presented by immune system cells, such as antigen-presenting cells, like dendritic cells or macrophages. In one embodiment, the antigen or its processed product (such as a T-cell epitope) binds to a T-cell receptor or B-cell receptor, or to an immunoglobulin molecule (such as an antibody). Thus, the antigen or its processed product can specifically react with antibodies or T lymphocytes (T cells). In one embodiment, the antigen is a parasitic antigen. According to this disclosure, in some embodiments, the antigen may be delivered by an RNA molecule as described herein. In some embodiments, the peptide or polypeptide antigen may be 2-100 amino acids, comprising, for example, lengths of 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids. In some embodiments, the peptide or polypeptide antigen may be greater than 50 amino acids. In some embodiments, the peptide or polypeptide antigen may be greater than 100 amino acids. In some embodiments, the antigen is recognized by immune effector cells. In some embodiments, if the antigen is recognized by immune effector cells, it is capable of inducing stimulation, priming, and / or amplification of immune effector cells carrying antigen receptors that recognize the antigen in the presence of appropriate co-stimulatory signals. In the context of embodiments of this disclosure, in some embodiments, the antigen may be presented or present on the surface of cells (e.g., antigen-presenting cells). In one embodiment, the antigen is presented by diseased cells (such as virus-infected cells). In one embodiment, the antigen receptor is a TCR that binds to an epitope presented in the context of MHC. In one embodiment, when expressed and / or present on T cells, TCR binding to an antigen presented by a cell (such as an antigen-presenting cell) leads to stimulation, initiation, and / or expansion of the T cell. In one embodiment, when expressed and / or present on T cells, TCR binding to an antigen presented on a diseased cell leads to cell lysis and / or apoptosis of the diseased cell, wherein the T cell preferably releases cytotoxic factors such as perforin and granzyme.
[0035] Related: When used herein, the term means that two events or entities are “related” to each other if the presence, level, extent, type, and / or form of one event or entity is associated with the presence, level, extent, type, and / or form of another event or entity. For example, an entity is considered related to a disease, condition, or disorder if the presence, level, and / or form of a particular entity (e.g., polypeptide, genetic trait, metabolite, microorganism, etc.) is associated with the incidence, susceptibility, severity, stage, etc., of that particular disease, condition, or disorder (e.g., in a relevant population). In some embodiments, two or more entities are “related” to each other if they interact directly or indirectly to bring them physically close to each other and / or keep them close to each other. In some embodiments, two or more physically related entities are covalently connected to each other; in some embodiments, two or more physically related entities are not covalently connected to each other, but are non-covalently related, for example, by means of hydrogen bonds, van der Waals interactions, hydrophobic interactions, magnetism, and combinations thereof.
[0036] Binding: Those skilled in the art will understand from this specification that the term "binding" generally refers to non-covalent association between or within entities or parts. In some embodiments, binding data are expressed as "IC50". As understood in the art, IC50 is the concentration of the agent being evaluated in a binding assay at which 50% inhibition of binding to a reference agent with a known binding affinity for a binding partner is observed. In some embodiments, the assay is run under conditions that limit the binding target and reference concentrations, and these values approximate K. D Value. Determination of binding is well known in the art and described in detail, for example, in PCT publications WO 94 / 20127 and WO 94 / 03205, and other publications such as Sidney et al., Current Protocols in Immunology 18.3.1 (1998); Sidney et al., J. Immunol. 154:247 (1995); and Sette et al., Mol. Immunol. 31:813 (1994). Alternatively, binding can be expressed relative to the binding of a reference standard peptide. For example, it can be based on its IC50 value relative to a reference standard peptide. 50 IC 50Other assay systems may also be used, including those that determine the presence of live cells (e.g., Ceppellini et al., Nature 339:392 (1989); Christnick et al., Nature 352:67 (1991); Busch et al., Int. Immunol. 2:443 (1990); Hill et al., J. Immunol. 147:189 (1991); del Guercio et al., J. Immunol. 154:685 (1995)), and cell-free systems using detergent lysates (e.g., Cerundolo et al., J. Immunol. 2:443 (1990); Hill et al., J. Immunol. 2:443 (1990); del Guercio et al., J. Immunol. 2:443 (1990); cell-free systems using detergent lysates (e.g., Cerundolo et al., J. Immunol. 2:443 (1995)). MHC can be stabilized and purified (e.g., Hill et al., J. Immunol. 152, 2890 (1994); Marshall et al., J. Immunol. 152: 4946 (1994)), ELISA systems (e.g., Reay et al., EMBO J. 11: 2829 (1992)), surface plasmon resonance (e.g., Khilko et al., J. Biol. Chem. 268: 15425 (1993)), high-throughput soluble phase assays (Hammer et al., J. Exp. Med. 180: 2353 (1994)), and measurements of MHC class I stability or assembly (e.g., Ljunggren et al., Nature 346: 476 (1990); Schumacher et al., Cell 62: 563 (1990); Townsend et al., Cell 62:285 (1990); Parker et al., J. Immunol. 149:1896 (1992)).
[0037] Cap: As used herein, the term "cap" refers to a structure comprising or substantially composed of nucleoside-5'-triphosphate, which is typically attached to the 5' end of uncapped RNA (e.g., uncapped RNA having a 5'-diphosphate). In some embodiments, the cap is or comprises a guanine nucleotide. In some embodiments, the cap is or comprises a naturally occurring RNA 5' cap, including, for example, but not limited to, a 7-methylguanosine cap having a structure designated "m7G". In some embodiments, the cap is or comprises a synthetic cap analogue that resembles an RNA cap structure and, if attached thereto, has the ability to stabilize RNA, including, for example, but not limited to, anti-reverse cap analogues (ARCA) known in the art. Those skilled in the art will understand that methods for attaching a cap to the 5' end of RNA are known in the art. For example, in some embodiments, capped RNA can be obtained by in vitro capping of RNA having a 5'-triphosphate group or RNA having a 5'-diphosphate group using a capping enzyme system (including, for example, but not limited to, a vaccinia capping enzyme system or a brewer's yeast capping enzyme system). Alternatively, capped RNA can be obtained by in vitro transcription (IVT) of a single-stranded DNA template in the presence of a dinucleotide or trinucleotide cap analogue.
[0038] Cell-mediated immunity: The terms "cell-mediated immunity," "cellular immunity," "cellular immune response," or similar terms are intended to include cellular responses against cells characterized by antigen expression, specifically the presentation of MHC class I or II antigens. Cellular responses involve immune effector cells, particularly T cells or T lymphocytes, which act as "helpers" or "killers." Helper T cells (also known as CD4+) + T cells (or CD4 T cells) play a central role in regulating the immune response, and killer cells (also known as cytotoxic T cells, cytolytic T cells, CD8 T cells) also play a central role. + T cells, CD8 T cells, or CTLs kill diseased cells, such as virus-infected cells, thereby preventing the production of more diseased cells.
[0039] Co-administration: As used herein, the term "co-administration" refers to the use of a pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) and an additional therapeutic agent. The combined use of the pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) and the additional therapeutic agent may be performed simultaneously or individually (e.g., sequentially in any order). In some embodiments, the pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) and the additional therapeutic agent may be combined in a pharmaceutically acceptable carrier, or may be placed in a separate carrier and delivered to target cells or administered to a subject at different times. Each of these situations is intended to fall within the meaning of "co-administration" or "combination," provided that the pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) and the additional therapeutic agent are delivered or administered sufficiently close in time such that there is at least some temporal overlap in the biological effects produced by each for the treated target cells or subject.
[0040] Codon optimization: As used herein, the term "codon optimization" refers to altering codons in the coding region of a nucleic acid molecule to reflect typical codon usage of the host organism, without preferably altering the amino acid sequence encoded by the nucleic acid molecule. In the context of this disclosure, in some embodiments, codon optimization is performed on the coding region to achieve optimal expression in a subject treated with the RNA molecule described herein. In some embodiments, codon optimization may be performed such that inserting codons that yield frequently occurring tRNAs replaces "rare codons." In some embodiments, codon optimization may include increasing the G / C content of the coding region of the RNA described herein, compared to the guanosine / cytosine (G / C) content of the corresponding coding sequence of wild-type RNA, wherein the amino acid sequence encoded by the RNA is preferably unmodified compared to the amino acid sequence described herein.
[0041] Combination therapy: As used herein, the term "combination therapy" refers to those situations where a subject is simultaneously exposed to two or more treatment regimens (e.g., two or more therapeutic agents). In some embodiments, the two or more regimens may be administered simultaneously; in some embodiments, such regimens may be administered sequentially (e.g., all "doses" of the first regimen are administered before any dose of the second regimen); in some embodiments, such agents are administered in an overlapping dosing regimen. In some embodiments, "administration" of combination therapy may involve combining one or more agents or methods of administration to a subject receiving other agents or methods. For clarity, combination therapy does not require individual agents to be administered together in a single composition (or even simultaneously), but in some embodiments, two or more agents or their active portions may be administered together in a combination composition.
[0042] Comparable: As used herein, the term "comparable" means two or more agents, entities, situations, conditions, etc., that may not be identical to each other, but are similar enough to allow for comparison between them, so that those skilled in the art will understand that reasonable conclusions can be drawn based on observed differences or similarities. In some embodiments, a set of comparable conditions, environments, individuals, or groups is characterized by a plurality of features of substantial identity and one or a few different features. In the context, those skilled in the art will understand the degree of identity required for two or more such sets of agents, entities, situations, conditions, etc., to be considered comparable in any given situation. For example, those skilled in the art will understand that a set of environments, individuals, or groups is comparable to each other when characterized by a sufficient number and type of features of substantial identity to ensure that reasonable conclusions are drawn that differences in results or observed phenomena in different sets of environments, individuals, or groups are caused by or indicate changes in those different features.
[0043] Corresponding to: As used herein, the term “corresponding to” refers to a relationship between two or more entities. For example, the term “corresponding to” can be used to specify the positional / identical nature of a structural component in a compound or composition relative to another compound or composition (e.g., relative to a suitable reference compound or composition). For example, in some embodiments, monomeric residues in a polymer (e.g., amino acid residues in a polypeptide or nucleic acid residues in a polynucleotide) can be identified as “corresponding to” residues in a suitable reference polymer. For example, those skilled in the art will understand that, for simplicity, residues in polypeptides are typically designated using a typical numbering system based on a reference-related polypeptide, such that the amino acid “corresponding to,” for example, the residue at position 190, is not actually the 190th amino acid in a particular amino acid chain, but rather corresponds to the 190th residue in the reference polypeptide; those skilled in the art will readily understand how to identify “corresponding” amino acids. For example, those skilled in the art will recognize various sequence alignment strategies that can be used to identify “corresponding” residues in peptides and / or nucleic acids according to this disclosure, including software programs such as BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / Hhsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE. Those skilled in the art will also understand that, in some cases, the term “corresponding” can be used to describe an event or entity that shares a related similarity with another event or entity (e.g., a suitable reference event or entity). To cite just one example, in some implementations a gene or protein in an organism may be described as “corresponding” to a gene or protein from another organism in order to indicate that it plays a similar role or performs a similar function and / or that it exhibits a particular degree of sequence identity or homology, or shares specific characteristic sequence components.
[0044] Derivative: In the context of an amino acid sequence (peptide or polypeptide) "derived from" a specified amino acid sequence (peptide or polypeptide), it refers to a structural analog of the specified amino acid sequence. In some embodiments, the amino acid sequence derived from a particular amino acid sequence has the same, substantially the same, or homologous amino acid sequence as the specific sequence or a fragment thereof. The amino acid sequence derived from a particular amino acid sequence may be a variant of the specific sequence or a fragment thereof. For example, those skilled in the art will understand that antigens suitable for use herein may be modified such that the antigen is sequence-different from the naturally occurring sequence or native sequence from which it is derived, while retaining the desired activity of the native sequence.
[0045] Design: As used herein, the term “design” means (i) an agent whose structure is selected or has been selected artificially; (ii) produced by a process requiring artificial intervention; and / or (iii) an agent that is different from natural substances and other known agents.
[0046] Dosing regimen: Those skilled in the art will understand that the term "dosing regimen" can be used to refer to a set of unit doses (usually more than one) administered individually to a subject, typically at intervals of time. In some embodiments, a given therapeutic agent has a recommended dosing regimen, which may involve one or more doses. In some embodiments, the dosing regimen includes multiple doses, each time-spaced from the other doses. In some embodiments, individual doses are spaced from each other by the same length of time interval; in some embodiments, the dosing regimen includes multiple doses and at least two distinct time intervals separating the individual doses. In some embodiments, all doses within the dosing regimen have the same unit dose amount. In some embodiments, the different doses within the dosing regimen have different amounts. In some embodiments, the dosing regimen includes a first dose of a first dose amount, followed by one or more additional doses of a second dose amount different from the first dose amount. In some embodiments, the dosing regimen includes a first dose of a first dose amount, followed by one or more additional doses of a second dose amount identical to the first dose amount. In some embodiments, when administered in a relevant population, the dosing regimen is associated with a desired or beneficial outcome (i.e., a therapeutic dosing regimen).
[0047] Encoding: As used herein, the term "encode" or "encoding" refers to the sequence information that guides the production of a first molecule having a defined nucleotide sequence (e.g., RNA) or a defined amino acid sequence of a second molecule. For example, a DNA molecule may encode an RNA molecule (e.g., through transcription involving a DNA-dependent RNA polymerase). An RNA molecule may encode a polypeptide (e.g., through translation). Thus, if transcription and translation of RNA corresponding to a gene produces a polypeptide in a cell or other biological system, then the gene, cDNA, or RNA molecule (e.g., RNA) encodes the polypeptide. In some embodiments, the coding region of an RNA molecule encoding a target antigen refers to the coding strand whose nucleotide sequence is identical to the RNA sequence of such a target antigen. In some embodiments, the coding region of an RNA molecule encoding a target antigen refers to the non-coding strand of this target antigen, which can be used as a template for gene or cDNA transcription.
[0048] Engineered: Generally speaking, the term “engineered” refers to aspects that are artificially manipulated. For example, a polynucleotide is considered “engineered” when two or more sequences that are not linked together in the order described in nature are artificially manipulated to be directly linked to each other in an engineered polynucleotide, and / or when a particular residue in a polynucleotide is non-naturally present and / or is artificially manipulated to be linked to an entity or part that is not linked to it in nature.
[0049] Epitope: As used herein, the term "epitaph" refers to a portion specifically recognized by an immunoglobulin-binding component (e.g., an antibody or receptor). For example, an epitope may be recognized by T cells, B cells, or antibodies. In some embodiments, an epitope consists of multiple chemical atoms or groups on an antigen. In some embodiments, such chemical atoms or groups are surface-exposed when the antigen adopts an associated three-dimensional conformation. In some embodiments, such chemical atoms or groups are spatially and physically close to each other when the antigen adopts this conformation. In some embodiments, at least some of such chemical atoms are physically separated groups when the antigen adopts an alternative conformation (e.g., linearization). Therefore, in some embodiments, an epitope of an antigen may include continuous or discontinuous portions of the antigen. In some embodiments, an epitope is or comprises a T-cell epitope. In some embodiments, an epitope may have a length of about 5 to about 30 amino acids, or about 10 to about 25 amino acids, or about 5 to about 15 amino acids, or about 5 to 12 amino acids, or about 6 to about 9 amino acids.
[0050] Expression: As used herein, the term “expression” of a nucleic acid sequence refers to the production of a gene product from the nucleic acid sequence. In some embodiments, the gene product may be a transcript. In some embodiments, the gene product may be a polypeptide. In some embodiments, the expression of a nucleic acid sequence involves one or more of the following: (1) generating an RNA template from a DNA sequence (e.g., by transcription); (2) processing an RNA transcript (e.g., by splicing, editing, etc.); (3) translating RNA into a polypeptide or protein; and / or (4) post-translational modification of the polypeptide or protein.
[0051] 5'UTR: As used herein, the term "5'UTR" refers to the sequence of an RNA molecule between the transcription start site and the start codon of the coding region of the RNA molecule. In some embodiments, "5'UTR" refers, for example, to the sequence of an RNA molecule that begins at the transcription start site and ends one nucleotide (nt) before the start codon (typically AUG) of the coding region of the RNA molecule, in its natural context.
[0052] Fragment: The term "fragment" as used herein in the context of nucleic acid sequences (e.g., RNA sequences) or amino acid sequences may generally refer to a portion of a reference sequence. In some embodiments, the reference sequence is, for example, a full-length sequence of a nucleic acid sequence or amino acid sequence. Therefore, a fragment generally refers to a sequence identical to a corresponding extension within the reference sequence. In some embodiments, a fragment comprises a continuous extension of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 95% of the total length of the reference sequence from which the fragment is derived. In some embodiments, with respect to an amino acid sequence (peptide or polypeptide), the term "fragment" refers to a portion of an amino acid sequence, such as a sequence representing a shortened amino acid sequence at the N-terminus and / or C-terminus. In some embodiments, a fragment of an amino acid sequence comprises at least 6, specifically at least 8, at least 12, at least 15, at least 20, at least 30, at least 50, or at least 100 consecutive amino acids from an amino acid sequence.
[0053] Homology: As used herein, the term "homology" or "homogeneity" refers to the overall correlation between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, molecules are considered "homologous" to each other if the sequences of polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules have at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity. In some embodiments, molecules are considered “homologous” to each other if the sequences of polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% similar (e.g., containing residues with relevant chemical properties at corresponding positions). For example, as is well known to those skilled in the art, certain amino acids are generally classified as “hydrophobic” or “hydrophilic” amino acids that are similar to each other, and / or have “polar” or “nonpolar” side chains. The substitution of one amino acid for another of the same type is generally considered a “homologous” substitution.
[0054] Humoral immunity: As used herein, the term "humoral immunity" or "humoral immune response" refers to antibody production and its associated processes, including: Th2 activation and cytokine production, germinal center formation and allotype conversion, affinity maturation, and memory cell production. It also refers to the effector functions of antibodies, including pathogen neutralization, classical complement activation, and opsonization-promoted phagocytosis and pathogen elimination.
[0055] Identity: As used herein, the term "identity" refers to the overall relevance between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, molecules are considered "substantially identical" to each other if the sequences of polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules have at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity. The calculation of the percentage of identity between two nucleic acid or polypeptide sequences can be performed, for example, by aligning the two sequences for optimal comparison purposes (e.g., for optimal alignment, vacancies can be introduced into one or both of the first and second sequences, and different sequences can be ignored for comparison purposes). In some implementations, the length of the sequence to be aligned for comparison purposes is at least 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding positions are then compared. The molecule is considered identical at that position when a position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) as the corresponding position in the second sequence. The percentage identity between the two sequences is a function of the number of shared positions, taking into account the number and length of vacancies that are necessary to achieve optimal alignment of the two sequences. The comparison of sequences and the determination of the percentage identity between the two sequences can be accomplished using mathematical algorithms. For example, the percentage identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (1989), which is incorporated into the ALIGN program (version 2.0). In some implementations, nucleic acid sequence comparisons performed using the ALIGN program employ a PAM120 weighted residue table, a 12-fold vacancy length penalty, and a 4-fold vacancy penalty. The percentage of identity between two nucleotide sequences can alternatively be determined using the GAP program in the GCG software package, which utilizes the NWSgapdna.CMP matrix.
[0056] Increased, induced, or decreased: As used herein, these terms, or grammatically comparable comparative terms, indicate a value relative to a comparable reference measurement. For example, in some embodiments, an assessment value achieved using the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be “increased” relative to an assessment value obtained using a comparable reference pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine). Alternatively or additionally, in some embodiments, an assessment value achieved in a subject may be “increased” relative to a value obtained in the same subject under different conditions (e.g., before or after an event; or with or without an event such as administration of a pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) as described herein), or in different comparable subjects (e.g., in terms of prior exposure to a disease, unlike the subject of interest, e.g., there are no comparable subjects who have been administered a pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) as described herein). In some embodiments, the comparable term refers to a statistically relevant difference (e.g., having a universality and / or magnitude sufficient to achieve statistical relevance). Those skilled in the art will appreciate that... It may be readily possible to determine the extent and / or generality of the difference required or sufficient to achieve this statistical significance in a given context. In some embodiments, the term "reduced" or its equivalent means a reduction in the level of the assessed value by at least 5%, at least 10%, at least 20%, at least 50%, at least 75%, or more compared to a comparable reference. In some embodiments, the term "reduced" or its equivalent means complete or substantially complete suppression, i.e., a reduction to zero or substantially zero. In some embodiments, the term "increased" or "induced" means an increase in the level of the assessed value by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 80%, at least 100%, at least 200%, at least 500%, or more compared to a comparable reference.
[0057] Ionizable: The term "ionizable" refers to a compound, group, or atom that carries a charge at a given pH. In the case of ionizable amino lipids, such lipids or their functional groups or atoms carry a positive charge at a given pH. In some embodiments, ionizable amino lipids carry a positive charge at an acidic pH. In some embodiments, ionizable amino lipids are primarily neutral at physiological pH values, such as about 7.0-7.4 in some embodiments, but become positively charged at lower pH values. In some embodiments, ionizable amino lipids may have a pKa in the range of about 5 to about 7.
[0058] Isolated: The term "isolated" means altered or removed from its natural state. For example, nucleic acids or peptides naturally present in living organisms are not "isolated," but the same nucleic acids or peptides partially or completely isolated from their native coexisting material are "isolated." Isolated nucleic acids or proteins can exist in substantially pure form or in non-natural environments, such as host cells.
[0059] Lipids: As used herein, the terms “lipid” and “lipid-like material” are broadly defined as molecules comprising one or more hydrophobic portions or groups and optionally one or more hydrophilic portions or groups. Molecules comprising both hydrophobic and hydrophilic portions are also commonly referred to as amphiphiles.
[0060] RNA lipid nanoparticles: As used herein, the term "RNA lipid nanoparticle" refers to nanoparticles comprising at least one lipid and an RNA molecule. In some embodiments, the RNA lipid nanoparticles comprise at least one ionizable amino lipid. In some embodiments, the RNA lipid nanoparticles comprise at least one ionizable amino lipid, at least one accessory lipid, and at least one polymer-conjugated lipid (e.g., PEG-conjugated lipid). In various embodiments, the RNA lipid nanoparticles described herein may have an average size (e.g., Z-average) of about 100 nm to 1000 nm, or about 200 nm to 900 nm, or about 200 nm to 800 nm, or about 250 nm to about 700 nm. In some embodiments of this disclosure, the RNA lipid nanoparticles may have a particle size (e.g., Z-average) of about 30 nm to about 200 nm, or about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 80 nm to about 100 nm, about 90 nm to about 100 nm, about 70 nm to about 90 nm, about 80 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, the average size of the lipid nanoparticles is determined by measuring the particle size. In some embodiments, the RNA lipid nanoparticles may be prepared by mixing lipids with RNA molecules described herein.
[0061] Lipid-like molecules: As used herein, "lipid-like molecules" refers to lipid-like molecules. In some embodiments, lipid-like molecules are amphiphilic molecules having one or more lipid-like physical properties. In the context of this disclosure, the term lipid is considered to encompass lipid-like molecules.
[0062] Nanoparticles: As used herein, the term "nanoparticle" refers to a particle having an average size suitable for parenteral administration. In some embodiments, the nanoparticle has a longest dimension (e.g., diameter) of less than 1,000 nanometers (nm). In some embodiments, the nanoparticle can be characterized by a longest dimension (e.g., diameter) of less than 300 nm. In some embodiments, the nanoparticle can be characterized by a longest dimension (e.g., diameter) of less than 100 nm. In many embodiments, the nanoparticle can be characterized by a longest dimension between about 1 nm and about 100 nm, or between about 1 μm and about 500 nm, or between about 1 nm and 1,000 nm. In many embodiments, a population of nanoparticles is characterized by an average size (e.g., longest dimension) below about 1,000 nm, about 500 nm, about 100 nm, about 50 nm, about 40 nm, about 30 nm, about 20 nm, or about 10 nm, and often above about 1 nm. In many embodiments, the nanoparticle may be substantially spherical such that its longest dimension is its diameter. In some implementations, the nanoparticles have a diameter of less than 100 nm, as defined by the National Institutes of Health.
[0063] Naturally occurring: As used herein, the term “naturally occurring” refers to an entity that can exist in nature. For example, peptides or nucleic acids that exist in organisms (including viruses) and can be isolated from natural sources but have not been intentionally modified by humans in a laboratory are naturally occurring.
[0064] Neutralization: As used herein, the term "neutralization" refers to an event in which a binder (such as an antibody) binds to a biologically active site of a virus (such as a receptor-binding protein), thereby inhibiting parasitic infection of the cell. In some embodiments, the term "neutralization" refers to an event in which the binder eliminates or significantly reduces the ability of the cell to infect it.
[0065] Nucleic acid particles: "Nucleic acid particles" can be used to deliver nucleic acids to target sites of interest (e.g., cells, tissues, organs, etc.). Nucleic acid particles may comprise at least one cationic lipid or cationic ionizable lipid or lipid-like material, at least one cationic polymer (such as protamine) or a mixture thereof, and nucleic acid. In some embodiments, the nucleic acid particles are lipid nanoparticles. In some embodiments, the nucleic acid particles are lipid complex particles.
[0066] Nucleic Acids / Polynucleotides: As used herein, the term "nucleic acid" refers to a polymer of at least 10 or more nucleotides. In some embodiments, the nucleic acid is or comprises DNA. In some embodiments, the nucleic acid is or comprises RNA. In some embodiments, the nucleic acid is or comprises peptide nucleic acid (PNA). In some embodiments, the nucleic acid is or comprises a single-stranded nucleic acid. In some embodiments, the nucleic acid is or comprises a double-stranded nucleic acid. In some embodiments, the nucleic acid comprises both single-stranded and double-stranded portions. In some embodiments, the nucleic acid comprises a backbone comprising one or more phosphodiester-linked bonds. In some embodiments, the nucleic acid comprises a backbone comprising both phosphodiester-linked and non-phosphodiester-linked bonds. For example, in some embodiments, the nucleic acid may comprise a backbone comprising one or more phosphate thioester or 5'-N-phosphamide-linked bonds and / or one or more peptide bonds, for example, as in "peptide nucleic acid". In some embodiments, the nucleic acid comprises one or more or all of the natural residues (e.g., adenine, cytosine, deoxyadenosine, deoxycytidine, deoxyguanosine, deoxythymidine, guanine, thymine, uracil). In some embodiments, the nucleic acid comprises one or more or all of the non-natural residues. In some embodiments, the non-natural residues comprise nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolopyrimidine, 3-methyladenosine, 5-methylcytidine, C-5-propynyl-cytidine, C-5-propynyl-uridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazoadenosine, 7-deazoguanosine, 8-oxadenosine, 8-oxoguanosine, 6-O-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, compared to the sugars in natural nucleic acids, the non-natural residues comprise one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose). In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or a polypeptide. In some embodiments, the nucleic acid has a nucleotide sequence comprising one or more introns. In some embodiments, the nucleic acid can be prepared by isolating from a natural source, for example by enzymatic synthesis (e.g., in vivo or in vitro) via complementary template-based polymerization, replication in a recombinant cell or system, or by chemical synthesis.In some implementations, the nucleic acid length is at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 350. 0, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 8500, 9000, 9500, 10,000, 10,500, 11,000, 11,500, 12,000, 12,500, 13,000, 13,500, 14,000, 14,500, 15,000, 15,500, 16,000, 16,500, 17,000, 17,500, 18,000, 18,500, 19,000, 19,500, or 20,000 or more residues or nucleotides.
[0067] Nucleotide: As used herein, the term "nucleotide" means as it is generally understood in the art. When the number of nucleotides is used as an indicator of, for example, the size of a polynucleotide, a certain number of nucleotides refers to the number of nucleotides on a single strand of, for example, a polynucleotide.
[0068] Patient: As used herein, the term "patient" means any organism that suffers from or is at risk of a disease, condition, or disorder. Typical patients include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and / or humans). In some embodiments, the patient is a human. In some embodiments, the patient suffers from or is susceptible to one or more diseases, conditions, or disorders. In some embodiments, the patient exhibits one or more symptoms of a disease, condition, or disorder. In some embodiments, the patient has been diagnosed with one or more diseases, conditions, or disorders. In some embodiments, the disease, condition, or disorder suitable for the provided technology is or includes HSV infection. In some embodiments, the patient has received or has received certain therapies for diagnosing and / or treating a disease, condition, or disorder. In some embodiments, the patient is a patient who suffers from or is susceptible to HSV infection.
[0069] PEG-conjugated lipids: The term "PEG-conjugated lipids" refers to molecules that include both lipid and polyethylene glycol moieties.
[0070] Pharmaceutical composition: As used herein, the term "pharmaceutical composition" refers to an active agent formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, the active agent is present in a unit dose suitable for administration in a treatment regimen that, when administered to the relevant population, demonstrates a statistically significant probability of achieving the intended therapeutic effect. In some embodiments, the pharmaceutical composition may be specifically formulated as, for example, a sterile solution or suspension, for parenteral administration, such as by subcutaneous, intramuscular, or intravenous injection.
[0071] Effective dose of a drug: The term "effective dose of a drug" or "therapeutic effective dose" refers to the amount, alone or in combination with other doses, that achieves the desired response or desired effect. In the case of treating a specific disease, in some embodiments, the desired response involves inhibiting the progression of the disease. In some embodiments, this inhibition may include slowing the progression of the disease and / or interrupting or reversing the progression of the disease. In some embodiments, the desired response in the treatment of a disease may be or include delaying or preventing the onset of the disease or ailment. The effective dose of the pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) will depend on, for example, the disease or ailment to be treated, the severity of the disease or ailment, individual parameters of the patient (including, for example, age, physiological condition, body size, and weight), duration of treatment, type of concomitant therapy (if present), specific route of administration, etc. Therefore, the dosage of the pharmaceutical composition described herein (e.g., an immunogenic composition, such as a vaccine) may depend on a variety of such parameters. In cases where the response in a patient is insufficient at the initial dose, a higher dose (or an effective higher dose achieved through a different, more localized route of administration) may be used.
[0072] poly(A) sequence: As used herein, the term "poly(A) sequence" or "polyA tail" refers to a sequence of uninterrupted or discontinuous adenosine residues typically located at the 3' end of an RNA molecule. Poly(A) sequences are known to those skilled in the art and may follow the 3'-UTR in the RNA described herein. Uninterrupted poly(A) sequences are characterized by continuous adenosine residues. Uninterrupted poly(A) sequences are typical in nature. The RNAs disclosed herein may have a free 3'-end poly(A) sequence that is ligated to the RNA post-transcriptionally by a template-independent RNA polymerase, or a poly(A) sequence encoded by DNA and transcribed by a template-dependent RNA polymerase.
[0073] Polypeptide: As used herein, the term "polypeptide" refers to a polymer chain of amino acids. In some embodiments, the polypeptide has an amino acid sequence that occurs in nature. In some embodiments, the polypeptide has an amino acid sequence that does not occur in nature. In some embodiments, the polypeptide has an engineered amino acid sequence because it is designed and / or generated artificially through manipulation. In some embodiments, the polypeptide may contain natural amino acids, non-natural amino acids, or both, or consist of them. In some embodiments, the polypeptide may contain only natural amino acids, or only non-natural amino acids, or consist of them. In some embodiments, the polypeptide may contain D-amino acids, L-amino acids, or both. In some embodiments, the polypeptide may contain only D-amino acids. In some embodiments, the polypeptide may contain only L-amino acids. In some embodiments, the polypeptide may contain one or more dangling groups or other modifications, for example, modifications or attachments to one or more amino acid side chains at the N-terminus, C-terminus, or any combination thereof of the polypeptide. In some embodiments, such dangling groups or modifications include acetylation, amidation, esterification, methylation, polyethylene glycolation, etc., including combinations thereof. In some embodiments, the polypeptide may be cyclic, and / or may contain a cyclic moiety. In some embodiments, the polypeptide is not cyclic and / or does not contain any cyclic portion. In some embodiments, the polypeptide is linear. In some embodiments, the polypeptide may be or comprise a stapled polypeptide. In some embodiments, the term "polypeptide" may be appended to the name of a reference polypeptide, activity, or structure; in such cases, it is used herein to refer to a polypeptide that shares a relevant activity or structure and can therefore be considered a member of the same class or family of polypeptides. For each of these classes, this specification provides and / or those skilled in the art will recognize exemplary polypeptides within the class whose amino acid sequences and / or functions are known; in some embodiments, such exemplary polypeptides are reference polypeptides of a polypeptide class or family. In some embodiments, members of a polypeptide class or family exhibit significant sequence homology or identity with the reference polypeptide of the class; share common sequence motifs (e.g., characteristic sequence components) with all polypeptides in the class; and / or share common activities (in some embodiments, at comparable levels or within specified ranges). For example, in some embodiments, the member polypeptide shows at least about 30%-40%, and typically greater than about 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or greater, degree of overall sequence homology or identity with the reference polypeptide and / or includes at least one region exhibiting a very high sequence identity (e.g., a conserved region, which may be or contain characteristic sequence components in some embodiments) typically greater than 90% or even 95%, 96%, 97%, 98%, or 99%.This conserved region typically encompasses at least 3-4 and usually up to 20 or more amino acids; in some embodiments, the conserved region encompasses at least one extension having at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more consecutive amino acids. In some embodiments, the associated polypeptide may comprise or be composed of a fragment of the parent polypeptide.
[0074] Prevention: As used herein, the terms “prevent” or “prevention” when used in connection with the occurrence of a disease, condition, and / or disorder refer to reducing the risk of developing a disease, condition, and / or disorder and / or delaying the onset of one or more features or symptoms of a disease, condition, or disorder. Prevention is considered complete when the onset of a disease, condition, or disorder is delayed for a predetermined period of time.
[0075] Recombination: In the context of this disclosure, the term "recombination" means "prepared via genetic engineering". In some embodiments, in the context of this disclosure, the "recombinant" entity (such as a recombinant nucleic acid) is not naturally occurring.
[0076] Reference: As used herein, the term "reference" describes a standard or control relative to which comparison is made. For example, in some embodiments, the agent, animal, individual, population, sample, sequence, or value of interest is compared with a reference or control agent, animal, individual, population, sample, sequence, or value. In some embodiments, the reference or control is substantially tested and / or measured simultaneously with the test or assay of interest. In some embodiments, the reference or control is a historical reference or control optionally embodied in a tangible medium. Generally, as those skilled in the art will understand, a reference or control is determined or characterized under conditions or circumstances similar to those of the reference or control being evaluated. Those skilled in the art will understand when sufficient similarity exists to justify reliance on a particular possible reference or control and / or comparison with it.
[0077] Ribonucleic acid (RNA): As used herein, the term "RNA" or "polynucleotide" refers to a polymer of ribonucleotides. In some embodiments, the RNA is single-stranded. In some embodiments, the RNA is double-stranded. In some embodiments, the RNA comprises both single-stranded and double-stranded portions. In some embodiments, the RNA may comprise a backbone structure as defined above in the definition of "nucleic acid / polynucleotide". The RNA may be regulatory RNA (e.g., siRNA, microRNA, etc.) or messenger RNA (mRNA). In some embodiments, the RNA is mRNA. In some embodiments where the RNA is mRNA, the RNA typically includes a poly(A) region at its 3' end. In some embodiments where the RNA is mRNA, the RNA typically includes a cap structure recognized in the art at its 5' end, for example, for recognizing the mRNA and ligating it to a ribosome to initiate translation. In some embodiments, the RNA is synthetic RNA. Synthetic RNA includes RNA synthesized in vitro (e.g., by enzymatic synthesis and / or by chemical synthesis).
[0078] Ribonucleotides: As used herein, the term "ribonucleotide" encompasses both unmodified and modified ribonucleotides. For example, unmodified ribonucleotides include the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). Modified ribonucleotides may contain one or more modifications, including but not limited to, for example, (a) terminal modifications, such as 5' modifications (e.g., phosphorylation, dephosphorylation, conjugation, reverse linkage, etc.), 3' modifications (e.g., conjugation, reverse linkage, etc.), (b) base modifications, such as substitution with a modified base, a stable base, a destabilized base, or a base or conjugated base that pairs with an extended chaperone library base, (c) sugar modifications (e.g., at the 2' or 4' position) or sugar substitutions, and (d) internucleotide linkage modifications, including modifications or substitutions of phosphodiester linkages. The term "ribonucleotide" also encompasses ribonucleotide triphosphates, including both modified and unmodified ribonucleotide triphosphates.
[0079] Risk: As will be understood from the context, “risk” for a disease, condition, and / or disorder means the likelihood that a particular individual will develop said disease, condition, and / or disorder. In some embodiments, risk is expressed as a percentage. In some embodiments, risk is 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% up to 100%. In some embodiments, risk is expressed as risk relative to the risk associated with a reference sample or reference sample group. In some embodiments, the reference sample or reference sample group has a known risk of disease, condition, disorder, and / or event. In some embodiments, the reference sample or reference sample group is drawn from individuals equivalent to the particular individual. In some embodiments, relative risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or higher. In some implementations, risk may reflect one or more genetic attributes, such as those that predispose an individual to develop (or not develop) a particular disease, condition, and / or disorder. In some implementations, risk may reflect one or more epigenetic events or attributes and / or one or more lifestyle or environmental events or attributes.
[0080] RNA-lipid complex particles: As used herein, the term "RNA-lipid complex particle" refers to a complex comprising liposomes (especially cationic liposomes) and RNA molecules. Without being bound by any particular theory, the electrostatic interaction between positively charged liposomes and negatively charged RNA leads to the recombination and spontaneous formation of RNA-lipid complex particles. In some embodiments, the positively charged liposomes may comprise cationic lipids, such as DOTMA in some embodiments, and additional lipids, such as DOPE in some embodiments. In one embodiment, the RNA-lipid complex particle is a nanoparticle.
[0081] Selectivity or Specificity: When used herein with reference to an active agent, those skilled in the art will understand that the terms “selectivity” or “specificity” mean that the agent distinguishes potential target entities, states, or cells. For example, in some embodiments, an agent is said to “specifically” bind to a target if it preferentially binds to its target in the presence of one or more competing alternative targets. In many embodiments, specific interactions depend on the presence of specific structural features of the target entity (e.g., epitopes, clefts, binding sites). It should be understood that specificity need not be absolute. In some embodiments, specificity can be evaluated relative to the specificity of the target-binding portion against one or more other potential target entities (e.g., competing agents). In some embodiments, specificity is evaluated relative to the specificity of a reference specific binding portion. In some embodiments, specificity is evaluated relative to the specificity of a reference non-specific binding portion.
[0082] Stable: As used herein, the term "stable" in the context of this disclosure means that a pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) as a whole and / or its components meets or exceeds predetermined acceptance criteria. For example, in some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) does not exhibit unacceptable levels of microbial growth and has substantially no or no degradation of its active biomolecular components. In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) means that the integrity of the RNA molecules remains at least 90% or higher. In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) means that at least 90% or more (including, for example, at least 95%, at least 96%, at least 97% or more) of the RNA molecules remain encapsulated within lipid nanoparticles. In some embodiments, a stable pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) means a formulation that, when administered to a subject, still elicits the desired immunological response. In some embodiments, a pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) remains stable under certain conditions for a specified period of time.
[0083] Subject: As used herein, the term "subject" refers to an organism to which the composition described herein is to be administered, for example, for experimental, diagnostic, preventive, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, domestic pets, etc.) and humans. In some embodiments, the subject is a human subject. In some embodiments, the subject suffers from a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject is susceptible to a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject exhibits one or more symptoms or characteristics of a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject exhibits one or more nonspecific symptoms of a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject does not exhibit any symptoms or characteristics of a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject is a person having one or more characteristics characterizing susceptibility or risk to a disease, condition, or disorder (e.g., HSV infection). In some embodiments, the subject is a patient. In some implementations, the subject is an individual who has received and / or has received diagnostic and / or therapeutic treatments.
[0084] Suffering from: An individual who has been diagnosed with a disease, condition and / or disorder and / or exhibits one or more symptoms of a disease, condition and / or disorder.
[0085] Susceptibility: An individual susceptible to a disease, condition, and / or illness is an individual who has a higher risk of developing said disease, condition, and / or illness than the general population. In some embodiments, an individual susceptible to a disease, condition, and / or illness may not be diagnosed with said disease, condition, and / or illness. In some embodiments, an individual susceptible to a disease, condition, and / or illness may exhibit symptoms of the disease, condition, and / or illness. In some embodiments, an individual susceptible to a disease, condition, and / or illness may not exhibit symptoms of the disease, condition, and / or illness. In some embodiments, an individual susceptible to a disease, condition, and / or illness will develop the disease, condition, and / or illness. In some embodiments, an individual susceptible to a disease, condition, and / or illness will not develop the disease, condition, and / or illness.
[0086] Synthesis: As used herein, the term "synthesis" refers to an entity that is artificially created or manufactured through human intervention, or a synthetically produced entity, rather than a naturally occurring entity. For example, in some embodiments, synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule chemically synthesized, for example, by solid-phase synthesis in some embodiments. In some embodiments, the term "synthesis" refers to an entity manufactured outside of a biological cell. For example, in some embodiments, synthetic nucleic acid or polynucleotide refers to a nucleic acid molecule (e.g., RNA) produced by in vitro transcription using a template.
[0087] Therapy: The term "therapy" refers to the administration or delivery of an agent or intervention that has a therapeutic effect and / or causes a desired biological and / or pharmacological effect (e.g., one that is statistically likely to have when administered to a relevant population). In some embodiments, a therapeutic agent or therapy is any substance that can be used to reduce, improve, alleviate, suppress, prevent, or delay the onset of one or more symptoms or features of a disease, condition, and / or disorder, reduce its severity, and / or reduce its incidence. In some embodiments, a therapeutic agent or therapy is a medical intervention (e.g., surgery, radiation, phototherapy) that can be performed to reduce, alleviate, suppress, prevent, or delay the onset of one or more symptoms or features of a disease, condition, and / or disorder, reduce its severity, and / or reduce its incidence.
[0088] Triple-Untranslated Region (3'UTR): As used herein, the term "triple-untranslated region" or "3'UTR" refers to a sequence of RNA molecules that begins after a stop codon in the coding region of an open reading frame (OPG) sequence. In some embodiments, the 3'UTR begins, for example, immediately after a stop codon in the coding region of an OPG sequence, in its natural context. In other embodiments, the 3'UTR begins, for example, not immediately after a stop codon in the coding region of an OPG sequence, in its natural context.
[0089] Threshold level (e.g., acceptance criterion): As used herein, the term "threshold level" refers to a level used as a reference to obtain information about measurement results, such as those obtained in a determination, and / or to classify said results. For example, in some embodiments, a threshold level means a value measured in a determination that defines the boundary between two subsets of a population (e.g., batches that meet quality control criteria and batches that do not meet quality control criteria). Thus, values equal to or higher than the threshold level define one subset of the population, while values lower than the threshold level define another subset. The threshold level may be determined based on one or more control samples or the entire control sample population. The threshold level may be determined before, simultaneously with, or after the measurement of interest. In some embodiments, the threshold level may be a range of values.
[0090] Treatment: As used herein, the term "treatment" means any method used to partially or completely reduce, improve, alleviate, suppress, prevent, delay the onset, reduce the severity, and / or decrease the incidence of one or more symptoms or features of a disease, condition, and / or disorder. Treatment may be administered to a subject who does not exhibit signs of a disease, condition, and / or disorder. In some embodiments, such as for the purpose of reducing the risk of developing lesions associated with a disease, condition, and / or disorder, treatment may be administered to a subject who exhibits only early signs of a disease, condition, and / or disorder. In some embodiments, treatment may be administered to a subject at a later stage of a disease, condition, and / or disorder.
[0091] Vaccination: As used herein, the term "vaccination" refers to the administration of a composition intended to produce an immune response, for example, against a disease-related (e.g., pathogenic) agent. In some embodiments, vaccination may be administered before, during, and / or after exposure to a disease-related agent, and in some embodiments, shortly before, during, and / or after exposure to the agent. In some embodiments, vaccination comprises multiple administrations of a vaccine composition at appropriate intervals. In some embodiments, vaccination produces an immune response against an infectious agent.
[0092] Vaccine: As used herein, the term "vaccine" refers to a composition that induces an immune response when administered to a subject. In some embodiments, the induced immune response provides protective immunity.
[0093] Variant: As used herein in the context of molecules such as nucleic acids, proteins, or small molecules, the term "variant" refers to a molecule that exhibits significant structural identity with a reference molecule but differs structurally from it, for example, differing from the reference entity in the presence or absence or level of one or more chemical motifs. In some embodiments, the variant is also functionally different from its reference molecule. Generally, whether a particular entity is properly considered a "variant" of a reference entity is based on the degree of its structural identity with the reference molecule. As those skilled in the art will understand, any biological or chemical reference molecule has certain characteristic structural components. By definition, a variant is a unique molecule that shares one or more of these characteristic structural components but differs from the reference molecule in at least one respect. In some embodiments, a variant polypeptide or nucleic acid may differ from a reference polypeptide or nucleic acid due to one or more differences in the amino acid or nucleotide sequence and / or one or more differences in the chemical motifs (e.g., carbohydrates, lipids, phosphate groups) that are covalent components of a polypeptide or nucleic acid (e.g., linked to the polypeptide or nucleic acid backbone). In some embodiments, the variant peptide or nucleic acid exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99% overall sequence identity with the reference peptide or nucleic acid. In some embodiments, the variant peptide or nucleic acid does not share at least one characteristic sequence component with the reference peptide or nucleic acid. In some embodiments, the reference peptide or nucleic acid has one or more biological activities. In some embodiments, the variant peptide or nucleic acid shares one or more of the biological activities of the reference peptide or nucleic acid. In some embodiments, the variant peptide or nucleic acid lacks one or more of the biological activities of the reference peptide or nucleic acid. In some embodiments, the variant peptide or nucleic acid exhibits a reduced level of one or more biological activities compared to the reference peptide or nucleic acid. In some embodiments, a peptide or nucleic acid of interest is considered a “variant” of the reference peptide or nucleic acid if it has the same amino acid or nucleotide sequence as the reference, except for a small number of sequence changes at specific positions. Typically, compared to the reference, less than about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, or about 2% of residues in the variant are substituted, inserted, or deleted. In some embodiments, the variant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue compared to the reference. Typically, the variant polypeptide or nucleic acid contains a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of substituted, inserted, or deleted functional residues (i.e., residues involved in a specific biological activity) relative to the reference. In some embodiments, the variant polypeptide or nucleic acid contains at most about 5, about 4, about 3, about 2, or about 1 addition or deletion compared to the reference, and in some embodiments, no addition or deletion is included.In some embodiments, the variant polypeptide or nucleic acid, compared to the reference, contains fewer than about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, about 6, and typically fewer than about 5, about 4, about 3, or about 2 additions or deletions. In some embodiments, the reference polypeptide or nucleic acid is a polypeptide or nucleic acid that is found in nature.
[0094] Vector: As used herein, a vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop to which an additional DNA segment can be linked. Another type of vector is a viral vector, in which an additional DNA segment can be linked to a viral genome. Some vectors are capable of autonomous replication in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication and free mammalian vectors). Other vectors (e.g., non-free mammalian vectors) can integrate into the host cell's genome after introduction into the host cell and thereby replicate along with the host genome. Additionally, some vectors are capable of directing the expression of genes operatively linked to them. Such vectors are referred to herein as "expression vectors." In some embodiments, known techniques can be used, for example, to generate or manipulate recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipid transfection). Enzymatic reactions and purification techniques can be performed according to the manufacturer's instructions or as commonly performed in the art or as described herein. The foregoing techniques and procedures can generally be performed according to conventional methods well known in the art and described in various general and more specific references cited and discussed throughout this specification. See, for example, Sambrook et al., Molecular Cloning: A Laboratory Manual (4th edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2012)), which is incorporated herein by reference for any purpose.
[0095] All references and similar materials cited in this application, including but not limited to patents, patent applications, articles, books, papers, and web pages, regardless of their format, are expressly incorporated herein by reference in their entirety. If one or more incorporated references and similar materials differ from or contradict this application, including but not limited to defined terminology, terminology usage, or described techniques, this application shall prevail. The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter in any way.
[0096] As discussed above, this disclosure provides pharmaceutical compositions (e.g., immunogenic compositions, e.g., vaccines) and related technologies (e.g., methods) for delivering specific herpes simplex virus (HSV) antigen constructs (e.g., HSV-1 antigen constructs, HSV-2 antigen constructs, or combinations thereof) to subjects (e.g., patients). Specifically, this disclosure provides HSV (e.g., HSV-1, HSV-2, or both) vaccine compositions and related technologies (e.g., methods).
[0097] This disclosure provides, for example, polynucleotides encoding one or more HSV antigens. In some embodiments, this polynucleotide may be part of an RNA construct. In some embodiments, the polynucleotide or RNA construct as described herein may be part of a composition (e.g., a pharmaceutical composition, such as an immunogenic composition, such as a vaccine).
[0098] In some implementations, the techniques provided herein are for HSV. The following describes HSV and certain exemplary features.
[0099] I. Herpes simplex virus (HSV)
[0100] Herpes simplex virus (HSV) belongs to the α subfamily of the human herpesvirus family and includes two types: HSV-1 and HSV-2. The structures of HSV-1 and HSV-2 mainly consist (from inside to outside) a DNA core, capsid, inner membrane, and envelope. Each of HSV-1 and HSV-2 has a double-stranded DNA genome of approximately 153 kb, encoding at least 80 genes. The DNA core is enclosed by an icosahedral capsid composed of 162 capsid particles, 150 hexagonal particles, and 12 pentagonal particles, made up of six different viral proteins. The DNA is surrounded by at least 20 different viral inner membrane proteins with structural and regulatory functions. Some of these are involved in capsid transport to the nucleus and other organelles, viral DNA entry into the nucleus, activation of early gene transcription, inhibition of cellular protein biosynthesis, and mRNA degradation. The viral envelope surrounding the inner membrane has at least 12 different glycoproteins (BNs) on its surface. Glycoproteins can exist as heterodimers (H / L and E / I), with most existing as monomers.
[0101] HSV-1 and HSV-2 can cause a range of mild, moderate, and severe lesions, including oral and genital ulcers, viral blindness, viral encephalitis, and neonatal disseminated infection. HSV-1 and HSV-2 typically spread through different routes and affect different parts of the body, but the signs and symptoms they cause may overlap. Infections caused by HSV-1 represent one of the more widespread infections in the oral and facial region and commonly cause cold sores, herpetic stomatitis, and keratitis. HSV-2 commonly causes genital herpes and is primarily spread through direct sexual contact with lesions. Most genital HSV infections are caused by HSV-2; however, an increasing number of genital HSV infections are attributed to HSV-1. Genital HSV-1 infections are generally less severe and less common than genital HSV-2 infections.
[0102] HSV infection is transmitted through contact with herpes lesions, mucous membrane surfaces, genital secretions, or oral secretions. The average incubation period after exposure is usually 4 days, but can be between 2 and 12 days. HSV particles infect and elongate neurons that weaken surrounding tissues, and establish a latent state in these cells, specifically in the trigeminal ganglion and dorsal root ganglia in the sacral region, from which the particles can occasionally be reactivated. Furthermore, similar to other herpesviruses, HSV infection is lifelong and generally asymptomatic. It should be understood, without being bound by any particular theory, that HSV particles can detach from the infected individual and are unrelated to the occurrence of clinical manifestations.
[0103] HSV infection is rarely fatal, but it is characterized by blisters that may rupture and become painful. Clinical presentation is largely similar depending on the type of virus. However, as discussed above, HSV-1 infection is often less severe than HSV-2 infection, and patients infected with HSV-2 generally experience more outbreaks.
[0104] A. Lifecycle
[0105] As described in this article, in order to initiate infection, HSV (HSV-1 or HSV-2) particles use viral glycoproteins to bind to the cell surface and fuse their envelope with the plasma membrane (see example). Figure 2 (Step 1). After membrane fusion, the viral capsid and inner membrane proteins are internalized into the cytoplasm (see, for example...). Figure 2 In step 2), once inside the cytoplasm, the viral capsid accumulates in the nucleus and releases viral DNA into the nucleus (see, for example...). Figure 2Step 3). HSV replicates by producing three rounds of transcription for each of the following: α (immediate early) proteins that primarily regulate viral replication; β (early) proteins that synthesize and package DNA; and γ (late) proteins, most of which are virosomal proteins (see Whitley et al., Lancet 2001 May 12 357(9267); Taylor et al., Front Biosci. 2002 March 1; 7:d752-64; and...). et al., FrontMicrobiol. 2018, 11 October; 9:2406; each of the references cited is incorporated herein by reference in its entirety (see, for example, Figure 2 (Steps 4-6).
[0106] The HSV capsid assembles within the nucleus of infected cells (see, for example) Figure 2 (Step 7). Once the viral capsid has completed assembly in the cell nucleus, these particles continue their maturation process in the same compartment by acquiring inner membrane proteins. After leaving the nucleus, additional inner membrane proteins are added to the capsid. Simultaneously, glycoproteins are translated and glycosylated in the endoplasmic reticulum and processed in the Golgi network (TGN) before being directed to multiple cells (see, for example...). Figure 2 (Step 8). They are then exported to plasma membrane glycoproteins in the early endosomes (see, for example, step 8). Figure 2 (Step 9). The viral capsid in the cytoplasm will then fuse with an endosome containing the HSV glycoprotein to form an infectious virion within the vesicle (see, for example...). Figure 2 (Steps 10-12).
[0107] HSV (HSV-1 or HSV-2) can establish latent infection. After primary infection, HSV replicates efficiently in epithelial cells or enters sensory neuron axons and migrates to the neuronal nucleus. There, the viral DNA remains circular, extrachromosomal, and does not express any cleavage genes; however, latent-associated transcripts are expressed and then spliced to produce mRNA. This pervasive transcriptional silencing may allow the virus to remain hidden in cells by evading immune surveillance. In some aspects, this document provides techniques (e.g., compositions and methods) for amplifying, inducing, promoting, enhancing, and / or improving immune responses against HSV (e.g., HSV-1 and / or HSV-2) or its components (e.g., proteins or fragments thereof). In some embodiments, the techniques provided herein are designed to amplify, induce, promote, enhance, and / or improve immune memory against HSV or its components (e.g., proteins or fragments thereof). In some embodiments, the techniques described herein are designed to act as a booster of a primary vaccine, such as a vaccine against one or more epitopes of HSV (e.g., HSV-1 and / or HSV-2).
[0108] The virus remains in this state throughout the host's lifetime, or until a suitable signal reactivates the virus and produces new offspring. The offspring viruses then travel via neuronal axons to the site of initial infection in order to restart the lysis and replication cycle.
[0109] B.HSV genome
[0110] Both the HSV-1 and HSV-2 genomes are approximately 150 kb long double-stranded DNA, differing slightly between subtypes and strains. This genome encodes more than 80 genes and has a high GC content: 67% for HSV-1 and 69% for HSV-2 (see Whitley et al., Lancet May 12, 2001; 357(9267); Taylor et al., Front Biosci. March 1, 2002; 7:d752-64; and Jiao et al., Microbiol Resour Announc. September 2019; 8(39):e00993-19, which are incorporated herein by reference in full).
[0111] The genome is organized into unique long regions (UL) and unique short regions (US). ULs are typically bounded by terminal long (TRL) and internal long (IRL) repeats. USs are typically bounded by terminal short (IRS) and internal short (TRS) repeats. Genes found in unique regions exist as a single copy in the genome, but genes encoded in repeat regions exist as two copies in the genome (see Whitley et al., Lancet 12 May 2001; 357(9267); Taylor et al., Front Biosci. 1 March 2002; 7:d752-64; and Jiao et al., Microbiol Resour Announc. 1 Sep 2019; 8(39):e00993-19, which are incorporated herein by reference in full).
[0112] HSV contains three origins of replication within the genome, named according to their location in the long (oriL) or short (oriS) regions of the genome. OriL exists as a single copy in the UL region, but oriS is located in the repeat region of the short region; therefore, it exists as two copies in the genome. Both oriL and oriS are palindromic sequences consisting of an AT-rich central region flanked by inverted repeat sequences containing multiple binding sites with different affinities for the viral origin-binding protein (UL9). Either oriL or the oriS sequence is sufficient for viral replication (see Whitley et al., Lancet May 12, 2001; 357(9267); Taylor et al., Front Biosci. March 1, 2002; 7:d752-64; and Jiao et al., Microbiol Resour Announc. Sep 2019; 8(39):e00993-19, which are incorporated herein by reference in full).
[0113] The viral genome also contains signals for the appropriate processing of the newly synthesized genome for packaging into a pre-formed capsid. Progeny genomes are generated in long polymers that require cleavage into unit-length monomers. For this purpose, the viral genome contains two DNA sequence components, pac1 and pac2, to ensure proper cleavage and packaging of unit-length progeny genomes. These components are located within the inverted repeat (DR) sequences within the terminal inverted repeat regions of the viral genome (see Whitley et al., Lancet, May 12, 2001; 357(9267); Taylor et al., Front Biosci., March 1, 2002; 7:d752-64; and Jiao et al., Microbiol Resour Announc., Sep 2019; 8(39):e00993-19, which are incorporated herein by reference in their entirety).
[0114] C.HSV vaccine
[0115] Several HSV vaccines that primarily target HSV-2 and primarily focus on generating neutralizing antibodies (nAbs) targeting viral envelope glycoprotein D (as related to immune protection) have been developed and evaluated in human clinical trials, as shown in Table 1 below. Although these vaccines have demonstrated protective effects against HSV in preclinical studies and, in some cases, in Phase 2 studies, none have shown efficacy sufficient for further development or commercialization.
[0116] This disclosure provides the insight that many prior strategies for developing pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) for treating and / or protecting against HSV infection have focused primarily or even almost entirely on developing neutralizing antibodies targeting surface glycoproteins. This disclosure identifies problems with such strategies, including, for example, their inability to recognize the value or even importance of ensuring that the induced immune response includes significant T-cell activity (CD4 T-cell activity in some embodiments, CD8 T-cell activity in some embodiments, and both in some embodiments). In some embodiments, pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) comprising or delivering CD4 and CD8 epitopes of one or more HSV antigens (e.g., HSV-1 antigen, HSV-2 antigen, or combinations thereof) in addition to one or more B-cell antigens and / or epitopes can be used to treat and / or protect against HSV infection.
[0117] Table 1: Some HSV vaccines in clinical development
[0118]
[0119]
[0120] Antiviral treatment for D.HSV
[0121] This disclosure provides the understanding that the constructs and / or compositions described herein can be administered as part of a regimen with other therapeutic agents. This disclosure also recognizes that subjects receiving the constructs and / or compositions described herein may have previously received other therapeutic agents.
[0122] In some implementations, for example, the subject may be receiving or have previously received an antiviral agent against HSV. In some implementations, the antiviral agent may be administered to treat HSV-1 or HSV-2 infection or relapse. In some implementations, the antiviral agent is or includes acyclovir, valacyclovir, famciclovir, or combinations thereof. Table 2 below provides some information about the selected antiviral agent.
[0123] Table 2: Antiviral drugs for treating HSV
[0124]
[0125] II. Constructs
[0126] A. Antigen
[0127] This disclosure provides for situations where certain HSV-2 antigens (e.g., gC, gD, and / or gE antigens) and their antigenic fragments can be used to prevent or treat HSV infection (e.g., HSV-2 infection, HSV-1 infection, or both). This disclosure also provides for situations where such HSV-2 antigens, with their antigenic portions, can be delivered, for example, in HSV-2 antigen constructs and / or HSV compositions (e.g., immunogenic compositions, such as vaccines) as further disclosed herein.
[0128] The polynucleotides provided herein comprise the antigenic portion of an HSV-2 antigen (e.g., HSV-2 glycoprotein). In some embodiments, the polynucleotides described herein encode the HSV-2 gC antigen or an antigenic fragment thereof. In some embodiments, the polynucleotides described herein encode the HSV-2 gD antigen or an antigenic fragment thereof. In some embodiments, the polynucleotides described herein encode the HSV-2 gE antigen or an antigenic fragment thereof.
[0129] In some embodiments, the polynucleotides described herein encode the antigenic portion of the HSV-2gC antigen. In some embodiments, the polynucleotides described herein encode the antigenic portion of the HSV-2gD antigen. In some embodiments, the polynucleotides described herein encode the antigenic portion of the HSV-2gE antigen.
[0130] The following is a brief description of HSV-2gC, gD, and gE.
[0131] Glycoprotein C (gC)
[0132] Mature HSV glycoprotein C (gC) is a 56 kDa protein that plays a crucial role in the initial adsorption of HSV to its host targets. Glycoprotein C is a type I membrane glycoprotein and is considered a major adsorption protein and primary viral ligand for binding heparan sulfate proteoglycans (HSPGs) to the surface of target host cells. This occurs through the interaction of gC with HSPG-rich regions found on F-actin-rich membrane protrusions (called filopodia).
[0133] Furthermore, it was demonstrated that glycoprotein C regulates cell entry and infection by increasing the pH threshold for acid-induced gB conformational changes. Low pH induces reversible conformational changes in gB domains I and V, functional regions containing hydrophobic rings important in the fusion process. By positively modulating low-pH-induced gB conformational changes, glycoprotein C enhances the ability of HSV to invade cell types requiring low-pH invasion mechanisms, such as epithelial cells.
[0134] In addition to its role in adsorption, glycoprotein C has also been shown to play an important role in immune escape. Glycoprotein C is one of the major targets of lymphocyte cytotoxicity in certain cell types and can bind complement component C3b, thereby inhibiting complement activation. Furthermore, neutralizing epitopes present on other HSV glycoproteins (such as gB) are protected by the presence of gC, thus preventing the immune response from blocking fusion.
[0135] Glycoprotein D (gD)
[0136] Glycoprotein D is a 46kDa type I membrane glycoprotein. Its N-terminal extracellular domain contains 316 amino acids. Glycoprotein D is not conserved in herpesviridae viruses, but it is crucial for HSV entry into cells. Glycoprotein D promotes invasion by interacting with a variety of receptors on the cell surface, including herpesvirus entry mediators (HVEM), cohesin-1 or cohesin-2, and heparin sulfate with specific modifications. These host receptors do not act as co-receptors because the interaction between each glycoprotein and its host receptor occurs independently. Binding of gD to one of these cellular receptors causes a conformational change, altering gD's autoinhibitory off state to an active state, which transmits one of the two signals believed to be required for gH / gL activation. HVEM was the first identified gD receptor, belonging to the tumor necrosis factor (TNF) receptor family, and is commonly found on T cells, B cells, dendritic cells, natural killer cells, macrophages, and non-immune cell types such as neurons and epithelial cells. Within the N-terminus of glycoprotein D, there is a 37-residue hairpin structure that forms the entire binding site for the host receptor HVEM. Specifically, residues 1-32 of the N-terminal domain of glycoprotein D bind to the cysteine-rich domain 1 (CDR1) of HVEM. When not in contact with HVEM, this N-terminal extension adopts an extended and flexible conformation.
[0137] All clinical strains of HSV-1 and HSV-2, regardless of their origin, use cohesin-1 to enter host cells; however, several mutant strains of HSV-1 and HSV-2 utilize cohesin-2. Furthermore, HSV-1, but not HSV-2, utilizes heparin sulfate. The interaction between glycoprotein D and net-1 has been shown to be crucial in some cell types, such as neurons, even when other glycoprotein receptors are present on the cell surface.
[0138] Glycoprotein E (gE)
[0139] Glycoprotein E has a size of approximately 53 kDa. Glycoprotein E interacts with glycoprotein I to form a heterodimeric complex, playing a crucial role in intercellular transmission and virus-induced fusion. The gE / gI ratio (unlike gB, gD, and gH / gL) is not essential for fusion and cell entry, but it is important for intercellular transmission. Disruption of the gE / gI complex formation significantly affects HSV proliferation, as the viral lysis cycle is heavily dependent on intercellular transmission. The mechanism by which gE / gI promotes intercellular transmission is unclear, but its function is believed to depend on several inner membrane proteins. The cooperation of the inner membrane proteins UL11, UL16, and UL21 is believed to be crucial for the processing, transport, and biological activity of gE.
[0140] Table 3: HSV antigens, secretion signals, and versions
[0141]
[0142]
[0143] Example amino acid sequences of certain HSV gC, gD, and gE peptides are provided in Table 4 below, example deoxyribonucleic acid sequences encoding certain HSV gC, gD, and gE peptides are provided in Table 5, and example ribonucleic acid sequences encoding certain HSV gC, gD, and gE peptides are provided in Table 6 below.
[0144] Table 4: Amino acid sequences of example HSV glycoproteins
[0145]
[0146]
[0147] Table 5: Examples of HSV glycoprotein deoxyribonucleic acid sequences
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176]
[0177] Table 6: Example RNA sequences of HSV glycoproteins
[0178]
[0179]
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208] This document provides polynucleotides encoding polypeptides. In some embodiments, the polypeptide comprises one or more HSV glycoprotein C (gC) antigens or antigenic fragments thereof. In some embodiments, the polypeptide comprises an antigenic moiety of HSV gC. In some embodiments, the antigenic moiety of HSV gC comprises an amino acid sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the amino acid sequence of SEQ ID NO:1 or a portion thereof. In some embodiments, the antigenic moiety of HSV gC has an amino acid sequence having identity with the amino acid sequence of SEQ ID NO:1. In some embodiments, the antigenic portion of HSV gC comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:260.
[0209] In some embodiments, the polynucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the ribonucleic acid sequence of any one of SEQ ID NO:16-19, 147, and 274-281.
[0210] In some embodiments, the polypeptide comprises one or more HSV glycoprotein D (gD) antigens or antigenic fragments thereof. In some embodiments, the polypeptide comprises an antigenic moiety of HSV gD. In some embodiments, the antigenic moiety of HSV gD comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:2 or a portion thereof. In some embodiments, the antigenic moiety of HSV gD has an amino acid sequence identical to the amino acid sequence of SEQ ID NO:2.
[0211] In some embodiments, the polynucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the ribonucleic acid sequence of any one of SEQ ID NO:20-23, 143, and 286.
[0212] In some embodiments, the polypeptide comprises one or more HSV glycoprotein E (gE) antigens or antigenic fragments thereof. In some embodiments, the polypeptide comprises an antigenic moiety of HSV gE. In some embodiments, the antigenic moiety of HSV gE comprises an amino acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the amino acid sequence of SEQ ID NO:3 or a portion thereof. In some embodiments, the antigenic moiety of HSV gE has an amino acid sequence identical to the amino acid sequence of SEQ ID NO:3.
[0213] In some embodiments, the polynucleotide comprises a ribonucleic acid sequence that is at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the ribonucleic acid sequence of any one of SEQ ID NO:24-27 and 282-285.
[0214] B. Secretion signals
[0215] This document provides polypeptides comprising (i) an HSV antigen or an antigenic fragment thereof and (ii) a secretion signal. This document also provides polynucleotides encoding polypeptides comprising (i) an HSV antigen or an antigenic fragment thereof and (ii) a secretion signal. In some embodiments, the secretion signal is functional in mammalian cells. In some embodiments, the secretion signal comprises or is composed of a human secretion signal. In some embodiments, the secretion signal comprises or is composed of an IL2 secretion signal.
[0216] In some embodiments, the secretion signal comprises or consists of a viral secretion signal. In some embodiments, the viral secretion signal comprises or consists of an HSV secretion signal (e.g., an HSV-1 or HSV-2 secretion signal). In some embodiments, the secretion signal comprises or consists of an HSV-1 secretion signal. In some embodiments, the secretion signal comprises or consists of an HSV-2 secretion signal.
[0217] In some embodiments, the HSV secretion signal comprises or is composed of an HSV glycoprotein D (gD) secretion signal (e.g., an HSV-1 or HSV-2 gD secretion signal). In some embodiments, the HSV secretion signal comprises or is composed of an HSV-1 gD secretion signal. In some embodiments, the HSV-1 gD secretion signal comprises one or more additional amino acids. In some embodiments, the HSV-1 gD secretion signal contains KY at the C-terminus of the signal sequence. In some embodiments, the HSV secretion signal comprises or is composed of an HSV-2 gD secretion signal. In some embodiments, the HSV-2 gD secretion signal contains one or more additional amino acids. In some embodiments, the HSV-2 gD secretion signal contains KYA or KYALA at the C-terminus of the signal sequence.
[0218] In some embodiments, the HSV secretion signal comprises or is composed of an HSV glycoprotein C (gC) secretion signal (e.g., an HSV-1 or HSV-2 gC secretion signal). In some embodiments, the HSV secretion signal comprises or is composed of an HSV-2 gC secretion signal.
[0219] In some embodiments, the HSV secretion signal comprises or is composed of an HSV glycoprotein E (gE) secretion signal (e.g., an HSV-1 or HSV-2 gE secretion signal). In some embodiments, the HSV secretion signal comprises or is composed of an HSV-1 gE secretion signal. In some embodiments, the HSV secretion signal comprises or is composed of an HSV-2 gE secretion signal. In some embodiments, the HSV-2 gE secretion signal contains one or more additional amino acids. In some embodiments, the HSV-2 gE secretion signal contains an RTS. In some embodiments, the HSV-2 secretion signal contains A20V, A21V, or A22V substitutions.
[0220] In some embodiments, the HSV secretion signal comprises or is composed of an HSV glycoprotein B (gB) secretion signal (e.g., an HSV-1 or HSV-2 gB secretion signal). In some embodiments, the HSV secretion signal comprises or is composed of an HSV-1 gB secretion signal. In some embodiments, the HSV-1 gB secretion signal comprises one or more additional amino acids. In some embodiments, the HSV-1 gB secretion signal contains an AP at the C-terminus of the signal sequence. In some embodiments, the HSV secretion signal comprises or is composed of an HSV-2 gB secretion signal.
[0221] In some embodiments, the HSV secretion signal comprises or consists of an HSV glycoprotein I (gI) secretion signal (e.g., an HSV-1 or HSV-2 gI secretion signal). In some embodiments, the HSV secretion signal comprises or consists of an HSV-1 gI secretion signal. In some embodiments, the HSV-1 gI secretion signal comprises one or more additional amino acids. In some embodiments, the HSV secretion signal comprises or consists of an HSV-2 gI secretion signal. In some embodiments, the HSV-2 gI secretion signal contains an additional leucine residue at the C-terminus of the signal sequence.
[0222] In some embodiments, the secretion signal comprises or is composed of the EboZ spike glycoprotein. In some embodiments, the EboZ secretion signal comprises one or more additional amino acids. In some embodiments, the EboZ secretion signal contains an IP at the C-terminus of the signal sequence.
[0223] In some implementations, the secretion signal is characterized by a length of approximately 15 to 30 amino acids.
[0224] In some embodiments, the secretion signal is located at the N-terminus of the polynucleotide. In some embodiments, the secretion signal preferably allows the transport of the associated polynucleotide to a defined cellular compartment (preferably the cell surface, endoplasmic reticulum (ER), or endosome-lysosome compartment).
[0225] In some embodiments, the polynucleotide containing the HSV antigen does not contain a secretion signal. In some embodiments, the polynucleotide containing the HSV antigen further contains a codon initialization start site.
[0226] In some embodiments, the secretion signal is the signal listed in Table 7, or a secretion signal that differs from it by 1, 2, 3, 4, or 5 amino acids. In some embodiments, the secretion signal is a signal selected from those included in Table 7 below and / or a signal encoded by sequences in Tables 8 and / or 9 below.
[0227] Table 7: Example Secretory Signals
[0228]
[0229] Table 8: Examples of deoxyribonucleic acid sequences encoding secretion signals
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236] Table 9: Example RNA sequences encoding secretion signals
[0237]
[0238]
[0239]
[0240]
[0241] C. Certain instances of antigen secretion signal combinations
[0242] In some embodiments, the polynucleotide encodes a polypeptide, wherein the polypeptide comprises an HSV-2 glycoprotein antigen or an antigenic fragment thereof and a secretion signal.
[0243] Examples of polynucleotide constructs encoding gC, gD, or gE antigens as described herein are provided in Table 10 below.
[0244] Table 10: Example Polynucleotide Constructs
[0245]
[0246]
[0247]
[0248]
[0249] In some embodiments, the polypeptide, as described herein (or encoded by a polynucleotide as described herein), comprises an HSV-2gC antigen and a secretion signal. Examples of combinations of HSV-2gC antigen and secretion signal, along with their corresponding amino acid sequences, are provided in Table 11 below.
[0250] In some embodiments, the polypeptide, as described herein (or encoded by a polynucleotide as described herein), comprises an HSV-2gD antigen and a secretion signal. Examples of combinations of HSV-2gD antigen and secretion signal, along with their corresponding amino acid sequences, are provided in Table 11 below.
[0251] In some embodiments, the polypeptide, as described herein (or encoded by a polynucleotide as described herein), comprises an HSV-2gE antigen and a secretion signal. Example combinations of HSV-2gE antigen and secretion signal, along with their corresponding amino acid sequences, are provided in Table 11 below. Exemplary nucleotide sequences are provided in Tables 12 and 13.
[0252] Table 11: Example secretory signals and HSV-2 glycoprotein amino acid sequences
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259] Table 12: Examples of deoxyribonucleic acid sequences encoding secretion signals and HSV-2 glycoproteins
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
[0270]
[0271]
[0272]
[0273]
[0274]
[0275]
[0276]
[0277]
[0278]
[0279]
[0280]
[0281]
[0282]
[0283]
[0284]
[0285]
[0286]
[0287]
[0288]
[0289]
[0290]
[0291]
[0292]
[0293]
[0294]
[0295]
[0296]
[0297]
[0298]
[0299]
[0300]
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307]
[0308]
[0309]
[0310]
[0311]
[0312]
[0313]
[0314]
[0315]
[0316]
[0317]
[0318]
[0319]
[0320]
[0321]
[0322]
[0323] Table 13: Example RNA sequences encoding secretion signals and HSV-2 glycoprotein
[0324]
[0325]
[0326]
[0327]
[0328]
[0329]
[0330]
[0331]
[0332]
[0333]
[0334]
[0335]
[0336]
[0337]
[0338]
[0339]
[0340]
[0341]
[0342]
[0343]
[0344]
[0345]
[0346]
[0347]
[0348]
[0349]
[0350]
[0351]
[0352]
[0353]
[0354]
[0355]
[0356]
[0357]
[0358]
[0359]
[0360]
[0361]
[0362]
[0363]
[0364]
[0365]
[0366]
[0367]
[0368]
[0369]
[0370]
[0371]
[0372]
[0373]
[0374]
[0375]
[0376]
[0377]
[0378]
[0379]
[0380]
[0381]
[0382]
[0383]
[0384]
[0385]
[0386]
[0387]
[0388]
[0389]
[0390]
[0391]
[0392]
[0393]
[0394] D. Transmembrane region
[0395] In some embodiments, the polypeptide described herein includes a transmembrane region. In some embodiments, the polynucleotide described herein encodes a polypeptide including a transmembrane region. In some embodiments, the transmembrane region is located at the N-terminus of the polypeptide. In some embodiments, the transmembrane region is located at the C-terminus of the polypeptide. In some embodiments, the transmembrane region is not located at the N-terminus or C-terminus of the polypeptide. In some embodiments, the polypeptide does not include a transmembrane region.
[0396] The transmembrane region is known in the art, and any of them can be used in the polypeptide described herein. In some embodiments, the transmembrane region comprises or is a hemagglutinin (HA) of influenza virus, Env of HIV-1, Equine Infectious Anemia Virus (EIAV), Murine Leukemia Virus (MLV), Mouse Mammary Tumor Virus, G protein of vesicular stomatitis virus (VSV), a transmembrane region of rabies virus, or a seven-transmembrane receptor. In some embodiments, the polypeptide comprises an HSV transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-1 or HSV-2 transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2gD transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2gC transmembrane region. In some embodiments, the HSV transmembrane region is an HSV-2gE transmembrane region.
[0397] III. Polynucleotides
[0398] A. Examples of polynucleotide characteristics
[0399] This disclosure also provides RNA constructs comprising the polynucleotides described herein. In some embodiments, the RNA constructs provided herein comprise polynucleotides encoding the HSV-2gC antigen or an antigenic fragment thereof. In some embodiments, the RNA constructs provided herein comprise polynucleotides encoding the HSV-2gD antigen or an antigenic fragment thereof. In some embodiments, the RNA constructs provided herein comprise polynucleotides encoding the HSV-2gE antigen or an antigenic fragment thereof.
[0400] In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gC antigen. In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gD antigen. In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gE antigen.
[0401] In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gC antigen and a secretion signal. In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gD antigen and a secretion signal. In some embodiments, the RNA constructs provided herein contain polynucleotides encoding the HSV-2gE antigen and a secretion signal.
[0402] In some embodiments, the polynucleotides described herein may comprise nucleotide sequences encoding a 5' UTR and / or a 3' UTR. In some embodiments, the polynucleotides described herein may comprise nucleotide sequences encoding a polyA tail. In some embodiments, the polynucleotides described herein may comprise a 5' cap, which may be incorporated during transcription or conjugated to the polynucleotide post-transcriptionally.
[0403] 1.5' cap
[0404] RNA is structurally characterized by a cap structure at the 5' end. Native eukaryotic RNA contains a 7-methylguanosine cap linked to the RNA via a 5'-to-5'-triphosphate bridge, resulting in the cap 0 structure (m7GpppN). In most eukaryotic RNAs and some viral RNAs, further modifications can occur at the 2'-hydroxyl (2'-OH) sites of the first and subsequent nucleotides (e.g., the 2'-hydroxyl can be methylated to form 2'-O-Me), resulting in "cap 1" and "cap 2" 5' ends, respectively. Diamond et al., (2014) Cytokine & Growth Factor Reviews, 25:543–550, which are incorporated herein by reference in full, reported that cap 0 RNA cannot be translated as efficiently as cap 1 RNA, with the 2'-O-Me at the penultimate position of the 5' end of the RNA playing a decisive role. The absence of 2'-O-met has been shown to trigger innate immunity and activate the IFN response. Daffis et al. (2010) Nature, 468:452-456; and Züst et al. (2011) Nature Immunology, 12:137-143, each of which is incorporated herein by reference in its entirety.
[0405] RNA capping has been well studied and described, for example, in Decroly E et al. (2012) Nature Reviews 10:51-65; and Ramanathan A et al. (2016) Nucleic Acids Res; 44(16):7511–7526, the entire contents of each of which are hereby incorporated by reference. For example, in some embodiments, the 5'-cap structure applicable in the context of this invention may be cap 0 (methylation of the first nucleobase, e.g., m7GpppN), cap 1 (additional methylation of the ribose of a neighboring nucleotide of m7GpppN), cap 2 (additional methylation of the ribose of the second nucleotide downstream of m7GpppN), cap 3 (additional methylation of the ribose of the third nucleotide downstream of m7GpppN), cap 4 (additional methylation of the ribose of the fourth nucleotide downstream of m7GpppN), ARCA (“anti-reverse cap analog”), modified ARCA (e.g., phosphate thioester modified ARCA), inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-denitro-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
[0406] As used herein, the term "5'-cap" refers to a structure found at the 5' end of an RNA (e.g., mRNA) molecule and generally comprises a guanosine nucleotide linked to RNA (e.g., mRNA) via a 5' to 5'-triphosphate bond (also known as Gppp or G(5')ppp(5')). In some embodiments, the guanosine nucleotide contained in the 5' cap may be modified, for example by methylation at one or more sites (e.g., at the 7 position) on the base (guanine), and / or by methylation at one or more sites on the ribose. In some embodiments, the guanosine nucleotide contained in the 5' cap comprises 3'O methylation at the ribose (3'OMeG). In some embodiments, the guanosine nucleotide contained in the 5' cap comprises methylation at the 7 position of guanine (m7G). In some embodiments, the guanosine nucleotide contained in the 5' cap comprises methylation at the 7 position of guanine and 3'O methylation at the ribose (m7(3'OMeG)). It should be understood that the symbols used in the previous paragraph (e.g., "(m2") are different from those used in the previous paragraph. 7,3’-O ")G" or "m7(3'OMeG)" applies to other structures described herein.
[0407] In some embodiments, providing RNA with the 5'-cap disclosed herein can be achieved via in vitro transcription, wherein the 5'-cap is co-transcribed into the RNA strand, or it can be ligated to the RNA post-transcriptionally using a capping enzyme. In some embodiments, co-transcriptional capping with the disclosed cap improves RNA capping efficiency compared to co-transcriptional capping with a suitable reference. In some embodiments, improved capping efficiency can increase RNA translation efficiency and / or translation rate, and / or increase expression of the encoded polypeptide. In some embodiments, alterations to the polynucleotide produce a non-hydrolyzable cap structure, which, for example, prevents uncapping and prolongs the RNA half-life.
[0408] In some implementations, the 5' cap used is a cap 0, cap 1, or cap 2 structure. See, for example, Ramanathan A et al. Figure 1 and Decroly E et al. Figure 1 Each of the aforementioned references is incorporated herein by reference in its entirety. See, for example, Ramanathan A et al. Figure 1 and Decroly E et al. Figure 1 Each of the aforementioned documents is incorporated herein by reference in its entirety. In some embodiments, the RNA described herein comprises a cap 1 structure. In some embodiments, the RNA described herein comprises a cap 2.
[0409] In some embodiments, the RNA described herein comprises a cap-0 structure. In some embodiments, the cap-0 structure comprises a guanosine nucleotide methylated at the 7-position of guanine ((m 7 In some implementations, this cap structure is linked to RNA via a 5'-to-5'-triphosphate bond, and is also referred to herein as (m). 7 In some embodiments, the cap 0 structure comprises a guanosine nucleoside methylated at the 2' position of the guanosine ribose. In some embodiments, the cap 0 structure comprises a guanosine nucleoside methylated at the 3' position of the guanosine ribose. In some embodiments, the guanosine nucleoside contained in the 5' cap comprises methylation at the 7' position of guanine and at the 2' position of the ribose (m2). 7,2’-O In some embodiments, the guanosine nucleotide contained in the 5' cap comprises methylation at the 7' position of guanine and at the 2' position of ribose (m2 7,3’-O )G).
[0410] In some embodiments, the cap 1 structure contains a guanosine nucleotide methylated at the 7-position of guanine ((m 7 )G) and optionally methylated guanosine nucleotides at the 2' or 3' position of the ribose, and the first nucleotide in RNA methylated at 2'O ((m 2’-OIn some embodiments, the cap 1 structure contains a guanosine nucleotide methylated at the 7-position of guanine ((m 7 )G) and guanosine nucleotides methylated at the 3' position of the ribose, and the first nucleotide (m) methylated at the 2' O position in RNA. 2’-O In some embodiments, the cap 1 structure is linked to the RNA via a 5' to 5'-triphosphate bond, and is also referred to herein as, for example, ((m 7 )Gppp( 2'-O (N1) or (m2) 7,3’-O )Gppp( 2'-O N1), where N1 is as defined and described herein. In some embodiments, the cap 1 structure contains a second nucleotide N2, which is located at the 2 position and is selected from A, G, C, or U, for example (m 7 )Gppp( 2'-O )N1pN2 or (m2 7,3’-O )Gppp( 2'-O )N1pN2, where each of N1 and N2 is as defined and described herein.
[0411] In some embodiments, the cap 2 structure contains a guanosine nucleotide methylated at the 7-position of guanine ((m 7 )G) and optionally methylated guanosine nucleotides at the 2' or 3' position of the ribose, and the first and second nucleotides of RNA methylated at 2'O (m 2’-O )N1p(m 2’-O In some embodiments, the cap 2 structure contains a guanosine nucleotide methylated at the 7-position of guanine ((m 7 The cap 2 structure is methylated at the 3' position of the ribose and the first and second nucleotides methylated at the 2' O position in the RNA. In some embodiments, the cap 2 structure is linked to the RNA via a 5'-to-5'-triphosphate bond, and is also referred to herein as, for example, ((m 7 )Gppp( 2'-O )N1p( 2'-O (N2) or (m2) 7,3’-O )Gppp( 2'-O )N1p( 2'-O )N2), where each of N1 and N2 is as defined and described herein.
[0412] In some embodiments, the 5' cap is a dinucleotide cap structure. In some embodiments, the 5' cap is a dinucleotide cap structure containing N1, where N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap G*N1, where N1 is as defined above and herein, and G* contains the structure of formula (I):
[0413]
[0414] or its salt,
[0415] Among them, each R 2 and R 3 It is -OH or -OCH3; and X is O or S.
[0416] In some implementation schemes, R 2 For -OH. In some implementations, R 2 For -OCH3. In some implementations, R 3 For -OH. In some implementations, R 3 For -OCH3. In some implementations, R 2 It is -OH and R 3 For -OH. In some implementations, R 2 It is -OH and R 3 For -CH3. In some implementations, R 2 For -CH3 and R 3 For -OH. In some implementations, R 2 For -CH3 and R 3 It is -CH3.
[0417] In some implementations, X is 0. In some implementations, X is S.
[0418] In some implementations, the 5' cap is a dinucleotide cap O structure (e.g., (m 7 )GpppN1、(m2 7,2’-O )GpppN1、(m2 7,3’-O )GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), where N1 is as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap O structure (e.g., (m 7 )GpppN1、(m2 7,2’-O )GpppN1、(m2 7,3’-O )GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), where N1 is G. In some embodiments, the 5' cap is a dinucleotide cap O structure (e.g., (m 7 )GpppN1、(m2 7,2’-O )GpppN1、(m2 7,3’-O)GpppN1、(m 7 )GppSpN1、(m2 7,2’-O )GppSpN1 or (m2 7,3’-O )GppSpN1), where N1 is A, U, or C. In some embodiments, the 5' cap is a dinucleotide cap 1 structure (e.g., (m 7 )Gppp(m 2’-O N1, (m2) 7,2’-O )Gppp(m 2’-O N1, (m2) 7,3’-O )Gppp(m 2’-O )N1、(m 7 )GppSp(m 2’-O N1, (m2) 7,2’-O )GppSp(m 2’-O )N1 or (m2) 7,3’-O )GppSp(m 2’-O )N1), where N1 is as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m 7 )GpppG(“Ecap0”), (m 7 )Gppp(m 2’-O )G(“Ecap1”), (m2 7,3’-O )GpppG(“ARCA” or “D1”) and (m2 7,2’-O )GppSpG(“β-S-ARCA”). In some implementations, the 5' cap is (m 7 )GpppG(“Ecap0”), which has the following structure:
[0419]
[0420] Or its salt.
[0421] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O )G(“Ecap1”), which has the following structure:
[0422]
[0423] Or its salt.
[0424] In some implementations, the 5' cap is (m2) 7,3’-O )GpppG(“ARCA” or “D1”), which has the following structure:
[0425]
[0426] Or its salt.
[0427] In some implementations, the 5' cap is (m2) 7,2’-O )GppSpG(“β-S-ARCA”), which has the following structure:
[0428]
[0429] Or its salt.
[0430] In some embodiments, the 5' cap is a trinucleotide cap structure. In some embodiments, the 5' cap is a trinucleotide cap structure comprising N1pN2, wherein N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a dinucleotide cap G*N1pN2, wherein N1 and N2 are as defined above and herein, and G* comprises the structure of formula (I):
[0431]
[0432] or its salt, wherein R 2 R 3 X is as defined and described in this article.
[0433] In some implementations, the 5' cap is a trinucleotide cap 0 structure (e.g., (m 7 )GpppN1pN2、(m2 7,2’-O )GpppN1pN2 or (m2 7,3’-O )GpppN1pN2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap 1 structure (e.g., (m 7 )Gppp(m 2’-O )N1pN2、(m2 7,2’-O )Gppp(m 2’-O )N1pN2、(m2 7,3’-O )Gppp(m 2’-O (N1pN2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is a trinucleotide cap 2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O N2, (m2) 7,2’-O )Gppp(m 2’-O )N1p(m 2’-O N2, (m2) 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O (m1)N2), where N1 and N2 are as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m2) 7,3’-O )Gppp(m 2’-O)ApG("CleanCap AG","CC413"), (m2 7,3’-O )Gppp(m 2’-O )GpG(“CleanCap GG”), (m 7 )Gppp(m 2’-O ApG,(m 7 )Gppp(m 2’-O )GpG、(m2 7,3’-O )Gppp(m2 6,2’-O ApG and (m 7 )Gppp(m 2’-O )ApU.
[0434] In some implementations, the 5' cap is (m2) 7,3’-O )Gppp(m 2’-O ApG(“CleanCapAG”,“CC413”) has the following structure:
[0435]
[0436] Or its salt.
[0437] In some implementations, the 5' cap is (m2) 7,3’-O )Gppp(m 2’-O GpG(“CleanCapGG”) has the following structure:
[0438]
[0439] Or its salt.
[0440] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O ApG has the following structure:
[0441]
[0442] Or its salt.
[0443] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O GpG has the following structure:
[0444]
[0445] Or its salt.
[0446] In some implementations, the 5' cap is (m2) 7,3’-O )Gppp(m2 6,2’-O ApG has the following structure:
[0447]
[0448] Or its salt.
[0449] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O ApU has the following structure:
[0450]
[0451] Or its salt.
[0452] In some embodiments, the 5' cap is a tetranucleotide cap structure. In some embodiments, the 5' cap is a tetranucleotide cap structure comprising N1pN2pN3, wherein N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide cap G*N1pN2pN3, wherein N1, N2, and N3 are as defined above and herein, and G* comprises the structure of formula (I):
[0453]
[0454] or its salt, wherein R 2 R 3 X is as defined and described in this article.
[0455] In some implementations, the 5' cap is a tetranucleotide cap O structure (e.g., (m 7 )GpppN1pN2pN3、(m2 7,2’-O )GpppN1pN2pN3 or (m2 7,3’-O )GpppN1N2pN3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide cap 1 structure (e.g., (m 7 )Gppp(m 2’-O )N1pN2pN3、(m2 7,2’-O )Gppp(m 2’-O )N1pN2pN3、(m2 7,3’-O )Gppp(m 2’-O (N1pN2N3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is a tetranucleotide cap 2 structure (e.g., (m 7 )Gppp(m 2’-O )N1p(m 2’-O )N2pN3、(m2 7,2’-O )Gppp(m 2 ’-O )N1p(m 2’-O)N2pN3、(m2 7,3’-O )Gppp(m 2’-O )N1p(m 2’-O (N2pN3), where N1, N2, and N3 are as defined and described herein. In some embodiments, the 5' cap is selected from the group consisting of: (m2 7,3’-O )Gppp(m 2’-O Ap(m) 2’-O )GpG、(m2 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O GpC, (m 7 )Gppp(m 2’-O Ap(m) 2’-O UpA and (m 7 )Gppp(m 2’-O Ap(m) 2’-O )GpG.
[0456] In some implementations, the 5' cap is (m2) 7,3’-O )Gppp(m 2’-O Ap(m) 2’-O GpG has the following structure:
[0457]
[0458] Or its salt.
[0459] In some implementations, the 5' cap is (m2) 7,3’-O )Gppp(m 2’-O )Gp(m 2’-O GpC has the following structure:
[0460]
[0461] Or its salt.
[0462] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O Ap(m) 2’-O UpA has the following structure:
[0463]
[0464] Or its salt.
[0465] In some implementations, the 5' cap is (m 7 )Gppp(m 2’-O Ap(m) 2’-O GpG has the following structure:
[0466]
[0467] Or its salt.
[0468] 2. Proximal sequence of the cap
[0469] In some embodiments, the 5' UTR used according to this disclosure includes, for example, a cap proximal sequence as disclosed herein. In some embodiments, the cap proximal sequence includes a sequence adjacent to the 5' cap. In some embodiments, the cap proximal sequence includes nucleotides at positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.
[0470] In some embodiments, the cap structure comprises one or more polynucleotides of a proximal cap sequence. In some embodiments, the cap structure comprises m 7 The guanosine cap and the nucleotide +1 (N1) of the RNA polynucleotide. In some embodiments, the cap structure contains m 7 The guanosine cap and the nucleotide +2 (N2) of the RNA polynucleotide. In some embodiments, the cap structure contains m 7 The guanosine cap and the nucleotides +1 and +2 (N1 and N2) of the RNA polynucleotide. In some embodiments, the cap structure contains m 7 The guanosine cap and the nucleotides of the RNA polynucleotide are +1, +2, and +3 (N1, N2, and N3).
[0471] Those skilled in the art will understand from this disclosure that, in some embodiments, one or more residues of the proximal cap sequence (e.g., one or more of residues +1, +2, +3, +4, and / or +5) may be included in the RNA by means of inclusion within the cap body (e.g., a cap 1 or cap 2 structure, etc.); or, in some embodiments, at least some residues of the proximal cap sequence may be enzymatically added (e.g., by a polymerase such as T7 polymerase). For example, m2 is utilized therein 7,3’-O Gppp(m1 2’-O In some exemplary implementations of the ApG cap, +1 (i.e., N1) and +2 (i.e., N2) are the cap's (m1) 2’-O A and G residues, and +3, +4 and +5 are added by polymerase (e.g., T7 polymerase).
[0472] In some embodiments, the 5' cap is a dinucleotide cap structure, wherein the proximal sequence of the cap contains N1 of the 5' cap, where N1 is any nucleotide, such as A, C, G, or U. In some embodiments, the 5' cap is a trinucleotide cap structure (e.g., the trinucleotide cap structure described above and herein), wherein the proximal sequence of the cap contains N1 and N2 of the 5' cap, where N1 and N2 are independently any nucleotide, such as A, C, G, or U. In some embodiments, the 5' cap is a tetranucleotide cap structure (e.g., the trinucleotide cap structure described above and herein), wherein the proximal sequence of the cap contains N1, N2, and N3 of the 5' cap, where N1, N2, and N3 are any nucleotide, such as A, C, G, or U.
[0473] In some embodiments, for example, the 5' cap is a dinucleotide cap structure, and the proximal sequence of the cap includes N1, and N2, N3, N4, and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, the 5' cap is a trinucleotide cap structure, and the proximal sequence of the cap includes N1 and N2, and N3, N4, and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide. In some embodiments, for example, the 5' cap is a tetranucleotide cap structure, and the proximal sequence of the cap includes N1, N2, and N3, and N4 and N5 of the 5' cap, wherein N1 to N5 correspond to positions +1, +2, +3, +4, and / or +5 of the RNA polynucleotide.
[0474] In some embodiments, N1 is A. In some embodiments, N1 is C. In some embodiments, N1 is G. In some embodiments, N1 is U. In some embodiments, N2 is A. In some embodiments, N2 is C. In some embodiments, N2 is G. In some embodiments, N2 is U. In some embodiments, N3 is A. In some embodiments, N3 is C. In some embodiments, N3 is G. In some embodiments, N3 is U. In some embodiments, N4 is A. In some embodiments, N4 is C. In some embodiments, N4 is G. In some embodiments, N4 is U. In some embodiments, N5 is A. In some embodiments, N5 is C. In some embodiments, N5 is G. In some embodiments, N5 is U. It should be understood that the various embodiments described above and herein (e.g., N1 to N5) may be used alone or in combination and / or may be combined with other embodiments (e.g., 5' caps) of the variables described above and herein.
[0475] In some embodiments, the proximal cap sequence comprises A1 and G2 of the cap 1 structure and A3A4U5 (SEQ ID NO:150) at corresponding positions +3, +4 and +5 of the polynucleotide.
[0476] 3.5'UTR
[0477] In some embodiments, the nucleic acid (e.g., DNA, RNA) used according to this disclosure comprises a 5'-UTR. In some embodiments, the 5'-UTR may comprise multiple different sequence components; in some embodiments, this multiple may be or comprise multiple copies of one or more specific sequence components (e.g., such as those derived from a specific source or otherwise referred to as functional or characteristic sequence components). In some embodiments, the 5'UTR comprises multiple different sequence components.
[0478] The term “untranslated region” or “UTR” is generally used in the art to refer to a region in a DNA molecule that is transcribed but not translated into an amino acid sequence, or a corresponding region in an RNA polynucleotide (such as an RNA molecule). Untranslated regions (UTRs) can be present at the 5' (upstream) (5'-UTR) and / or the 3' (downstream) (3'-UTR) of an open reading frame. As used herein, the term “5'-UTR” refers to a polynucleotide sequence between the 5' end (e.g., transcription start site) of a polynucleotide and the start codon of the coding region of the polynucleotide. In some embodiments, “5'UTR” refers, for example, in its natural context, a polynucleotide sequence that begins at the 5' end (e.g., transcription start site) of a polynucleotide and ends one nucleotide (nt) before the start codon (typically AUG) of the coding region of the polynucleotide. In some embodiments, the 5'UTR contains a Kozak sequence. The 5'-UTR is located downstream of the 5'-cap (if present), for example, directly adjacent to the 5'-cap. In some embodiments, the 5' UTR disclosed herein includes, for example, a cap proximal sequence as defined and described herein. In some embodiments, the cap proximal sequence includes a sequence adjacent to the 5' cap.
[0479] Examples of 5'UTRs include human alpha globin (hAg) 5'UTR or a fragment thereof, TEV 5'UTR or a fragment thereof, HSP70 5'UTR or a fragment thereof, or c-Jun 5'UTR or a fragment thereof.
[0480] In some implementations, the RNA disclosed herein comprises hAg 5'UTR or a fragment thereof.
[0481] In some embodiments, the RNA disclosed herein comprises a 5' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the 5' UTR having the sequence AGAA TAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO:151). In some embodiments, the RNA disclosed herein comprises a 5' UTR having the sequence AGAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC (SEQ ID NO:151).
[0482] In some embodiments, the RNA disclosed herein comprises a 5' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with a 5' UTR having the sequence AACU AGUAUUCUUCUGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO:152). In some embodiments, the RNA disclosed herein comprises a 5' UTR having the sequence AACUAGUAUUCUUCUGGUCCCCACAGACUCA GAGAGAACCCGCCACC (SEQ ID NO:152) (hAg-Koza k / 5' UTR).
[0483] 4. polyA tail
[0484] In some embodiments, the polynucleotides (e.g., DNA, RNA) disclosed herein comprise, for example, a polyadenosine (polyA) sequence as described herein. In some embodiments, the polyA sequence is located downstream of the 3'-UTR, for example, adjacent to the 3'-UTR.
[0485] As used herein, the term "poly(A) sequence" or "polyA tail" refers to a sequence of uninterrupted or discontinuous adenosine residues typically located at the 3' end of an RNA polynucleotide. Poly(A) sequences are known to those skilled in the art and may follow the 3'-UTR in the RNA described herein. Uninterrupted poly(A) sequences are characterized by continuous adenosine residues. Uninterrupted poly(A) sequences are typical in nature. In some embodiments, the polynucleotides disclosed herein comprise uninterrupted poly(A) sequences. In some embodiments, the polynucleotides disclosed herein comprise discontinuous poly(A) sequences. In some embodiments, the RNA disclosed herein may have a free 3'-terminus poly(A) sequence that is ligated to the RNA post-transcriptionally by a template-independent RNA polymerase, or a poly(A) sequence encoded by DNA and transcribed by a template-dependent RNA polymerase.
[0486] It has been demonstrated that the poly(A) sequence of approximately 120 A nucleotides has a beneficial effect on RNA levels in transfected eukaryotic cells as well as on protein levels translated from an open reading frame located upstream (5') of the poly(A) sequence (Holtkamp et al., 2006, Blood, Vol. 108, pp. 4009-4017, which are incorporated herein by reference).
[0487] In some embodiments, the poly(A) sequence according to this disclosure is not limited to a specific length; in some embodiments, the poly(A) sequence is of any length. In some embodiments, the poly(A) sequence comprises at least 20, at least 30, at least 40, at least 80, or at least 100 and at most 500, at most 400, at most 300, at most 200, or at most 150 A nucleotides, and specifically about 120 A nucleotides, or substantially composed of said number of A nucleotides. In this document, “substantially composed of” means that the majority of the nucleotides in the poly(A) sequence, typically at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% by number, are A nucleotides, but the remaining nucleotides are permitted to be nucleotides other than A nucleotides, such as U nucleotides (uridine monophosphate), G nucleotides (guanosine monophosphate), or C nucleotides (cytidine monophosphate). In this article, "composed of" means all nucleotides in the poly(A) sequence, i.e., 100% of the nucleotides in the poly(A) sequence are A nucleotides. The term "A nucleotide" or "A" refers to adenosine monophosphate.
[0488] In some implementations, a poly(A) sequence is ligated during RNA transcription, such as during the preparation of RNA transcribed in vitro, based on a DNA template containing repeating dT nucleotides (deoxythymidines) in a strand complementary to the coding strand. The DNA sequence encoding the poly(A) sequence (coding strand) is called a poly(A) box.
[0489] In some embodiments, the poly(A) box present in the DNA coding strand is essentially composed of dA nucleotides, but interrupted by random sequences of four nucleotides (dA, dC, dG, and dT). The length of this random sequence can be 5 to 50, 10 to 30, or 10 to 20 nucleotides. This box is disclosed in WO 2016 / 005324 A1, which is incorporated herein by reference. Any poly(A) box disclosed in WO 2016 / 005324 A1, which is incorporated herein by reference in its entirety, may be used according to this disclosure. Covering poly(A) boxes that are essentially composed of dA nucleotides, but interrupted by random sequences of equal distribution of the four nucleotides (dA, dC, dG, and dT) and having a length of, for example, 5 to 50 nucleotides, exhibit constant amplification of plasmid DNA in *E. coli* at the DNA level, and remain associated with beneficial properties at the RNA level that support RNA stability and translation efficiency. In some embodiments, the poly(A) sequence contained in the RNA polynucleotide described herein consists primarily of A nucleotides, but is interrupted by random sequences of four nucleotides (A, C, G, U). The length of this random sequence can be 5 to 50, 10 to 30, or 10 to 20 nucleotides.
[0490] In some implementations, no nucleotides other than A are located on the 3' flanking side of the poly(A) sequence, meaning that the poly(A) sequence is not masked at its 3' end by nucleotides other than A or followed by nucleotides other than A.
[0491] In some embodiments, the poly(A) sequence may comprise at least 20, at least 30, at least 40, at least 80, or at least 100 and up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist substantially of at least 20, at least 30, at least 40, at least 80, or at least 100 to up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence may consist of at least 20, at least 30, at least 40, at least 80, or at least 100 to up to 500, up to 400, up to 300, up to 200, or up to 150 nucleotides. In some embodiments, the poly(A) sequence comprises at least 100 nucleotides. In some embodiments, the poly(A) sequence comprises about 150 nucleotides. In some implementations, the poly(A) sequence contains approximately 120 nucleotides.
[0492] In some embodiments, the polyA tail comprises a specific number of adenosine residues, such as about 50 or more, about 60 or more, about 70 or more, about 80 or more, about 90 or more, about 100 or more, about 120, about 150, or about 200. In some embodiments, the polyA tail of the tandem construct may comprise 200 or fewer A residues. In some embodiments, the polyA tail of the tandem construct may comprise about 200 A residues. In some embodiments, the polyA tail of the tandem construct may comprise 180 or fewer A residues. In some embodiments, the polyA tail of the tandem construct may comprise about 180 A residues. In some embodiments, the polyA tail may comprise 150 or fewer residues.
[0493] In some embodiments, the RNA comprises a poly(A) sequence containing the nucleotide sequence AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:153), or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG CATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:153). In some embodiments, the poly(A) tail comprises a plurality of A residues interrupted by a linker. In some embodiments, the linker comprises the nucleotide sequence GCATATGAC (SEQ ID NO:154).
[0494] In some embodiments, the RNA comprises a poly(A) sequence containing the nucleotide sequence AA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:155), or a nucleotide sequence having at least 99%, 98%, 97%, 96%, 95%, 90%, 85%, or 80% identity with the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAG CAUAUGACUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:155). In some embodiments, the poly(A) tail comprises a plurality of A residues interrupted by a linker. In some embodiments, the linker comprises the nucleotide sequence GCAUAUGAC (SEQ ID NO:156).
[0495] 5.3'UTR
[0496] In some embodiments, the RNA used according to this disclosure comprises a 3'-UTR. As used herein, the terms "triple-placed untranslated region," "3'UTR," or simply "3'UTR" refer to a sequence of RNA molecules that begins after a stop codon in the coding region of an open reading frame sequence. In some embodiments, the 3'UTR begins, for example, immediately after a stop codon in the coding region of an open reading frame sequence, in its natural context. In other embodiments, the 3'UTR begins, for example, not immediately after a stop codon in the coding region of an open reading frame sequence, in its natural context. The term "3'-UTR" preferably does not include a poly(A) sequence. Thus, the 3'-UTR is upstream of the poly(A) sequence (if present), for example, directly adjacent to the poly(A) sequence.
[0497] In some embodiments, the RNA disclosed herein comprises a 3' UTR containing an F component and / or an I component. In some embodiments, the 3' UTR or its proximal sequence contains a restriction site. In some embodiments, the restriction site is a BamHI site. In some embodiments, the restriction site is an XhoI site.
[0498] In some embodiments, the RNA construct includes the F component. In some embodiments, the F component sequence is the 3'-UTR of an N-terminal cleavage enhancer (AES).
[0499] In some embodiments, the RNA disclosed herein comprises a 3' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the 3' UTR having the sequence CTGG TACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC (SEQ ID NO:157). In some embodiments, the RNA disclosed herein comprises a 3' UTR having the sequence CTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACC (SEQ ID NO:157).
[0500] In some embodiments, the RNA disclosed herein comprises a 3' UTR having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the 3' UTR having the sequence CUGG UACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCUCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO:158). In some embodiments, the RNA disclosed herein comprises a 3' UTR having the sequence CUGGUACUGCAUGCACGCAAUGCUAGCUGCCCCUUUCCCGUCCUGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAUGCUCCCACCUCCACCUGCCCCACUCACCACCUCUGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAUGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGUGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUUGGUCAAUUUCGUGCCAGCCACACC (SEQ ID NO:158).
[0501] In some implementations, 3'UTR is the FI component as described in WO2017 / 060314, which is incorporated herein by reference in its entirety.
[0502] B. RNA format
[0503] At least three different formats have been developed for RNA compositions (e.g., pharmaceutical compositions): RNA containing unmodified uridine (uRNA), nucleoside-modified RNA (modRNA), and self-amplifying RNA (saRNA). Each of these platforms exhibits unique characteristics. Generally, in all three formats, the RNA is capped, contains an open reading frame (ORF) flanked by untranslated regions (UTRs), and has a polyA tail at the 3' end. The ORFs of uRNA and modRNA vectors encode antibody agents or fragments thereof. saRNA has multiple ORFs.
[0504] In some embodiments, the RNA described herein may have modified nucleosides. In some embodiments, the RNA comprises a modified nucleoside replacing at least one (e.g., each) uridine.
[0505] As used herein, the term "uracil" describes one of the nucleobases that can appear in nucleic acids that contain RNA. The structure of uracil is:
[0506]
[0507] As used herein, the term "uridine" describes one of the nucleosides that can be found in RNA. The structure of uridine is:
[0508]
[0509] UTP (uridine 5'-triphosphate) has the following structure:
[0510]
[0511] Pseudo-UTP (pseudouridine 5'-triphosphate) has the following structure:
[0512]
[0513] "Pseudouridine" is an example of a modified nucleoside that is an isomer of uridine, wherein uracil is linked to a pentose ring via a carbon-carbon bond that replaces the nitrogen-carbon glycosidic bond.
[0514] Another exemplary modified nucleoside is N1-methyl-pseuuridine (m1Ψ), which has the following structure:
[0515]
[0516] N1-Methyl-pseudo-UTP has the following structure:
[0517]
[0518] Another exemplary modified nucleoside is 5-methyluridine (m5U), which has the following structure:
[0519]
[0520] In some embodiments, one or more uridines in the RNA described herein are replaced by modified nucleosides. In some embodiments, the modified nucleosides are modified uridines.
[0521] In some embodiments, the RNA comprises a nucleoside modified in place of at least one uridine. In some embodiments, the RNA comprises a nucleoside modified in place of each uridine.
[0522] In some embodiments, the modified nucleoside is independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the modified nucleoside comprises pseudouridine (ψ). In some embodiments, the modified nucleoside comprises N1-methyl-pseudouridine (m1ψ). In some embodiments, the modified nucleoside comprises 5-methyl-uridine (m5U). In some embodiments, the RNA may comprise more than one type of modified nucleoside, and the modified nucleoside is independently selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the modified nucleoside comprises pseudouridine (ψ) and N1-methyl-pseudouridine (m1ψ). In some embodiments, the modified nucleoside comprises pseudouridine (ψ) and 5-methyl-uridine (m5U). In some embodiments, the modified nucleoside comprises N1-methyl-pseudouridine (m1ψ) and 5-methyl-uridine (m5U). In some embodiments, the modified nucleosides include pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U).
[0523] In some embodiments, the nucleoside replacing one or more (e.g., all) of the uridine modifications in the RNA may be any one or more of the following: 3-methyluridine (m3U), 5-methoxyuridine (mo5U), 5-aza-uridine, 6-aza-uridine, 2-thio-5-aza-uridine, 2-thio-uridine (s2U), 4-thio-uridine (s4U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxyuridine (ho5U), 5-aminoallyl-uridine, 5-halo-uridine (e.g., 5-iodo-uridine or 5-bromo-uridine), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo5U), 5-carboxymethyl-uridine (c m5U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uridine (chm5U), 5-carboxyhydroxymethyl-uridine methyl ester (mchm5U), 5-methoxycarbonylmethyl-uridine (mcm5U), 5-methoxycarbonylmethyl-2-thio-uridine (mcm5s2U), 5-aminomethyl-2-thio-uridine (nm5s2U), 5-methylaminomethyl-uridine (mnm5U), 1-ethyl-pseudouridine, 5-methylaminomethyl-2-thio-uridine (mnm5s2U), 5-methylaminomethyl-2-seleno-uridine (mnm5se2U), 5-carbamoylmethyl-uridine (ncm5U), 5-carboxymethylaminomethyl-uridine (cm nm5U), 5-carboxymethylaminomethyl-2-thio-uridine (cmnm5s2U), 5-propynyl-uridine, 1-propynyl-pseudouridine, 5-tauronic acid methyl-uridine (τm5U), 1-tauronic acid methyl-pseudouridine, 5-tauronic acid methyl-2-thio-uridine (τm5s2U), 1-tauronic acid methyl-4-thio-pseudouridine, 5-methyl-2-thio-uridine (m5s2U), 1-methyl-4-thio-uridine (m1s4ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m3ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deazo-pseudouridine, 2-thio-1-methyl-1-deazo-pseudouridine, dihydrouridine ( D), dihydro-dihydrouridine, 5,6-dihydrouridine, 5-methyl-dihydrouridine (m5D), 2-thio-dihydrouridine, 2-thio-dihydro-dihydrouridine, 2-methoxy-uridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uridine (acp3U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp3ψ), 5-(isopentenylaminomethyl)uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio-uridine (inm5s2U), α-thio-uridine, 2'-O-methyl-uridine (Um), 5,2'-O-dimethyluridine (m5Um), 2'-O-methyl-pseudouridine (ψm), 2-thio-2'-O-methyluridine (s2Um), 5-methoxycarbonylmethyl-2'-O-methyluridine (mcm5Um), 5-carbamoylmethyl-2'-O-methyluridine (ncm5Um), 5-carboxymethylaminomethyl-2'-O-methyluridine (cmnm5Um), 3 2'-O-dimethyluridine (m3Um), 5-(isopentenylaminomethyl)-2'-O-methyluridine (inm5Um), 1-thiouridine, deoxythymidine, 2'-F-arasu-uridine, 2'-F-uridine, 2'-OH-arasu-uridine, 5-(2-carbonmethoxyvinyl)uridine, 5-[3-(1-E-propenylamino)uridine or any other modified uridine known in the art.
[0524] In some embodiments, the RNA comprises other modified nucleosides or comprises further modified nucleosides, such as modified cytidine. For example, in some embodiments, 5-methylcytidine partially or completely, preferably completely, replaces cytidine in the RNA. In some embodiments, the RNA comprises 5-methylcytidine and one or more selected from pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), and 5-methyl-uridine (m5U). In some embodiments, the RNA comprises 5-methylcytidine and N1-methyl-pseudouridine (m1ψ). In some embodiments, the RNA comprises 5-methylcytidine replacing each cytidine and N1-methyl-pseudouridine (m1ψ) replacing each uridine.
[0525] In some embodiments of this disclosure, RNA is “replicon RNA” or simply “replicon,” specifically “self-replicating RNA” or “self-amplifying RNA.” In a preferred embodiment, the replicon or self-replicating RNA is derived from a single-stranded (ss) RNA virus (specifically a positive-stranded ss RNA virus, such as alphavirus) or contains components derived from said virus. Alphavirus is a typical example of a positive-stranded RNA virus. Alphavirus replicates in the cytoplasm of infected cells (for a review of the alphavirus life cycle, see José et al., Future Microbiol., 2009, Vol. 4, pp. 837-856, which is incorporated herein by reference in its entirety). The total genome length of many alphaviruses is typically in the range of 11,000 to 12,000 nucleotides, and the genomic RNA typically has a 5' cap and a 3' poly(A) tail. The alphavirus genome encodes non-structural proteins (involved in transcription, modification, and replication of viral RNA, as well as protein modification) and structural proteins (forming viral particles). There are typically two open reading frames (ORFs) in the genome. Four non-structural proteins (nsP1-nsP4) are typically encoded by a first ORF originating near the 5' end of the genome, while alphavirus structural proteins are encoded by a second ORF located downstream of the first ORF and extending near the 3' end of the genome. Typically, the first ORF is larger than the second ORF, with a ratio of approximately 2:1. In alphavirus-infected cells, only the nucleic acid sequences encoding non-structural proteins are translated from the genomic RNA, while the genetic information encoding structural proteins is translated from subgenomic transcripts, which are RNA molecules similar to eukaryotic messenger RNA (mRNA; Gould et al., 2010, Antiviral Res., Vol. 87, pp. 111-124, which are incorporated herein by reference in their entirety). Post-infection, in the early stages of the viral life cycle, the (+) strand of genomic RNA is used directly, like messenger RNA, to translate the open reading frame encoding the non-structural multiprotein (nsP1234).
[0526] Alphavirus-derived vectors have been proposed for delivering exogenous genetic information to target cells or organisms. In a simplified approach, a first ORF encodes an alphavirus-derived RNA-dependent RNA polymerase (replicaase), which mediates the self-amplification of RNA during translation. A second ORF, encoding an alphavirus structural protein, is replaced by an open reading frame encoding the HSV-2 construct described herein. Alphavirus-based trans-replication systems rely on alphavirus nucleotide sequence components on two separate nucleic acid molecules: one molecule encodes a viral replicaase, and the other is capable of trans-replication by said replicaase (hence the name trans-replication system). Trans-replication requires the simultaneous presence of both nucleic acid molecules in a given host cell. Nucleic acid molecules capable of trans-replication by the replicaase must contain certain alphavirus sequence components to allow recognition by the alphavirus replicaase and the synthesis of RNA.
[0527] Unmodified uridine platforms may be characterized by, for example, intrinsic adjuvant activity and good tolerability and safety. Modified uridine (e.g., pseudouridine) platforms may be characterized by reduced adjuvant activity, weakened activation of innate immune sensory receptors, and therefore good tolerability and safety. Self-amplifying platforms may be characterized by, for example, prolonged protein expression duration, good tolerability and safety, and a higher likelihood of effectiveness with extremely low vaccine doses.
[0528] This disclosure provides specific RNA constructs optimized for improvements such as manufacturability, encapsulation, expression levels (and / or timing). Certain components are discussed below, and some preferred embodiments are illustrated herein.
[0529] C. Codon optimization and GC enrichment
[0530] As used herein, the term "codon optimization" refers to altering codons in the coding region of a nucleic acid molecule (e.g., a polynucleotide) to reflect typical codon usage in a host organism (e.g., a subject receiving a nucleic acid molecule (e.g., a polynucleotide)) without preferably altering the amino acid sequence encoded by the nucleic acid molecule. In the context of this disclosure, in some embodiments, codon optimization is performed on the coding region to achieve optimal expression in a subject treated with the RNA molecule described herein. In some embodiments, codon optimization may be performed such that the insertion of codons that yield frequently occurring tRNA replaces "rare codons." In some embodiments, codon optimization may include increasing the G / C content of the coding region of the RNA described herein, compared to the guanosine / cytosine (G / C) content of the corresponding coding sequence of wild-type RNA, wherein the amino acid sequence encoded by the RNA is preferably unmodified compared to the amino acid sequence described herein.
[0531] In some embodiments, the coding sequence (also referred to as the “coding region”) is codon-optimized for expression in a subject (e.g., a human) to which the composition (e.g., a pharmaceutical composition) is to be administered. Therefore, in some embodiments, the sequence in this polynucleotide (e.g., a polynucleotide) may differ from the wild-type sequence encoding the relevant antigen or a fragment or epitope thereof, even when the amino acid sequence of the antigen or a fragment or epitope thereof is wild-type.
[0532] In some implementations, codon optimization strategies are used to express the codons in relevant subjects (e.g., humans), and in some cases, to express them in specific cells or tissues.
[0533] Different species exhibit specific preferences for certain codons of particular amino acids. Without being bound by any single theory, codon preference (differences in codon use between organisms) is generally associated with the translation efficiency of messenger RNA (mRNA), which is particularly thought to depend on the nature of the codon being translated and the availability of a particular transfer RNA (tRNA) molecule. The preference of the selected tRNA in a cell generally likely reflects the most frequently used codons in peptide synthesis. Therefore, genes can be tailored based on codon optimization to achieve optimal gene expression in a given organism. Codon usage tables are available, for example, at www.kazusa.orjp / codon / , in a “Codon Usage Database,” and these tables can be adapted in various ways. Computer algorithms for codon optimization of specific sequences for expression in a particular subject or its cells are also available, such as GeneForge (Aptagen; Jacobus, PA).
[0534] In some embodiments, the polynucleotides (e.g., polynucleotides) of this disclosure are codon-optimized, wherein the codons in the polynucleotide (e.g., polynucleotide) are adapted for human codon use (referred to herein as "human codon-optimized polynucleotides"). In some embodiments, a portion of the polynucleotide is codon-optimized (e.g., a portion of a glycoprotein or the portion encoding it, or a portion of a secretion signal or the portion encoding a secretion signal). In some embodiments, the entire polynucleotide is codon-optimized. Codons encoding the same amino acid occur at different frequencies in a subject, such as a human. Therefore, in some embodiments, the coding sequence of the polynucleotides of this disclosure is modified such that the frequency of codons encoding the same amino acid corresponds to the frequency of the natural presence of that codon according to human codon use, for example, as shown in Table 14. For example, in the case of amino acid Ala, the wild-type coding sequence is preferably adapted as follows: codon "GCC" is used at a frequency of 0.40, codon "GCT" at a frequency of 0.28, codon "GCA" at a frequency of 0.22, and codon "GCG" at a frequency of 0.10, etc. (See Table 14). Therefore, in some embodiments, this procedure (as illustrated for Ala) is applied to each amino acid encoded by the coding sequence of a polynucleotide to obtain a sequence suitable for human codon usage.
[0535] Table 14: Human codon usage with frequencies indicated for each amino acid.
[0536]
[0537]
[0538] Certain strategies for codon optimization and / or G / C enrichment for human expression are described in WO2002 / 098443, which is incorporated herein by reference in its entirety. In some embodiments, the coding sequence may be optimized using a multi-parameter optimization strategy. In some embodiments, the optimization parameters may include parameters that affect protein expression, which may have an effect, for example, at the transcriptional, RNA, and / or translational levels. In some embodiments, exemplary optimization parameters include, but are not limited to, transcriptional level parameters (including, for example, GC content, shared splice sites, hidden splice sites, SD sequences, TATA boxes, termination signals, artificial recombination sites, and combinations thereof); RNA level parameters (including, for example, unstable RNA motifs, ribosome entry sites, repetitive sequences, and combinations thereof); translational level parameters (including, for example, codon usage, premature poly(A) sites, ribosome entry sites, secondary structures, and combinations thereof); or combinations thereof. In some implementations, the coding sequence can be optimized by the GeneOptimizer algorithm as described below: Fath et al., “Multiparameter RNA and Codon Optimization: A Standardized Tool to Assess and Enhance Autologous Mammalian Gene Expression” PLoS ONE 6(3):e17596; Rabb et al., “The GeneOptimizer Algorithm: using a sliding window approach to cope with the vast sequence space in multiparameter DNA sequence optimization” Systems and Synthetic Biology (2010) 4:215-225, which are incorporated herein by reference in their entirety; and Graft et al., “Codon-optimized genes that enable increased heterologous expression in mammalian cells and elicit efficient immune responses in mice after vaccination of naked DNA” Methods Mol Med (2004) 94:197-210, the entire contents of each of these references are incorporated herein by reference for the purposes described herein.In some implementations, the encoded sequence can be optimized using the Eurofins adaptive and optimization algorithm “GENEius”, as described in Eurofins' Application Notes: Eurofins' adaptation and optimization software “GENEius” in comparison to other optimization algorithms, the entire contents of which are incorporated herein by reference for the purposes described herein.
[0539] In some embodiments, the coding sequences used according to this disclosure have an increased G / C content compared to the coding sequences of the HSV gC, gD, and / or gE (or fragments thereof) constructs described herein. In some embodiments, the guanosine / cytidine (G / C) content of the coding region is altered relative to a comparable coding sequence of the HSV gC, gD, and / or gE (or fragments thereof) constructs described herein, but the amino acid sequence encoded by the polynucleotide remains unchanged.
[0540] Without being bound by any particular theory, it is proposed that GC enrichment can improve the translation of payload sequences. Generally, sequences with increased G (guanosine) / C (cytidine) content are more stable than those with increased A (adenosine) / U (uridine) content. The fact that several codons encode the same amino acid (so-called genetic code degeneracy) allows for the determination of the codons most favorable for stability (so-called selective codon use). Depending on the amino acid encoded by the polynucleotide, there are multiple possibilities for modification of the ribonucleic acid sequence compared to its wild-type sequence. Specifically, codons containing A and / or U nucleotides can be modified by replacing them with other codons encoding the same amino acid but without A and / or U, or containing lower amounts of A and / or U nucleotides.
[0541] In some embodiments, the G / C content of the coding region of the polynucleotide described herein is increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even greater compared to the G / C content of the coding region before codon optimization of, for example, wild-type RNA. In some embodiments, the G / C content of the coding region of the polynucleotide described herein is decreased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, or even greater compared to the G / C content of the coding region before codon optimization of, for example, wild-type RNA.
[0542] In some embodiments, the stability and translation efficiency of the polynucleotide may be incorporated into one or more components that have been shown to contribute to the stability and / or translation efficiency of the polynucleotide; exemplary such components are described, for example, in PCT / EP2006 / 009448, which is incorporated herein by reference. In some embodiments, to increase the expression of the polynucleotide used according to this disclosure, the polynucleotide may be modified within the coding region, i.e., the sequence encoding the expressed peptide or protein, without altering the sequence of the expressed peptide or protein, for example, to increase GC content, thereby increasing RNA stability and / or performing codon optimization, and thereby enhancing translation in the cell.
[0543] D. Some instance RNA constructs
[0544] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:65, a 3' UTR, and a polyA tail.
[0545] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:70. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:70, a 3' UTR, and a polyA tail.
[0546] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:73. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:73, a 3' UTR, and a polyA tail.
[0547] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:67. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:67, a 3' UTR, and a polyA tail.
[0548] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:68. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:68, a 3' UTR, and a polyA tail.
[0549] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:75. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:75, a 3' UTR, and a polyA tail.
[0550] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:131. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:131, a 3' UTR, and a polyA tail.
[0551] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:132. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:132, a 3' UTR, and a polyA tail.
[0552] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:159. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:159, a 3' UTR, and a polyA tail.
[0553] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:160. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:160, a 3' UTR, and a polyA tail.
[0554] In some embodiments, the polynucleotide provided herein encodes a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:161. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:161, a 3' UTR, and a polyA tail.
[0555] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:162. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:162, a 3' UTR, and a polyA tail.
[0556] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:163. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:163, a 3' UTR, and a polyA tail.
[0557] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:164. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:164, a 3' UTR, and a polyA tail.
[0558] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:327. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:327, a 3' UTR, and a polyA tail.
[0559] In some embodiments, the polynucleotides provided herein encode a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:328. In some embodiments, the RNA construct comprises a 5' cap, a 5' UTR, a polynucleotide encoding a polypeptide, wherein the polypeptide comprises the amino acid sequence according to SEQ ID NO:328, a 3' UTR, and a polyA tail.
[0560] IV. RNA Delivery Technology
[0561] The provided polynucleotides can be delivered using any suitable method known in the art for the therapeutic applications described herein, including, for example, delivery as naked RNA or delivery mediated by viral and / or non-viral vectors, polymer-based vectors, lipid compositions, nanoparticles (e.g., lipid nanoparticles, polymer nanoparticles, lipid-polymer hybrid nanoparticles, etc.) and / or peptide-based vectors. For information on various methods that can be used to deliver the polynucleotides described herein, see, for example, Wadhwa et al., “Opportunities and Challenges in the Delivery of mRNA-Based Vaccines”, Pharmaceutics (2020), 102 (27 pages), the contents of which are incorporated herein by reference.
[0562] In some embodiments, one or more polynucleotides may be formulated together with lipid nanoparticles for delivery (e.g., administration).
[0563] In some embodiments, lipid nanoparticles may be designed to protect polynucleotides from extracellular RNases and / or engineered to deliver RNA systemically to target cells. In some embodiments, such lipid nanoparticles may be particularly suitable for delivering polynucleotides when administered intravenously or intramuscularly to a subject.
[0564] A. Lipid composition
[0565] 1. Lipids and lipid-like materials
[0566] The terms “lipid” and “lipid-like material” are broadly defined herein as molecules comprising one or more hydrophobic moieties or groups and optionally one or more hydrophilic moieties or groups. Molecules comprising both hydrophobic and hydrophilic moieties are also commonly referred to as amphiphiles. Lipids are generally poorly soluble in water. In an aqueous environment, the amphiphilic nature allows the molecules to self-assemble into organized structures and different phases. One of these phases consists of a lipid bilayer, due to its presence in vesicles, multilayer / monolayer liposomes, or membranes in an aqueous environment. Hydrophobicity can be conferred by incorporating nonpolar groups, including but not limited to long-chain saturated and unsaturated aliphatic hydrocarbon groups and such groups substituted with one or more aromatic, cyclic aliphatic, or heterocyclic groups. The hydrophilic groups may comprise polar and / or charged groups and include carbohydrates, phosphate esters, carboxyl groups, sulfate groups, amino groups, thioglycolic groups, nitro groups, hydroxyl groups, and other similar groups.
[0567] Typically, amphiphilic compounds have a polar head connected to a long hydrophobic tail. In some embodiments, the polar portion is soluble in water, while the nonpolar portion is insoluble in water. Additionally, the polar portion may carry a positive or negative charge. Alternatively, the polar portion may simultaneously have both a positive and a negative charge and be an amphoteric ion or an internal salt. For the purposes of this disclosure, the amphiphilic compound may be, but is not limited to, one or more natural or non-natural lipids and lipid-like compounds.
[0568] "Lipid-like materials" are substances that are structurally and / or functionally related to lipids but are not strictly considered lipids. For example, the term includes compounds capable of forming amphiphilic layers due to their presence in vesicles, multilayer / monolayer liposomes, or membranes in an aqueous environment, and includes surfactants, or synthetic compounds possessing both hydrophilic and hydrophobic portions. Generally, the term refers to molecules comprising hydrophilic and hydrophobic portions with different structural arrangements, which may be similar to or dissimilar to the structural arrangements of lipids.
[0569] Specific examples of amphiphilic compounds that may be included in the amphiphilic layer include, but are not limited to, phospholipids, amino lipids, and sphingolipids.
[0570] Generally, lipids can be classified into eight categories: fatty acids, glycerolipids, glycerophospholipids, sphingolipids, glycolipids, polyketides (derived from the condensation of ketoacyl subunits), sterols, and isopentenyl lipids (derived from the condensation of isopentenyl subunits). Although the term "lipid" is sometimes used synonymously with fat, fat is a subgroup of lipids called triglycerides. Lipids also encompass molecules such as fatty acids and their derivatives (including triglycerides, diglycerides, monoglycerides, and phospholipids), as well as sterol-containing metabolites such as cholesterol.
[0571] Fatty acids are a group of different molecules formed from hydrocarbon chains ending with carboxylic acid groups; this arrangement gives the molecule a polar hydrophilic end and a water-insoluble nonpolar hydrophobic end. The carbon chains, typically between 4 and 24 carbons in length, can be saturated or unsaturated and can be linked to functional groups containing oxygen, halogens, nitrogen, and sulfur. If a fatty acid contains double bonds, it can exhibit cis or trans geometric isomerism, which significantly affects the molecular conformation. Cis double bonds cause the fatty acid chain to bend, an effect resulting from complexation with more double bonds in the chain. Other major lipid types in the fatty acid class are fatty esters and fatty amides.
[0572] Glycerol lipids consist of mono-, di-, and tri-substituted glycerols, the most well-known being fatty acid triesters of glycerol, called triglycerides. The term "triacylglycerol" is sometimes used synonymously with "triglyceride." In these compounds, the three hydroxyl groups of glycerol are typically esterified from different fatty acids. Other subclasses of glycerol lipids are represented by glycosylglycerols, characterized by the presence of one or more sugar residues linked to glycerol via glycosidic bonds.
[0573] Glycerophospholipids are amphiphilic molecules (containing both hydrophobic and hydrophilic regions) with a glycerol core consisting of two fatty acid-derived "tails" linked by ester bonds and a "head" group linked by phosphate ester bonds. Glycerophospholipids are commonly referred to as phospholipids (although sphingomyelins are also classified as phospholipids), and examples include phosphatidylcholine (also known as PC, GPCho, or lecithin), phosphatidylethanolamine (PE or GPEtn), and phosphatidylserine (PS or GPSer).
[0574] Sphingolipids are members of a family of complex compounds, sharing a common structural feature: a sphingokinase backbone. The major sphingokinases in mammals are generally referred to as sphingosine. Ceramides (N-acyl-sphingokinases) are a major subclass of sphingokinase derivatives of fatty acids linked by an amide group. These fatty acids are typically saturated or monounsaturated, with chain lengths of 16 to 26 carbon atoms. The major phosphosphingolipid in mammals is sphingomyelin (ceramide phosphocholine), while insects primarily contain ceramide phosphoethanolamine, and fungi possess phytoceramide phosphoinositol and a mannose-containing head group. Glycosphingolipids are a diverse family of molecules composed of one or more sugar residues linked to a sphingokinase via glycosidic bonds. Examples of these substances range from simple to complex glycosphingolipids, such as cerebrosides and gangliosides.
[0575] Sterols, such as cholesterol and its derivatives, or tocopherol and its derivatives, together with glycerophospholipids and sphingomyelins, are important components of membrane lipids.
[0576] Glycolipids are compounds in which fatty acids are directly linked to the sugar backbone, forming a structure compatible with the membrane bilayer. In glycolipids, monosaccharides replace the glycerol backbone present in glycerol lipids and glycerophospholipids. The most common glycolipids are acylated glucosamine precursors of the lipid A component of lipopolysaccharides in Gram-negative bacteria. Typical lipid A molecules are disaccharides of glucosamine, derived from up to seven fatty acyl chains. The smallest lipopolysaccharide required for the growth of *E. coli* is Kdo2-lipid A, a hexaacylated disaccharide of glucosamine glycosylated with two 3-deoxy-D-manno-octulose (Kdo) residues.
[0577] Polyketides are synthesized by polymerizing acetyl and propionyl subunits using classical enzymes and repeating and multimodal enzymes that share the same mechanical characteristics as fatty acid synthases. They comprise a large number of secondary metabolites and natural products from animal, plant, bacterial, fungal, and marine sources and exhibit tremendous structural diversity. Many polyketides are cyclic molecules, and their backbones are often further modified by glycosylation, methylation, hydroxylation, oxidation, or other processes.
[0578] Lipids and lipid-like materials can be cationic, anionic, or neutral. Neutral lipids or lipid-like materials exist as uncharged or neutral zwitterionic forms at the selected pH.
[0579] In some embodiments, suitable lipids or lipid-like materials used in this disclosure include those described in WO2020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for the purposes described herein.
[0580] 2. Cations or cation-ionizable lipids or lipid-like materials
[0581] In some embodiments, the cationic or cationically ionizable lipid or lipid-like material intended for use herein includes any cationic or cationically ionizable lipid or lipid-like material capable of electrostatically binding nucleic acids. In one embodiment, the cationic or cationically ionizable lipid or lipid-like material intended for use herein may associate with nucleic acids, for example, by forming a complex with the nucleic acid or forming vesicles therein that encapsulate or seal the nucleic acid.
[0582] Cationic lipids or lipid-like materials are characterized by having a net positive charge (e.g., at the relevant pH). Cationic lipids or lipid-like materials bind negatively charged nucleic acids through electrostatic interactions. Generally, cationic lipids have lipophilic moieties, such as sterols, acyl chains, diacyl groups, or more acyl chains, and the head group of the lipid typically carries a positive charge.
[0583] In some embodiments, cationic lipids or lipid-like materials possess a net positive charge only at certain pH levels, specifically acidic pH levels, while at different, preferably higher pH levels such as physiological pH levels, they preferably do not possess a net positive charge, and are preferably uncharged, i.e., neutral. This ionization behavior is believed to enhance efficacy by facilitating endosome escape and reducing toxicity compared to particles that remain cationic at physiological pH levels.
[0584] In some embodiments, the cationic lipid or cationic ionizable lipid or lipid-like material comprises a head group containing at least one positively charged or protonable nitrogen atom (N).
[0585] Examples of cationic lipids include, but are not limited to, 1,2-dioleoyl-3-trimethylammonium propane (DOTAP); N,N-dimethyl-2,3-dioleoyloxypropylamine (DODMA), 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA), 3-(N-(N',N'-dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), dimethylbis(octadecylammonium) (DDAB); 1,2-dioleoyl-3-dimethylammonium-propane (DODAP); 1,2-diacyloxy-3-dimethylammonium propane; 1,2-dialkyloxy-3-dimethylammonium propane; bis(octadecyl)dimethylammonium chloride (DODAC); 1,2-distearate-N,N-dimethylammonium chloride (DODAC); and 1,2-distearate-N,N-dimethylammonium chloride (DODAC). 3-Aminopropane (DSDMA), 2,3-di(tetradecoxy)propyl-(2-hydroxyethyl)-dimethylazonium (DMRIE), 1,2-dimyristoyl-sn-glycerol-3-ethylphosphocholine (DMEPC), 1,2-dimyristoyl-3-trimethylammonium propane (DMTAP), 1,2-dioleoyloxypropyl-3-dimethyl-hydroxyethylammonium bromide (DORIE), and 2,3-dioleoyloxy-N-[2-(sperminecarbamate)ethyl]-N,N-dimethyl-1-propanium trifluoroacetate (DOSPA), 1,2-dilinoleoyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleoyloxy-N,N-dimethylaminopropane (D... LenDMA), bis(octadecylaminoglycylsper ... -Dimethylpropylamine (DLinDAP), 1,2-N,N'-dilinoleylcarbamoyl-3-dimethylaminopropane (DLincarbDAP), 1,2-dilinoleylcarbamoyl-3-dimethylaminopropane (DLinCDAP), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxacyclopentane (DLin-K-DMA), 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxacyclopentane (DLin-K-XTC2-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxacyclopentane (DLin-KC2-DMA), butyrate C37-6,9,2831-Tetraen-19-yl-4-(dimethylamino) ester (DLin-MC3-DMA), N-(2-hydroxyethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanium bromide (DMRIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(cis-9-tetradecenyloxy)-1-propanium bromide (GAP-DMORIE), (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(dodecyloxy)-1-propanium bromide (GAP-DLRIE) (±)-N-(3-aminopropyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanium bromide (GAP-DMRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)-1-propanium bromide (βAE-DMRIE), N-(4-carboxybenzyl)-N,N-dimethyl-2,3-bis(oleoyloxy)propan-1-ammonium (DOBAQ), 2-({8-[(3β)-cholesterol-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12 [Z)-Octadeca-9,12-dien-1-yloxy]prop-1-amine (octyl-CLinDMA), 1,2-dimyristoyl-3-dimethylammonium-propane (DMDAP), 1,2-dipalmitoyl-3-dimethylammonium-propane (DPDAP), N1-[2-((1S)-1-[(3-aminopropyl)amino]-4-[di(3-aminopropyl)amino]butylcarbamoylamino)ethyl]-3,4-di[oleoyloxy]-benzamide (MVL5), 1,2-dioleoyl-sn-glycerol-3-ethylphosphocholine (DOEP) C), 2,3-bis(dodecyloxy)-N-(2-hydroxyethyl)-N,N-dimethylprop-1-ammonium bromide (DLRIE), N-(2-aminoethyl)-N,N-dimethyl-2,3-bis(tetradecyloxy)prop-1-ammonium bromide (DMORIE), 8,8'-((((2(dimethylamino)ethyl)thio)carbonyl)azanyl)dioctanoic acid di((Z)-non-2-en-1-yl) ester (ATX), N,N-dimethyl-2,3-bis(dodecyloxy)prop-1-amine (DLDMA), N,N-dimethyl-2,3-Bis(tetradecyloxy)prop-1-amine (DMDMA), heptadecanedioic acid di((Z)-non-2-en-1-yl)-9-((4-(dimethylaminobutyryl)oxy) ester (L319), N-dodecyl-3-((2-dodecylcarbamoyl-ethyl)-{2-[(2-dodecylcarbamoyl-ethyl)-2-{(2-dodecylcarbamoyl-ethyl)-[2-(2-dodecylcarbamoyl-ethylamino)-ethyl]-amino}-ethylamino)propionamide (lipid 98N12-5), 1-[2-[bis(2-hydroxydodecyl)amino]ethyl-[2-[4-[2-[bis(2-hydroxydodecyl)amino]ethyl]hexahydropyrazin-1-yl]ethyl]amino]dodecyl-2-ol (lipid C12-200), (Commercially available cationic liposomes containing DOTMA and 1,2-dioleoyl-sn-3-phosphoethanolamine (DOPE), from GIBCO / BRL, Grand Island, NY); (Commercially available cationic liposomes containing N-(1-(2,3-dioleoyloxy)propyl)-N-(2-(sperminecarbamate)ethyl)-N,N-dimethyltrifluoroacetate ammonium (DOSPA) and (DOPE), from GIBCO / BRL); and (Commercially available cationic lipids comprising bis(octadecylaminoglycyl)carboxysylspermine (DOGS) in ethanol, from Promega Corp., Madison, Wis.) or any combination of any of the foregoing substances. Other suitable cationic lipids for use in this disclosure include those described in WO2020 / 128031 and US20200163878, the entire contents of each of which are incorporated herein by reference for the purposes described herein. Other suitable cationic lipids for use in this disclosure include those described in WO2010 / 053572 (including Cl 2-200 described in paragraph
[00225] ) and WO2012 / 170930, both of which are incorporated herein by reference for the purposes described herein. Additional suitable cationic lipids for use in this disclosure include HGT4003, HGT5000, HGTS001, HGT5001, and HGT5002 (see US20150140070A1, which is incorporated herein by reference in its entirety).
[0586] In some embodiments, formulations suitable for pharmaceutical compositions (e.g., immunogenic compositions, such as vaccines) as described herein may comprise at least one cationic lipid. Representative cationic lipids include, but are not limited to, 1,2-dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-dilinoleyloxy-3-morpholinylpropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), 1,2-dilinoleothio-3-dimethylaminopropane (DLin-S-DMA), 1-linoleoyl-2-linoleyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3-trimethylaminopropane chloride (DLin-TMA.CI), 1,2-dilinoleoyl-3-trimethylaminopropane chloride (DLin-TAP.CI), and 1,2-dilinoleyloxy-3-(N-methylpiperazinyl)acetoxypropane. Alkane (DLin-MPZ), 3-(N,N-dioleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dioleyloxo-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), and 2,2-dioleyl-4-dimethylaminomethyl-[1,3]-dioxacyclopentane (DLin-K-DMA), 2,2-dioleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxacyclopentane (DLin-KC2-DMA); dioleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA); MC3 (US20100324120, the entire contents of which are incorporated herein by reference).
[0587] In some embodiments, amino or cationic lipids useful according to this disclosure have at least one protonable or deprotonable group, such that the lipid is positively charged at a pH equal to or below physiological pH (e.g., pH 7.4), and neutral at a second pH preferably equal to or above physiological pH. It should be understood, of course, that the addition or removal of protons with varying pH is an equilibrium process, and that the reference to charged or neutral lipids refers to the properties of the dominant species and does not require all lipids to be present in a charged or neutral form. Lipids having more than one protonable or deprotonable group, or being zwitterionic lipids, are not excluded, and such lipids are equally suitable for the context of this invention.
[0588] In some embodiments, the protonable lipid has a pKa of a protonable group in the range of about 4 to about 11, for example, about 5 to about 7.
[0589] In some embodiments, the cationic lipid may comprise about 10 mol% to about 100 mol%, about 20 mol% to about 100 mol%, about 30 mol% to about 100 mol%, about 40 mol% to about 100 mol%, or about 50 mol% to about 100 mol% of the total lipids present in the lipid composition used according to this disclosure.
[0590] 3. Additional lipids or lipid-like materials
[0591] In some embodiments, the formulations used according to this disclosure may comprise lipids or lipid-like materials other than cationic or cationic ionizable lipids or lipid-like materials, i.e., non-cationic lipids or lipid-like materials (including non-cationic ionizable lipids or lipid-like materials). Anionic and neutral lipids or lipid-like materials are collectively referred to herein as non-cationic lipids or lipid-like materials. In some embodiments, optimizing the formulation of nucleic acid particles by adding other hydrophobic portions (such as cholesterol and lipids) in addition to ionizable / cationic lipids or lipid-like materials may, for example, enhance particle stability and nucleic acid delivery efficiency.
[0592] In some embodiments, lipids or lipid-like materials that may or may not affect the total charge of the particles may be incorporated. In some embodiments, this lipid or lipid-like material is a non-cationic lipid or lipid-like material.
[0593] In some embodiments, non-cationic lipids may comprise, for example, one or more anionic lipids and / or neutral lipids. “Anionic lipids” are negatively charged (e.g., at a selected pH).
[0594] "Neutral lipids" exist in an uncharged or neutral zwitterionic form (e.g., at a selected pH). In some embodiments, the formulation comprises one of the following neutral lipid components: (1) phospholipids, (2) cholesterol or a derivative thereof; or (3) a mixture of phospholipids and cholesterol or a derivative thereof. Examples of cholesterol derivatives include, but are not limited to, cholesterol alcohols, cholesterol ketones, cholesterols, colistinols, cholesterol-2'-hydroxyethyl ether, cholesterol-4'-hydroxybutyl ether, tocopherols and their derivatives, and mixtures thereof.
[0595] Specific examples of phospholipids that can be used include, but are not limited to, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidic acid, phosphatidylserine, or sphingomyelin. These phospholipids particularly include diacylphosphatidylcholine, such as distearylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dimyristoylphosphatidylcholine (DMPC), octadecylphosphatidylcholine, dilauroylphosphatidylcholine, dipalmitoylphosphatidylcholine (DPPC), arachidoylphosphatidylcholine (DAPC), disambacylphosphatidylcholine (DBPC), bis(trisacylphosphatidylcholine) (DTPC), bis(tetracosylphosphatidylcholine) (DLPC), palmitoyloleyl-phosphatidylcholine (POPC), 1,2-di-O-octadecenyl-sn-glycerol-3-phosphocholine (18:0 diether PC), 1-oleoyl-2-cholesterolylhemisuccinoyl-sn-glycerol-3-phosphocholine (OChemsPC), and 1-hexadecyl-sn-glycerol-3-phosphocholine (C16 Lyso). PC) and phosphatidylethanolamines, specifically diacylphosphatidylethanolamines, such as dioleoylphosphatidylethanolamine (DOPE), distearate-phosphatidylethanolamine (DSPE), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), dilauroylphosphatidylethanolamine (DLPE), diphyranoylphosphatidylethanolamine (DPyPE), and other phosphatidylethanolamine lipids with different hydrophobic chains.
[0596] In some embodiments, the formulation used according to this disclosure includes DSPC or DSPC and cholesterol.
[0597] In some embodiments, the formulations used according to this disclosure include both cationic lipids and additional (non-cationic) lipids.
[0598] In some embodiments, the formulations described herein comprise polymer-conjugated lipids such as PEGylated lipids. "PEGylated lipids" includes both a lipid portion and a polyethylene glycol portion. PEGylated lipids are known in the art.
[0599] Unwilling to be bound by theory, the amount of (total) cationic lipids, compared to the amount of other lipids in the formulation, can affect important characteristics such as the charge, particle size, stability, tissue selectivity, and bioactivity of nucleic acids. In some embodiments, the molar ratio of at least one cationic lipid to at least one additional lipid is about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1.
[0600] In some embodiments, non-cationic lipids, specifically neutral lipids (e.g., one or more phospholipids and / or cholesterol), may account for about 0 mol% to about 90 mol%, about 0 mol% to about 80 mol%, about 0 mol% to about 70 mol%, about 0 mol% to about 60 mol%, or about 0 mol% to about 50 mol% of the total lipids present in the formulation.
[0601] 4. Lipid complex particles
[0602] In some embodiments of this disclosure, the RNA described herein may be present in RNA lipid complex particles.
[0603] "RNA-lipid complex particles" contain lipids, particularly cationic lipids, and RNA. Electrostatic interactions between positively charged liposomes and negatively charged RNA lead to the recombination and spontaneous formation of RNA-lipid complex particles. Positively charged liposomes can generally be synthesized using cationic lipids (such as DOTMA) and additional lipids (such as DOPE). In one embodiment, the RNA-lipid complex particles are nanoparticles.
[0604] In some embodiments, the RNA-lipid complex particles comprise both cationic lipids and additional lipids. In some embodiments, the cationic lipid is DOTMA and the additional lipid is DOPE.
[0605] In some embodiments, the molar ratio of at least one cationic lipid to at least one additional lipid is about 10:0 to about 1:9, about 4:1 to about 1:2, or about 3:1 to about 1:1. In specific embodiments, the molar ratio may be about 3:1, about 2.75:1, about 2.5:1, about 2.25:1, about 2:1, about 1.75:1, about 1.5:1, about 1.25:1, or about 1:1. In some embodiments, the molar ratio of at least one cationic lipid to at least one additional lipid is about 2:1.
[0606] In some embodiments, the RNA lipid complex particles have an average diameter in one embodiment ranging from about 200 nm to about 1000 nm, from about 200 nm to about 800 nm, from about 250 nm to about 700 nm, from about 400 nm to about 600 nm, from about 300 nm to about 500 nm, or from about 350 nm to about 400 nm. In a specific embodiment, the RNA-lipid complex particles have an average diameter of about 200 nm, about 225 nm, about 250 nm, about 275 nm, about 300 nm, about 325 nm, about 350 nm, about 375 nm, about 400 nm, about 425 nm, about 450 nm, about 475 nm, about 500 nm, about 525 nm, about 550 nm, about 575 nm, about 600 nm, about 625 nm, about 650 nm, about 700 nm, about 725 nm, about 750 nm, about 775 nm, about 800 nm, about 825 nm, about 850 nm, about 875 nm, about 900 nm, about 925 nm, about 950 nm, about 975 nm, or about 1000 nm. In one embodiment, the RNA-lipid complex particles have an average diameter in the range of about 250 nm to about 700 nm. In another embodiment, the RNA-lipid complex particles have an average diameter in the range of about 300 nm to about 500 nm. In some embodiments, the RNA-lipid complex particles have an average diameter of about 400 nm.
[0607] The RNA-lipid complex particles and compositions comprising RNA-lipid complex particles described herein are suitable for delivering RNA to target tissues after parenteral administration, specifically after intravenous administration. The RNA-lipid complex particles can be prepared using liposomes, which are obtained by injecting a solution of lipids in ethanol into water or a suitable aqueous phase. In one embodiment, the aqueous phase has an acidic pH. In one embodiment, the aqueous phase contains, for example, an amount of acetic acid of about 5 mM. Liposomes can be used to prepare RNA-lipid complex particles by mixing liposomes with RNA. In one embodiment, the liposomes and RNA-lipid complex particles comprise at least one cationic lipid and at least one additional lipid. In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenyl-3-trimethylammonium propane (DOTMA) and / or 1,2-dioleoyl-3-trimethylammonium propane (DOTAP). In one embodiment, the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycerol-3-phosphate ethanolamine (DOPE), cholesterol (Chol), and / or 1,2-dioleoyl-sn-glycerol-3-phosphate choline (DOPC). In one embodiment, the at least one cationic lipid comprises 1,2-di-O-octadecenoyl-3-trimethylammonium propane (DOTMA) and the at least one additional lipid comprises 1,2-di-(9Z-octadecenoyl)-sn-glycerol-3-phosphate ethanolamine (DOPE). In one embodiment, the liposome and RNA lipid complex particles comprise 1,2-di-O-octadecenoyl-3-trimethylammonium propane (DOTMA) and 1,2-di-(9Z-octadecenoyl)-sn-glycerol-3-phosphate ethanolamine (DOPE).
[0608] Spleen-targeting RNA-lipid complex particles are described in WO 2013 / 143683, which is incorporated herein by reference. It has been found that RNA-lipid complex particles with a net negative charge can be used to preferentially target spleen tissue or spleen cells, such as antigen-presenting cells, specifically dendritic cells. Therefore, RNA accumulation and / or RNA expression occur in the spleen after administration of the RNA-lipid complex particles. Therefore, the RNA-lipid complex particles of this disclosure can be used to express RNA in the spleen. In one embodiment, no or substantially no RNA accumulation and / or RNA expression occurs in the lungs and / or liver after administration of the RNA-lipid complex particles. In one embodiment, RNA accumulation and / or RNA expression occur in antigen-presenting cells (such as professional antigen-presenting cells in the spleen) after administration of the RNA-lipid complex particles. Therefore, the RNA-lipid complex particles of this disclosure can be used to express RNA in such antigen-presenting cells. In one embodiment, the antigen-presenting cells are dendritic cells and / or macrophages.
[0609] 5. Lipid nanoparticles (LNP)
[0610] In some embodiments, the nucleic acids (such as RNA) described herein are administered in the form of lipid nanoparticles (LNPs). In some embodiments, the LNPs may comprise any lipids capable of forming particles, with one or more nucleic acid molecules attached to the particles, or with one or more nucleic acid molecules encapsulated within the particles.
[0611] In some embodiments, the LNP comprises one or more cationic lipids and one or more stable lipids. Stable lipids include neutral lipids and polyethylene glycol-modified lipids.
[0612] In some embodiments, LNPs comprise cationic lipids, neutral lipids, sterols, polymer-conjugated lipids; and RNA encapsulated within or associated with lipid nanoparticles.
[0613] In some embodiments, the neutral lipids are selected from the group consisting of: DSPC, DPPC, DMPC, DOPC, POPC, DOPE, DOPG, DPPG, POPE, DPPE, DMPE, DSPE, and SM. In some embodiments, the neutral lipid is DSPC.
[0614] In some implementations, sterol is cholesterol.
[0615] In some embodiments, the polymer-conjugated lipid is a polyethylene glycol-modified lipid. In some embodiments, the polyethylene glycol-modified lipid has the following structure:
[0616]
[0617] Or its pharmaceutically acceptable salts, tautomers or stereoisomers, wherein: R 12 and R 13 Each is independently a straight-chain or branched, saturated or unsaturated alkyl chain containing 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has an average value in the range of 30 to 60. In some embodiments, R 12 and R 13 Each is independently a straight-chain saturated alkyl chain containing 12 to 16 carbon atoms. In some embodiments, w has an average value in the range of 40 to 55. In some embodiments, the average w is about 45. In some embodiments, R 12 and R 13 Each is an independent straight-chain saturated alkyl chain containing about 14 carbon atoms, and w has an average value of about 45.
[0618] In some embodiments, the PEGylated lipoprotein is DMG-PEG 2000, for example having the following structure:
[0619]
[0620] In some embodiments, the cationic lipid component of LNP has the structure of formula (III):
[0621]
[0622] Or its pharmaceutically acceptable salt, tautomer, prodrug, or stereoisomer, wherein:
[0623] L 1 or L 2 One of them is -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, -S(O) x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-、-C(=O)NR a -、NR a C(=O)NR a -、-OC(=O)NR a -or-NR a C(=O)O-, and L 1 or L 2 The other two are -O(C=O)-, -(C=O)O-, -C(=O)-, -O-, and -S(O). x -, -SS-, -C(=O)S-, SC(=O)-, -NR a C(=O)-、-C(=O)NR a -、NR a C(=O)NR a -、-OC(=O)NR a -or-NR a C(=O)O- or direct bond;
[0624] G 1 and G 2 Each is independently unsubstituted C1-C 12 Alkylene or C1-C 12 alkenyl;
[0625] G 3 For C1-C 24 Alkylene, C1-C 24 C3-C8 cycloalkylene, C3-C8 cycloalkylene;
[0626] Ra For H or C1-C 12 alkyl;
[0627] R 1 and R 2 Each independently is C6-C 24 Alkyl or C6-C 24 alkenyl;
[0628] R 3 For H, OR 5 CN, -C(=O)OR 4 -OC(=O)R 4 or -NR 5 C(=O)R 4 ;
[0629] R 4 For C1-C 12 alkyl;
[0630] R 5 It is H or C1-C6 alkyl; and
[0631] x is 0, 1, or 2.
[0632] In some of the aforementioned embodiments of formula (III), the lipid has one of the following structures (IIIA) or (IIIB):
[0633]
[0634] in:
[0635] A is a 3- to 8-membered cycloalkyl or cycloalkylene ring;
[0636] R 6 Each time it appears, it is independently H, OH, or Cl-C. 24 Alkyl; and
[0637] n is an integer in the range of 1 to 15.
[0638] In some of the aforementioned embodiments of formula (III), the lipid has structure (IIIA), and in other embodiments, the lipid has structure (IIIB).
[0639] In other embodiments of formula (III), the lipid has one of the following structures (IIIC) or (IIID):
[0640]
[0641] Where y and z are each an independent integer in the range of 1 to 12.
[0642] In any of the foregoing embodiments of formula (III), L 1 or L 2 One of them is -O (C = O)-. For example, in some implementations, L 1 and L 2 Each of these is -O (C = O)-. In any of the different implementations described above, L 1 and L 2 Each is independently -(C=O)O- or -O(C=O)-. For example, in some implementations, L 1 and L 2 Each of them is -(C=O)O-.
[0643] In some different embodiments of formula (III), the lipid has one of the following structures (IIIE) or (IIIF):
[0644]
[0645] In some of the foregoing embodiments of formula (III), the lipid has one of the following structures: (IIIG), (IIIH), (IIII), or (IIIJ):
[0646]
[0647]
[0648] In some of the foregoing embodiments of equation (III), n is an integer in the range of 2 to 12, for example, 2 to 8 or 2 to 4. For example, in some embodiments, n is 3, 4, 5 or 6. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some embodiments, n is 6.
[0649] In some other of the foregoing embodiments of equation (III), y and z are each independently integers in the range of 2 to 10. For example, in some embodiments, y and z are each independently integers in the range of 4 to 9 or 4 to 6.
[0650] In some of the aforementioned embodiments of formula (III), R 6 For H. In other of the aforementioned embodiments, R 6 For C1-C 24 Alkyl group. In other embodiments, R 6 It is OH.
[0651] In some implementations of formula (III), G 3 Not replaced. In other implementations, G3 is replaced. In various different implementations, G... 3For straight chain C1-C 24 Alkylene or straight-chain C1-C 24 Alkenyl group.
[0652] In some other of the aforementioned embodiments of formula (III), R 1 or R 2 For or both are C6-C 24 Alkenyl. For example, in some embodiments, R 1 and R 2 Each of them independently has the following structure:
[0653]
[0654] in:
[0655] R 7a and R 7b Each occurrence is independently H or Cl-C. 12 Alkyl; and
[0656] a is an integer from 2 to 12, and
[0657] Where R 7a R 7b Each of a and a is chosen such that R 1 and R 2 Each contains 6 to 20 carbon atoms independently. For example, in some implementations, 'a' is an integer in the range of 5 to 9 or 8 to 12.
[0658] In some of the aforementioned embodiments of formula (III), R appears at least once. 7a For example, in some implementations, R is H. 7a It is H each time it appears. In the other different embodiments described above, R appears at least once. 7b It is a C1-C8 alkyl group. For example, in some embodiments, the C1-C8 alkyl group is methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, n-hexyl, or n-octyl.
[0659] In different implementations of formula (III), R 1 or R 2 It has, or both have, one of the following structures:
[0660]
[0661] In some of the aforementioned embodiments of formula (III), R 3 For OH, CN, -C(=O)OR 4 -OC(=O)R 4 or -NHC(=O)R4 In some implementations, R 4 It can be methyl or ethyl.
[0662] In various different embodiments, the cationic lipid of formula (III) has one of the structures listed in Table 15 below.
[0663] Table 15: Example compounds of formula (III).
[0664]
[0665]
[0666]
[0667]
[0668]
[0669] In various implementations, the cationic lipid has one of the structures listed in Table 16 below.
[0670] Table 16: Examples of cationic lipid structures
[0671]
[0672] In some embodiments, the LNP comprises a cationic lipid, which is an ionizable lipid-like material (lipid-like substance). In some embodiments, the cationic lipid has the following structure:
[0673]
[0674] In some embodiments, the lipid nanoparticles may have an average size (e.g., average diameter) of about 30 nm to about 150 nm, about 40 nm to about 150 nm, about 50 nm to about 150 nm, about 60 nm to about 130 nm, about 70 nm to about 110 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, or about 70 nm to about 80 nm. In some embodiments, the lipid nanoparticles according to this disclosure may have an average size (e.g., average diameter) of about 50 nm to about 100 nm. In some embodiments, the lipid nanoparticles may have an average size (e.g., average diameter) of about 50 nm to about 150 nm. In some embodiments, the lipid nanoparticles may have an average size (e.g., average diameter) of about 60 nm to about 120 nm. In some embodiments, the lipid nanoparticles according to this disclosure may have an average size (e.g., average diameter) of about 30 nm, 35 nm, 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm or 150 nm. The term "average diameter" refers to the average hydrodynamic diameter of a particle, as measured by dynamic laser scattering (DLS), where data analysis is performed using a so-called cumulant algorithm, the results of which provide a so-called Z-mean with a length dimension and a dimensionless polydispersity index (PI) (Koppel, D., J. Chem. Phys. 57, 1972, pp. 4814-4820, ISO 13321, which is incorporated herein by reference). Here, the terms "average diameter," "diameter," or "size" of a particle are used synonymously with the value of the Z-mean.
[0675] In some embodiments, the lipid nanoparticles described herein may exhibit a polydispersity index of less than about 0.5, less than about 0.4, less than about 0.3, or about 0.2 or smaller. For example, lipid nanoparticles may exhibit a polydispersity index in the range of about 0.1 to about 0.3 or about 0.2 to about 0.3. The “polydispersity index” is preferably calculated based on dynamic light scattering measurements by means of so-called cumulative analysis as referred to in the definition of “mean diameter”. Under certain prerequisites, it may serve as a measure of the overall size distribution of ribonucleic acid nanoparticles (e.g., ribonucleic acid nanoparticles).
[0676] The lipid nanoparticles described herein can be characterized by the “N / P ratio,” which is the molar ratio of cationic (nitrogen) groups (“N” in N / P) in the cationic polymer to anionic (phosphate) groups (“P” in N / P) in the RNA. It should be understood that cationic groups are groups in cationic form (e.g., N…). + ( ), or groups that can ionize into cations. Using a single number in the N / P ratio (e.g., an N / P ratio of about 5) means a number greater than 1; for example, an N / P ratio of about 5 means 5:1. In some embodiments, the lipid nanoparticles described herein have an N / P ratio greater than or equal to 5. In some embodiments, the lipid nanoparticles described herein have an N / P ratio of about 5, 6, 7, 8, 9, or 10. In some embodiments, the lipid nanoparticles described herein have an N / P ratio of about 10 to about 50. In some embodiments, the lipid nanoparticles described herein have an N / P ratio of about 10 to about 70. In some embodiments, the lipid nanoparticles described herein have an N / P ratio of about 10 to about 120.
[0677] B. Example methods for preparing lipid nanoparticles
[0678] Lipids containing nucleic acids and lipid nanoparticles and methods for their preparation are known in the art, including, for example, U.S. Patent Nos. 8,569,256, 5,965,542 and U.S. Patent Publications Nos. 2016 / 0199485, 2016 / 0009637, 2015 / 0273068, 2015 / 0265708, 2015 / 0203446, 2015 / 0005363, 2014 / 0308304, 2014 / 0200257, 2013 / 086373, 2013 / 0338210, 2013 / 0323269, 2013 / 0245107, 2013 / 0195920, 2013 / 0123338, 2013 / 0022649, 2013 / 0017223, 2012 / 0295832, 2012 / 0183581, 20 12 / 0172411, 2012 / 0027803, 2012 / 0058188, 2011 / 0311583, 2011 / 0311582, 2011 / 0262527, 2011 / 0216622, 2011 / 0117125, 2011 / 0091525, 2011 / 0076335, 2011 / 0060032, 2010 / 013058 8. 2007 / 0042031, 2006 / 0240093, 2006 / 0083780, 2006 / 0008910, 2005 / 0175682, 2005 / 017054, 2005 / 0118253, 2005 / 0064595, 2004 / 0142025, 2007 / 0042031, 1999 / 009076 and PCT Publication No. WO The entire contents of each of the documents described in WO 2018 / 081480, WO 2017 / 004143, WO 2017 / 075531, WO 2015 / 199952, WO2014 / 008334, WO 2013 / 086373, WO 2013 / 086322, WO 2013 / 016058, WO 2013 / 086373, WO2011 / 141705 and WO 2001 / 07548 are incorporated herein by reference for the purposes described herein.
[0679] For example, in some embodiments, cationic lipids, neutral lipids (e.g., DSPC and / or cholesterol), and polymer-conjugated lipids can be dissolved in ethanol in predetermined molar ratios (e.g., the molar ratios described herein). In some embodiments, one or more lipid nanoparticles are prepared at a total lipid to polynucleotide weight ratio of approximately 10:1 to 30:1. In some embodiments, such polynucleotides can be diluted to 0.2 mg / mL in acetate buffer.
[0680] In some embodiments, using an ethanol injection technique, colloidal lipid dispersions containing polynucleotides can be formed as follows: an ethanol solution containing lipids such as cationic lipids, neutral lipids, and polymer-conjugated lipids is injected into an aqueous solution containing polynucleotides (e.g., the polynucleotides described herein).
[0681] In some embodiments, the lipid and polynucleotide solutions can be mixed at room temperature by pumping each solution into a mixing unit at a controlled flow rate (e.g., using a piston pump). In some embodiments, the flow rates of the lipid and RNA solutions entering the mixing unit are maintained at a 1:3 ratio. After mixing, nucleic acid-lipid particles are formed when the ethanol lipid solution is diluted with aqueous polynucleotides. Lipid solubility decreases as the positively charged cationic lipids interact with the negatively charged RNA.
[0682] In some embodiments, the solution containing RNA-encapsulated lipid nanoparticles may be processed by one or more of concentration adjustment, buffer exchange, formulation, and / or filtration.
[0683] In some implementations, the RNA-encapsulated lipid nanoparticles can be processed by filtration.
[0684] In some implementations, the particle size and / or internal structure of lipid nanoparticles (with or without RNA) can be monitored by appropriate techniques, such as, for example, small-angle X-ray scattering (SAXS) and / or cryo-transmission electron microscopy (CryoTEM).
[0685] V. Pharmaceutical Composition
[0686] This disclosure provides compositions comprising one or more of the polynucleotides described herein, such as pharmaceutical compositions. Pharmaceutical formulations may additionally comprise pharmaceutically acceptable excipients, as used herein, including any and all solvents, dispersion media, diluents or other liquid media, dispersing or suspending agents, surfactants, isotonic agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc., suitable for a particular dosage form. Remington's *The Science and Practice of Pharmacy*, 21st edition, ARGennaro (Lippincott, Williams & Wilkins, Baltimore, MD, 2006; incorporated herein by reference) discloses various excipients for formulating pharmaceutical compositions and their known preparation techniques. Unless any conventional excipient medium is incompatible with the substance or its derivatives by causing any undesirable biological effects or otherwise interacting in a harmful manner with any other component of the pharmaceutical composition, its use is contemplated within the scope of this disclosure.
[0687] In some embodiments, the excipient is approved for human and veterinary use. In some embodiments, the excipient is approved by the U.S. Food and Drug Administration. In some embodiments, the excipient is pharmaceutical grade. In some embodiments, the excipient complies with the standards of the United States Pharmacopeia (USP), the European Pharmacopoeia (EP), the British Pharmacopoeia, and / or the International Pharmacopoeia.
[0688] Pharmaceutically acceptable excipients used in the manufacture of pharmaceutical compositions include, but are not limited to, inert diluents, dispersants and / or granulators, surfactants and / or emulsifiers, disintegrants, binders, preservatives, buffers, lubricants and / or oils. Such excipients may optionally be included in the pharmaceutical formulation. Excipients such as cocoa butter and suppository waxes, colorants, coating agents, sweeteners, flavoring agents and / or aromatizers may be present in the composition at the discretion of the formulator.
[0689] General considerations in the formulation and / or manufacture of pharmaceutical preparations can be found, for example, in Remington: The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins, 2005 (incorporated herein by reference).
[0690] In some embodiments, the pharmaceutical compositions provided herein may be formulated according to conventional techniques such as those disclosed in Remington: The Science and Practice of Pharmacy, 21st edition, Lippincott Williams & Wilkins, 2005 (incorporated herein by reference), with one or more pharmaceutically acceptable carriers or diluents and any other known adjuvants and excipients.
[0691] The pharmaceutical compositions described herein may be administered by appropriate methods known in the art. As those skilled in the art will understand, the route and / or mode of administration may depend on many factors, including, but not limited to, the stability and / or pharmacokinetics and / or pharmacodynamics of the pharmaceutical compositions described herein.
[0692] In some embodiments, the pharmaceutical compositions described herein are formulated for parenteral administration, including administration methods typically by injection other than enteral and local administration, and including but not limited to intravenous, intramuscular, intra-arterial, intradermal, subcutaneous, subepidermal, or intra-articular injection and infusion. In preferred embodiments, the pharmaceutical compositions described herein are formulated for intravenous, intramuscular, or subcutaneous administration. In particularly preferred embodiments, the pharmaceutical compositions described herein are formulated for intramuscular administration.
[0693] In some embodiments, the pharmaceutical compositions described herein are formulated for intravenous administration. In some embodiments, pharmaceutically acceptable excipients suitable for intravenous administration include sterile aqueous solutions or dispersions and sterile powders for preparing sterile injectable solutions or dispersions.
[0694] Therapeutic compositions must generally be sterile and stable under manufacturing and storage conditions. Compositions can be formulated as solutions, microemulsions, lipid nanoparticles, or other ordered structures suitable for high drug concentrations. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Appropriate flowability can be maintained, for example, by using surfactants. In many cases, isotonic agents, such as sugars, polyols like mannitol, sorbitol, or sodium chloride, are preferably included in the composition. In some embodiments, prolonged absorption of the injectable composition can be achieved by including agents that delay absorption, such as monostearate and gelatin, in the composition.
[0695] Sterile injectable solutions can be prepared by incorporating the desired amount of the active compound with one or a combination of the ingredients listed above into a suitable solvent, followed by sterilization and / or microfiltration, as needed. In some embodiments, the pharmaceutical composition can be prepared as described herein and / or by methods known in the art. In some embodiments, the pharmaceutical composition includes ALC-0315; ALC-0159; DSPC; cholesterol; sucrose; NaCl; KCl; Na2HPO4; KH2PO4; and water for injection. In some embodiments, physiological saline (isotonic 0.9% NaCl) is used as a diluent.
[0696] These compositions may also contain adjuvants such as preservatives, wetting agents, emulsifiers, and dispersants. Prevention of microbial presence can be ensured simultaneously through sterilization procedures and by including various antibacterial and antifungal agents such as parabens, chlorobutanol, phenolic sorbic acid, etc. It may also be necessary to include isotonic agents such as sugars, sodium chloride, etc., in the pharmaceutical compositions described herein. Furthermore, prolonged absorption of injectable drug forms can be achieved by including agents that delay absorption, such as aluminum monostearate and gelatin.
[0697] The formulations of the pharmaceutical compositions described herein may be prepared by any method known in or subsequently developed in the field of pharmacological techniques. Generally, such preparation methods involve associating the active ingredient with a diluent or another excipient and / or one or more other auxiliary ingredients, and then, if necessary and / or required, shaping and / or packaging the product into desired single-dose or multi-dose units.
[0698] The pharmaceutical compositions according to this disclosure may be prepared, packaged, and / or sold in batches, as a single unit dose, and / or as multiple single unit doses. As used herein, "unit dose" means a discrete amount of a pharmaceutical composition comprising a predetermined amount of at least one RNA product produced using the systems and / or methods described herein.
[0699] The relative amounts of polynucleotides encapsulated in lipid nanoparticles, pharmaceutically acceptable excipients, and / or any additional ingredients in the pharmaceutical composition may vary depending on the subject to be treated, the target cells, the disease or condition, and may further depend on the route of administration of the composition.
[0700] In some embodiments, the pharmaceutical compositions described herein are formulated into pharmaceutically acceptable dosage forms using conventional methods known to those skilled in the art. The actual dose level of the active ingredient (e.g., a polynucleotide encapsulated in lipid nanoparticles) in the pharmaceutical compositions described herein can be varied to obtain an amount of active ingredient that effectively achieves the desired therapeutic response for a particular patient, composition, and administration mode, without toxicity to the patient. The selected dose level depends on a variety of pharmacokinetic factors, including the activity of the particular composition employed, route of administration, time of administration, excretion rate of the particular compound employed, duration of treatment, other drugs, compounds, and / or materials used in combination with the particular composition employed, the age, sex, weight, disease, general health condition, and prior medical history of the patient being treated, and similar factors well known in the medical technology.
[0701] Physicians with ordinary skills in the art can easily determine and prescribe an effective amount of the desired pharmaceutical composition. For example, a physician may start with a dose of the active ingredient (e.g., a polynucleotide encapsulated in lipid nanoparticles) used in the pharmaceutical composition at a level lower than required to achieve the desired therapeutic effect and gradually increase the dose until the desired effect is achieved.
[0702] In some embodiments, the pharmaceutical composition is formulated (e.g., but not limited to intravenous, intramuscular, or subcutaneous administration) to deliver a dose of about 5 mg RNA / kg.
[0703] In some embodiments, the pharmaceutical composition described herein may further comprise one or more additives, which, for example, in some embodiments, may enhance the stability of the composition under certain conditions. Examples of additives may include, but are not limited to, salts, buffering substances, preservatives, and carriers. For example, in some embodiments, the pharmaceutical composition may further comprise a cryoprotectant (e.g., sucrose) and / or an aqueous buffer solution, which may include one or more salts, including, for example, alkali metal salts or alkaline earth metal salts, such as, for example, sodium salts, potassium salts, and / or calcium salts.
[0704] In some embodiments, the pharmaceutical compositions provided herein are preservative-free, sterile RNA-lipid nanoparticle dispersions in an aqueous buffer solution for intravenous or intramuscular administration.
[0705] While the descriptions of pharmaceutical compositions provided herein are primarily directed toward those suitable for human administration, those skilled in the art will understand that such compositions are generally suitable for administration to all species of animals. It is well understood that pharmaceutical compositions suitable for human administration can be modified to be suitable for administration to a wide variety of animals, and that any modifications can be designed and / or performed by a reasonably skilled veterinary pharmacologist using only standard experimental methods, should any experiment be required.
[0706] A. Certain example pharmaceutical compositions
[0707] This document provides combinations comprising two or more polynucleotides as described herein. In some embodiments, the combination comprises three or more polynucleotides as described herein. In some embodiments, the combination comprises three polynucleotides as described herein.
[0708] This document also provides combinations comprising two or more pharmaceutical compositions, wherein each pharmaceutical composition comprises a polynucleotide as described herein.
[0709] This document provides combinations comprising two or more RNA constructs as described herein. In some embodiments, the combination comprises three or more RNA constructs as described herein. In some embodiments, the combination comprises three RNA constructs as described herein.
[0710] This article also provides combinations comprising two or more pharmaceutical compositions, each comprising an RNA construct as described herein.
[0711] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing a first polypeptide containing an HSV-2gC antigen or an antigen fragment thereof, and a second polynucleotide encoding a second polypeptide containing an HSV-2gD antigen or an antigen fragment thereof.
[0712] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing the HSV-2gC antigen and a second polynucleotide encoding a second polypeptide containing the HSV-2gD antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:70.
[0713] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising an HSV-2gC antigen or an antigen fragment thereof, and (ii) a second pharmaceutical composition comprising a second polynucleotide, wherein the second polynucleotide encodes a second polypeptide comprising an HSV-2gD antigen or an antigen fragment thereof.
[0714] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide encoding a first polypeptide containing the HSV-2gC antigen, and (ii) a second pharmaceutical composition comprising a second polynucleotide encoding a second polypeptide containing the HSV-2gD antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:70.
[0715] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing a first polypeptide containing an HSV-2gC antigen or an antigen fragment thereof, and a second polynucleotide encoding a second polypeptide containing an HSV-2gE antigen or an antigen fragment thereof.
[0716] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing the HSV-2gC antigen and a second polynucleotide encoding a second polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0717] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising an HSV-2gC antigen or an antigenic fragment thereof, and (ii) a second pharmaceutical composition comprising a second polynucleotide, wherein the second polynucleotide encodes a second polypeptide comprising an HSV-2gE antigen or an antigenic fragment thereof.
[0718] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide encoding a first polypeptide containing the HSV-2gC antigen, and (ii) a second pharmaceutical composition comprising a second polynucleotide encoding a second polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0719] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing a first polypeptide containing an HSV-2gD antigen or an antigen fragment thereof, and a second polynucleotide encoding a second polypeptide containing an HSV-2gE antigen or an antigen fragment thereof.
[0720] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing the HSV-2gD antigen and a second polynucleotide encoding a second polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:70. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0721] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising an HSV-2gD antigen or an antigenic fragment thereof, and (ii) a second pharmaceutical composition comprising a second polynucleotide, wherein the second polynucleotide encodes a second polypeptide comprising an HSV-2gE antigen or an antigenic fragment thereof.
[0722] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide encoding a first polypeptide containing the HSV-2gD antigen, and (ii) a second pharmaceutical composition comprising a second polynucleotide encoding a second polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:70. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0723] In some embodiments, the combination comprises a first polynucleotide encoding a first polypeptide containing a first polypeptide containing an HSV-2gC antigen or an antigen fragment thereof, a second polynucleotide encoding a second polypeptide containing an HSV-2gD antigen or an antigen fragment thereof, and a third polynucleotide encoding a third polypeptide containing an HSV-2gE antigen or an antigen fragment thereof.
[0724] In some embodiments, the combination comprises a first polynucleotide encoding a polypeptide containing the HSV-2gC antigen, a second polynucleotide encoding a polypeptide containing the HSV-2gD antigen, and a third polynucleotide encoding a third polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:70. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0725] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide, wherein the first polynucleotide encodes a first polypeptide comprising an HSV-2gC antigen or an antigen fragment thereof, (ii) a second pharmaceutical composition comprising a second polynucleotide, wherein the second polynucleotide encodes a second polypeptide comprising an HSV-2gD antigen or an antigen fragment thereof, and (iii) a third pharmaceutical composition comprising a third polynucleotide, wherein the third polynucleotide encodes a third polypeptide comprising an HSV-2gE antigen or an antigen fragment thereof.
[0726] In some embodiments, the combination comprises (i) a first pharmaceutical composition comprising a first polynucleotide encoding a first polypeptide containing the HSV-2gC antigen, (ii) a second pharmaceutical composition comprising a second polynucleotide encoding a second polypeptide containing the HSV-2gD antigen, and (iii) a third pharmaceutical composition comprising a third polynucleotide encoding a third polypeptide containing the HSV-2gE antigen. In some embodiments, the first polypeptide comprises the amino acid sequence according to SEQ ID NO:65. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:70. In some embodiments, the second polypeptide comprises the amino acid sequence according to SEQ ID NO:73.
[0727] In some embodiments, the polypeptide comprising the amino acid sequence according to SEQ ID NO:65 is encoded by the ribonucleic acid sequence according to SEQ ID NO:70. In some embodiments, the polypeptide comprising the amino acid sequence according to SEQ ID NO:73 is encoded by the ribonucleic acid sequence according to SEQ ID NO:73.
[0728] VI. Patient Group
[0729] In some aspects, the techniques of this disclosure are used for therapeutic and / or preventative purposes. In some embodiments, the techniques of this disclosure are used for treating and / or preventing HSV infection. The preventative purposes of this disclosure include pre-exposure prophylaxis and / or post-exposure prophylaxis.
[0730] In some embodiments, the techniques disclosed herein are used to treat and / or prevent conditions associated with this HSV (e.g., HSV-1 and / or HSV-2) infection. Conditions associated with this HSV (e.g., HSV-1 and / or HSV-2) infection include, for example, typical symptoms and / or complications of HSV (e.g., HSV-1 and / or HSV-2) infection.
[0731] In some embodiments, the provided composition (e.g., which is or contains HSV antigen, HSV gC, gD and / or gE antigen, such as HSV-2 gC, gD and / or gE antigen) may be suitable for detecting and / or characterizing one or more features of an anti-HSV (e.g., anti-HSV-1 and / or anti-HSV-2) immune response (e.g., by detecting the binding of serum from an infected subject to the provided antigen).
[0732] In some embodiments, the provided composition (e.g., which is or contains HSV antigen, HSV gC, gD and / or gE antigen, such as HSV-1 gC, gD and / or gE antigen) is suitable for generating antibodies against one or more epitopes contained therein; such antibodies may be suitable on their own for, for example, detecting or treating HSV infection.
[0733] This disclosure provides the use of encoding nucleic acids (e.g., DNA or RNA) to produce encoded antigens and / or the use of DNA constructs to produce RNA.
[0734] In some implementations, the technology of this disclosure is used in an unrestricted group of subjects; in other implementations, the technology of this disclosure is used in a specific group of subjects.
[0735] In some implementations, the subject population includes an adult population. In some implementations, the adult population includes subjects aged approximately 18 to approximately 55 years (e.g., approximately 19, 20, 25, 30, 35, 40, 45, 50, 51, 52, 53, 54, or 55 years).
[0736] In some implementations, the subject population includes an older population. In some implementations, the older population includes subjects who are approximately 56 years old, approximately 60 years old, approximately 70 years old, or older (e.g., approximately 60, 65, 70, 75, 80, 85, 90, 95, or 100 years old).
[0737] In some implementations, the subject has a weight of at least about 50 kg. In some implementations, the subject has a weight of at least about 51 kg (e.g., about 52, 53, 54, 55, 56, 57, 58, 59, or 60 kg).
[0738] In some implementation schemes, the subject has approximately 17.5 kg / m². 2 Approximately 37 kg / m 2 Such as approximately 18 kg / m 2 Approximately 36 kg / m 2 For example, approximately 18.5 kg / m 2 Approximately 35 kg / m 2Body mass index (BMI) within a certain range. In some implementations, the subject has a minimum weight of 17 kg / m². 2 Such as at least 17.5 kg / m 2 Such as at least 18kg / m 2 Such as at least 18.5 kg / m 2 BMI. In some implementations, subjects have a BMI of up to 40 kg / m². 2 Such as up to 39kg / m 2 Such as up to 38kg / m 2 Such as up to 37kg / m 2 Such as up to 36kg / m 2 Such as up to 35kg / m 2 BMI.
[0739] In some implementations, the subject population includes a pediatric group. In some implementations, the pediatric group includes subjects who are approximately 18 years of age or younger. In some such implementations, the pediatric group includes subjects who are between approximately 1 year of age and approximately 18 years of age (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 years of age).
[0740] In some embodiments, the subject population includes a neonatal population. In some embodiments, the neonatal population includes subjects approximately 12 months of age or younger (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 months or younger). In some embodiments, the subject population to be treated with the technology described herein includes infants whose mothers did not receive such technology during pregnancy (e.g., approximately 12 months of age or younger). In some implementations, the subject population to be treated with the technology described herein may include pregnant women; in some implementations, infants whose mothers were treated with the disclosed technology during pregnancy (e.g., receiving at least one dose, or alternatively only two doses) were not vaccinated during the first few weeks, months, or even years after birth (e.g., 1, 2, 3, 4, 5, 6, 7, 8 weeks or longer, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 months or longer, or 1, 2, 3, 4, 5 years or longer). Alternatively or additionally, in some embodiments, infants whose mothers were treated with the disclosed technique during pregnancy (e.g., received at least one dose, or alternatively, only two doses) may receive reduced treatment with the disclosed technique (e.g., lower doses and / or fewer administrations, such as boosters and / or lower total exposure, over a given period) or may require reduced vaccinations (e.g., lower doses and / or fewer administrations, such as boosters, over a given period) during the first few weeks, months, or even years after birth (e.g., 1, 2, 3, 4, 5, 6, 7, 8 weeks or longer, or 1, 2, 3, 4, 5, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 months or longer, or 1, 2, 3, 4, 5 years or longer) during the first few weeks, months, or even years after birth, such as the first few weeks, months, or even years after birth). In some embodiments, the administration of the compositions provided herein does not include a subject population of pregnant women.
[0741] In some implementation schemes, the subject population consists of or includes children aged 6 weeks to up to 17 months.
[0742] In some embodiments, the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be administered in combination with another pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) or a therapeutic intervention (i.e., to expose the subject to both simultaneously) in order to, for example, treat or prevent HSV infection, or another disease, condition or disorder.
[0743] In some embodiments, the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be administered together with a protein vaccine, DNA vaccine, RNA vaccine, cell vaccine, conjugate vaccine, etc. In some embodiments, one or more doses of the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be administered together (e.g., in a single visit) with another vaccine or other therapy.
[0744] In some embodiments, the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be administered to subjects who have been exposed to, or are expected to be exposed to, HSV (e.g., HSV-1 and / or HSV-2). In some embodiments, the provided pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) may be administered to subjects who do not have symptoms of HSV (e.g., HSV-1 and / or HSV-2).
[0745] In some embodiments, the subject has no prior history of known or suspected herpes simplex vaccination prior to administration of one or more doses of the composition disclosed herein.
[0746] In some embodiments, the subject does not have a feverish illness prior to administration of one or more doses of the composition disclosed herein. In some embodiments, the subject does not have a feverish illness for about 72 hours, about 48 hours, about 36 hours, about 24 hours, or about 12 hours prior to administration of one or more doses of the composition disclosed herein.
[0747] In some embodiments, the subject does not have an acute illness prior to administration of one or more doses of the composition disclosed herein. In some embodiments, the subject does not have an acute illness for about 72 hours, about 48 hours, about 36 hours, about 24 hours, or about 12 hours prior to administration of one or more doses of the composition disclosed herein.
[0748] In some embodiments, the subject did not receive the vaccine for 0 to 300 days, 0 to 290 days, 0 to 280 days, 0 to 270 days, 0 to 260 days, 0 to 250 days, 0 to 240 days, 0 to 230 days, 0 to 220 days, 0 to 210 days, 0 to 200 days, 0 to 190 days, 0 to 180 days, 0 to 170 days, 0 to 160 days, 0 to 150 days, 0 to 140 days, 0 to 130 days, 0 to 120 days, 0 to 110 days, 0 to 100 days, 0 to 90 days, 0 to 80 days, 0 to 70 days, 0 to 60 days, 0 to 50 days, 0 to 40 days, 0 to 35 days, 0 to 30 days, 0 to 29 days, or 0 to 28 days prior to administration of a therapeutically effective amount of one or more of the compositions disclosed herein. In some embodiments, the subject did not receive the vaccine for approximately 7, 14, 21, 28, 35, 42, 49, 56, 60, 70, 80, 90, 100, 125, 150, 175, 190, 200, 210, or 210 days prior to administration of a therapeutically effective amount of one or more of the compositions disclosed herein. In some embodiments, the vaccine is not a seasonal influenza vaccine or a medically indicated vaccine.
[0749] In some embodiments, the subject has not received a vaccine for at least 2 to 35 weeks, at least 3 to 34 weeks, or at least 4 to 33 weeks after administration of a therapeutically effective dose of one or more doses of a composition disclosed herein. In some embodiments, the subject has not received a vaccine for at least about 2 weeks, at least about 4 weeks, at least about 6 weeks, at least about 8 weeks, at least about 10 weeks, at least about 12 weeks, at least about 14 weeks, at least about 16 weeks, at least about 18 weeks, at least about 20 weeks, at least about 22 weeks, at least about 24 weeks, at least about 26 weeks, at least about 28 weeks, or at least about 30 weeks after administration of a therapeutically effective dose of one or more doses of a composition disclosed herein. In some embodiments, the vaccine is not a seasonal influenza vaccine or a medically indicated vaccine.
[0750] In some embodiments, the subject did not receive blood, plasma products, or immunoglobulins for about 0 to 600 days, about 0 to 590 days, about 0 to 580 days, about 0 to 570 days, about 0 to 560 days, about 0 to 550 days, or about 0 to 545 days prior to administration of one or more doses of the therapeutically effective composition disclosed herein.
[0751] In some embodiments, the subject has not received allergy treatment for 8 to 45 days, 12 to 40 days, 16 to 38 days, 21 to 35 days, 23 to 32 days, 25 to 30 days, or 26 to 29 days prior to administration of one or more doses of a therapeutically effective amount of the composition disclosed herein. In some embodiments, the subject has not received allergy treatment for about 14 days, about 16 days, about 18 days, about 20 days, about 22 days, about 24 days, about 26 days, or about 28 days prior to administration of one or more doses of a therapeutically effective amount of the composition disclosed herein. In some embodiments, allergy treatment includes antigen injection.
[0752] In some embodiments, the subject did not receive an immunosuppressive drug for 7 to 56 days, 14 to 56 days, 21 to 56 days, 28 to 56 days, 35 to 56 days, 42 to 56 days, 49 to 56 days, 7 to 49 days, 14 to 49 days, 21 to 49 days, 28 to 49 days, 35 to 49 days, 42 to 49 days, 7 to 42 days, 14 to 42 days, 21 to 42 days, 28 to 42 days, 35 to 42 days, 7 to 35 days, 14 to 35 days, 21 to 35 days, 28 to 35 days, 7 to 28 days, 14 to 28 days, 21 to 28 days, 7 to 21 days, 14 to 21 days, or 7 to 14 days prior to administration of a therapeutically effective amount of one or more doses of the compositions disclosed herein. In some embodiments, the subject has not received an immunosuppressive drug for about 7 days, about 14 days, about 21 days, about 28 days, about 35 days, about 42 days, about 49 days, or about 56 days prior to administration of a therapeutically effective amount of one or more doses of the compositions disclosed herein. In some embodiments, the subject has not received an immunosuppressive drug for about 28 days prior to administration of a therapeutically effective amount of one or more doses of the compositions disclosed herein.
[0753] In some embodiments, the immunosuppressive drug comprises systemic corticosteroids or radiation therapy. In some embodiments, the systemic corticosteroid is selected from, but is not limited to, methylprednisolone, dexamethasone, hydrocortisone, prednisone, prednisolone, fluticasone, flumethasone, fluocinolone, budesonide, beclomethasone, ciclesonide, cortisone, triamcinolone, betamethasone, and diffusion. Deflazacort, difluprednate, loteprednol, paramethasone, tixocortol, aldosterone, cloprednol, cortivazol, deoxycorticosterone, desonide, desoximetasone, difluorocortolone, fluclorolone, fludrocortisone, flunisolide, fluocinonide, fluocortin ester butyl), fluorocortisone, fluorocortolone, fluorometholone, flurandrenolone, halcinonide, icomethasone, meprednisone, mometasone, rofleponide, RPR 106541 and their corresponding pharmaceutically acceptable derivatives,Such as beclomethasone dipropionate (anhydrous or monohydrate), beclomethasone monopropionate, dexamethasone 21-isonicotinic acid ester, fluticasone propionate, icomethasone enbutate, tecortisone 21-pentavalate, triamcinolone acetonide, and their pharmaceutically acceptable salts and / or derivatives. In some embodiments, the corticosteroid is prednisone.
[0754] In some embodiments, the subject did not receive prophylactic antipyretics and / or analgesics for 0 to 600 days, 0 to 550 days, 0 to 500 days, 0 to 500 days, 0 to 450 days, 0 to 400 days, 0 to 350 days, 0 to 300 days, 0 to 250 days, 0 to 200 days, 0 to 150 days, 0 to 150 days, or 0 to 50 days prior to administration of one or more doses of the compositions disclosed herein.
[0755] In some implementations, the prophylactic antipyretic drug is selected from, but is not limited to, acetaminophen, nonsteroidal anti-inflammatory drugs (NSAIDs), salicylamide, salicylsalicylate, methyl salicylate, magnesium salicylate, faislamine, ethylsalicylate, diflunisal, choline magnesium salicylate, benorylate / benorilatem, amoxicillin, acetylsalicylate, ceclofenac, acemetacin, alclofenac, bromfenac, diclofenac, etodolac, indomethacin, nabumetone, oxametacin, proglumetacin, and solanine. Sulindac, Tolmetin, Iminoprofen, Benoxaprofen, Carprofen, Dexbuprofen, Dexketoprofen, Fenbufen, Fenoprofen, Flunoxaprofen, Flurbiprofen, Ibuprofen, Ibuproxam, Indoprofen, Ketoprofen, Ketoprofen, Ketorolac, Loxoprofen, Naproxen, Oxaprozin, Pirprofen, Suprofen, Tiaprofenic acid acid), mefenamic acid, flufenamic acid, meclofenamic acid, tolfenamic acidThe following are listed: acid, droxicam, lornoxicam, meloxicam, piroxicam, tenoxicam, dipyrone, azapropazone, clofezone, kebuzone, metamizole, mofebutazone, oxyphenbutazone, phenazone, phenylbutazone, sulfinpyrazone, decoxib, rofecoxib, parecoxib, and etoricoxib.
[0756] In some implementations, the preventative analgesic is selected from, but not limited to, acetaminophen, salicylamide, salicylsalicylate, methyl salicylate, magnesium salicylate, phensamide, ethylsalicylate, diflunisal, choline magnesium salicylate, benorilate / benoratadine and amoxicillin, acetylsalicylate, acetylclofenac, asimexin, alclofenac, bromofenac, diclofenac, etodoxacin, indomethacin, nabumetone, oxamexin, propylgammadex, sulindac, tometine, amioprofen, benzylprofen, carboprofen, dextro-ibuprofen, and dextro-ibuprofen. Ketoprofen, fenbufen, fenoprofen, flunoprofen, flurbiprofen, ibuprofen, isobutylproxen, indoprofen, ketoprofen, ketoroxyprofen, loxoprofen, naproxen, oxapazol, piroctone sulfamethoxazole, sulprofen, tiprofenicol, mefenamic acid, flufenamic acid, meclofenamic acid, tofenamic acid, droxoxicam, lornoxicam, meloxicam, piroxicam, tenoxicam, metamizole, azapril, chlorpheniramine, ketophenylbutazone, midazolam, mupirocin, hydroxybutanol, antipyrine, phenylbutazone, sulfinpyrazone, decoxib, rofecoxib Parecoxib, etoricoxib, codeine, dihydrocodeine, morphine or a morphine derivative thereof or a pharmaceutically acceptable salt thereof, diacetylmorphine, hydrocodone, hydromorphone, levorphanol, oxymorphone, alfentanil, buprenorphine, butorphanol, fentanyl, sufentanil, meperidine, methadone, nalbuphine, propoxyphene, pentazocine and pharmaceutically acceptable salts thereof.
[0757] VII. Treatment Methods
[0758] In some embodiments, the techniques of this disclosure can be administered to a subject according to a specific dosing regimen. In some embodiments, the dosing regimen may involve a single administration; in some embodiments, the dosing regimen may include one or more “boost” administrations following an initial administration. In some embodiments, the initial dose and the booster dose are the same amount; in some embodiments, they are different. In some embodiments, two or more booster doses are administered. In some embodiments, multiple doses are administered at prescribed intervals. In some embodiments, the time interval between doses becomes longer. In some embodiments, one or more subsequent doses are administered if a specific clinical (e.g., a decrease in neutralizing antibody levels) or condition (e.g., local development of a new strain) event occurs or is detected.
[0759] In some embodiments, the administered pharmaceutical composition (e.g., an immunogenic composition, such as a vaccine) comprising an RNA construct encoding an HSV-2 gC, gD, and / or gE construct is administered at an RNA dose of about 0.1 μg to about 300 μg, about 0.5 μg to about 200 μg, or about 1 μg to about 100 μg, such as about 1 μg, about 3 μg, about 10 μg, about 30 μg, about 50 μg, or about 100 μg. In some embodiments, the saRNA construct is administered at a lower dose than the modRNA or uRNA construct (e.g., 1 / 2, 1 / 4, 1 / 5, 1 / 10, or lower).
[0760] In some embodiments, the first booster dose is administered approximately six months after the initial dose, and preferably approximately 5, 4, 3, 2, or 1 month later. In some embodiments, the first booster dose is initiated approximately 1, 2, 3, or 4 weeks after the first dose and administered within a timeframe of approximately 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 weeks after the first dose (e.g., between approximately 1 and approximately 12 weeks after the first dose, or between approximately 2 or 3 weeks and approximately 5 and 6 weeks after the first dose, or approximately 3 or approximately 4 weeks after the first dose).
[0761] In some implementations, multiple booster doses (e.g., 2, 3, or 4) are administered within 6 months of the first dose or within 12 months of the first dose.
[0762] In some embodiments, three or fewer doses are required to achieve effective vaccination (e.g., greater than 60%, and in some embodiments greater than about 70%, about 75%, about 80%, about 85%, about 90%, or more) to reduce the risk of infection or serious illness. In some embodiments, no more than two doses are required. In some embodiments, a single dose is sufficient. In some embodiments, the RNA dose is about 60 μg or less, 50 μg or less, 40 μg or less, 30 μg or less, 20 μg or less, 10 μg or less, 5 μg or less, 2.5 μg or less, or 1 μg or less. In some embodiments, the RNA dose is about 0.25 μg, at least 0.5 μg, at least 1 μg, at least 2 μg, at least 3 μg, at least 4 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, or at least 40 μg. In some embodiments, RNA doses may be administered in doses of approximately 0.25 μg to 60 μg, 0.5 μg to 55 μg, 1 μg to 50 μg, 5 μg to 40 μg, or 10 μg to 30 μg per dose. In some embodiments, the RNA dose is approximately 30 μg. In some embodiments, at least two such doses are administered. For example, a second dose may be administered approximately 21 days after the first dose. In some embodiments, a first booster dose is administered approximately one month after the initial dose. In some such embodiments, at least another booster is administered at one-month intervals. In some embodiments, after two or three boosters, longer intervals are introduced and no further boosters are administered for at least 6, 9, 12, 18, 24, or more months. In some embodiments, a single further booster is administered approximately 18 months later. In some embodiments, further boosters are not required unless, for example, a significant change in clinical or environmental condition is observed.
[0763] VIII. Manufacturing Method
[0764] Individual polynucleotides can be produced by methods known in the art. For example, in some embodiments, polynucleotides can be produced, for instance, by in vitro transcription using a DNA template. Plasmid DNA used as a template for in vitro transcription to produce the polynucleotides described herein is also within the scope of this disclosure.
[0765] A DNA template is used for in vitro RNA synthesis in the presence of a suitable RNA polymerase (e.g., a recombinant RNA polymerase such as T7 RNA polymerase) and a ribonucleotide triphosphate (e.g., ATP, CTP, GTP, UTP). In some embodiments, polynucleotides (e.g., those described herein) may be synthesized in the presence of a modified ribonucleotide triphosphate. By way of example only, in some embodiments, pseudouridine (ψ), N1-methyl-pseudouridine (m1ψ), or 5-methyl-uridine (m5U) may be used to replace uridine triphosphate (UTP). In some embodiments, pseudouridine (ψ) may be used to replace uridine triphosphate (UTP). In some embodiments, N1-methyl-pseudouridine (m1ψ) may be used to replace uridine triphosphate (UTP). In some embodiments, 5-methyl-uridine (m5U) may be used to replace uridine triphosphate (UTP).
[0766] As will be apparent to those skilled in the art, during in vitro transcription, RNA polymerases (e.g., as described and / or used herein) typically pass through at least a portion of a single-stranded DNA template in the 3'→5' direction to produce single-stranded complementary RNA in the 5'→3' direction.
[0767] In some embodiments in which the polynucleotide contains a polyA tail, those skilled in the art will understand that this polyA tail can be encoded in a DNA template, for example by using appropriate tailing PCR primers, or it can be added to the polynucleotide after in vitro transcription, for example by enzymatic treatment (e.g., using a poly(A) polymerase such as E. coli poly(A) polymerase). Suitable poly(A) tails are described herein as above. For example, in some embodiments, the poly(A) tail contains the nucleotide sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAGCATATGACTAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (SEQ ID NO:153). In some embodiments, the poly(A) tail contains multiple A residues interrupted by a linker. In some embodiments, the linker contains the nucleotide sequence GCATATGAC (SEQ ID NO:154).
[0768] In some embodiments, those skilled in the art will understand that adding a 5' cap to RNA (e.g., mRNA) can facilitate recognition and ligation of RNA to the ribosome to initiate translation and enhance translation efficiency. Those skilled in the art will also understand that a 5' cap can also protect RNA products from 5' exonuclease-mediated degradation and thereby increase half-life. Capping methods are known in the art; those skilled in the art will understand that in some embodiments, capping can be performed after in vitro transcription in the presence of a capping system (e.g., an enzyme-based capping system such as, for example, a capping enzyme of vaccinia virus). In some embodiments, the cap can be introduced during in vitro transcription along with multiple ribonucleotide triphosphates such that the cap is incorporated into the polynucleotide during transcription (also known as co-transcriptional capping). In some embodiments, a feed-by-feed procedure with multiple additions of GTP during the reaction can be used to maintain a low concentration of GTP for efficient RNA capping. Suitable 5' caps are described herein. For example, in some embodiments, the 5' cap comprises m7(3'OMeG)(5')ppp(5')(2'OMeA)pG.
[0769] Following RNA transcription, the DNA template is digested. In some implementations, digestion can be achieved under appropriate conditions using DNase I.
[0770] In some embodiments, the polynucleotide transcribed in vitro can be provided in a buffer solution, such as a buffer such as HEPES, phosphate buffer, citrate buffer, or acetate buffer; in some embodiments, this solution can be buffered to, for example, a pH in the range of about 6.5 to about 7.5; in some embodiments, a pH of about 7.0. In some embodiments, the production of the polynucleotide may further include one or more of the following steps: purification, mixing, filtration, and / or filling.
[0771] In some embodiments, polynucleotides may be purified (e.g., in some embodiments, after an in vitro transcription reaction), for example, to remove components used or formed during the production process, such as, for example, proteins, DNA fragments, and / or nucleotides. Various nucleic acid purifications known in the art may be used according to this disclosure. Certain purification steps may be, or include, one or more of, for example, precipitation, column chromatography (including, for example, but not limited to, anion exchange, cation exchange, hydrophobic interaction chromatography (HIC)), and solid-substrate-based purification (e.g., magnetic bead-based purification). In some embodiments, polynucleotides may be purified using magnetic bead-based purification, which in some embodiments may be, or include, magnetic bead-based chromatography. In some embodiments, polynucleotides may be purified using hydrophobic interaction chromatography (HIC) and / or percolation. In some embodiments, polynucleotides may be purified using HIC followed by percolation.
[0772] In some embodiments, dsRNA may be obtained as a byproduct during in vitro transcription. In some such embodiments, a second purification step may be performed to remove dsRNA contamination. For example, in some embodiments, cellulose materials (e.g., microcrystalline cellulose) may be used, for instance, by chromatography to remove dsRNA contamination. In some embodiments, the cellulose material (e.g., microcrystalline cellulose) may be pretreated to inactivate potential RNase contamination, for example, by autoclaving followed by incubation with an aqueous alkaline solution such as NaOH. In some embodiments, the cellulose material may be used to purify polynucleotides according to the method described in WO 2017 / 182524, the entire contents of which are incorporated herein by reference.
[0773] In some embodiments, the batch of polynucleotides may be further processed by one or more filtration and / or concentration steps. For example, in some embodiments, after removing dsRNA contamination, one or more polynucleotides may be further subjected to osmosis (e.g., tangential flow filtration in some embodiments) to adjust the concentration of the polynucleotides to a desired RNA concentration and / or replace the buffer with a drug substance buffer.
[0774] In some implementations, the polynucleotides may be processed via 0.2 μm filtration and then filled into appropriate containers.
[0775] In some embodiments, polynucleotides and compositions thereof may be manufactured according to processes as described herein or as otherwise known in the art.
[0776] In some embodiments, polynucleotides and compositions thereof can be manufactured on a large scale. For example, in some embodiments, batches of polynucleotides can be manufactured in quantities greater than 1g, greater than 2g, greater than 3g, greater than 4g, greater than 5g, greater than 6g, greater than 7g, greater than 8g, greater than 9g, greater than 10g, greater than 15g, greater than 20g, or higher.
[0777] In some embodiments, RNA quality control may be performed and / or monitored at any time during the production process of polynucleotides and / or compositions comprising them. For example, in some embodiments, RNA quality control parameters including one or more of RNA characteristics (e.g., sequence, length, and / or RNA properties), RNA integrity, RNA concentration, residual DNA template, and residual dsRNA may be assessed and / or monitored after each or some steps of the polynucleotide manufacturing process, such as after in vitro transcription, and / or after each purification step.
[0778] In some embodiments, the stability of polynucleotides (e.g., produced by in vitro transcription) and / or compositions containing polynucleotides can be evaluated over a period of time (e.g., at least 3 months, at least 6 months, at least 9 months, at least 12 months, or longer) under various test storage conditions, such as at room temperature versus a refrigerator or sub-zero temperature. In some embodiments, polynucleotides (e.g., those described herein) and / or compositions thereof can be stably stored at refrigerator temperatures (e.g., from about 4°C to about 10°C) for at least 1 month or longer, including at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 7 months, at least 8 months, at least 9 months, at least 10 months, at least 11 months, or at least 12 months or longer. In some embodiments, polynucleotides (e.g., those described herein) and / or combinations thereof are stably stored at sub-zero temperatures (e.g., -20°C or below) for at least one month or longer, including at least two months, at least three months, at least four months, at least five months, at least six months, at least seven months, at least eight months, at least nine months, at least ten months, at least eleven months, or at least twelve months or longer. In some embodiments, polynucleotides (e.g., those described herein) and / or combinations thereof are stably stored at room temperature (e.g., at about 25°C) for at least one month or longer.
[0779] In some implementations, one or more evaluation methods (e.g., as a release test) may be used during the manufacture or other preparation or use of the polynucleotide.
[0780] In some embodiments, one or more quality control parameters may be evaluated to determine whether the polynucleotides described herein meet or exceed acceptance criteria (e.g., for subsequent formulation and / or release for dispensing). In some embodiments, such quality control parameters may include, but are not limited to, RNA integrity, RNA concentration, residual DNA template, and / or residual dsRNA. Certain methods for assessing RNA quality are known in the art; for example, those skilled in the art will recognize that in some embodiments, one or more analytical tests may be used for RNA quality assessment. Examples of such analytical tests may include, but are not limited to, gel electrophoresis, UV absorption, and / or PCR assays.
[0781] In some implementations, the batch of polynucleotides may be evaluated for one or more characteristics as described herein to determine subsequent processing steps. For example, if an RNA quality assessment indicates that the batch of polynucleotides meets or exceeds relevant acceptance criteria, this batch of polynucleotides may be designated for one or more further manufacturing and / or formulation and / or dispensing steps. Otherwise, if the batch of polynucleotides does not meet or exceeds acceptance criteria, alternative actions may be taken (e.g., discarding the batch).
[0782] In some implementations, batches of polynucleotides that meet the evaluation results can be used for one or more further manufacturing and / or formulation and / or dispensing steps.
[0783] IX. DNA Construct
[0784] This disclosure particularly provides DNA constructs that, for example, encode one or more antibody agents or components thereof as described herein. In some embodiments, the DNA constructs provided by and / or used according to this disclosure are contained in a vector.
[0785] Non-limiting examples of vectors include plasmid vectors, granular vectors, phage vectors such as λ phage, viral vectors such as retroviruses, adenoviruses, or baculovirus vectors, or artificial chromosome vectors such as bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), or P1 artificial chromosomes (PACs). In some embodiments, the vector is an expression vector. In some embodiments, the vector is a cloning vector. Generally, a vector is a nucleic acid construct that can be acceptablely or otherwise linked to a nucleic acid component of interest (e.g., a construct that serves as or encodes a payload, or confers a specific function, etc.).
[0786] Expression vectors, which may be plasmids, viruses, or other vectors, typically include an expressible sequence of interest (e.g., a coding sequence) functionally linked to one or more control components (e.g., promoters, enhancers, transcription terminators, etc.). Typically, such control components are selected for expression in the system of interest. In some embodiments, the system is ex vivo (e.g., an in vitro transcription system); in other embodiments, the system is in vivo (e.g., bacteria, yeast, plants, insects, fish, vertebrates, mammalian cells or tissues, etc.).
[0787] Cloning vectors are generally used for modification, engineering, and / or replication (e.g., in vivo replication, such as in simple systems like bacteria or yeast, or in vitro replication, such as by amplification of polymerase chain reaction or other amplification processes). In some embodiments, the cloning vector may lack an expression signal.
[0788] In many embodiments, the vector may include replication components such as primer binding sites and / or origins of replication. In many embodiments, the vector may include insertion or modification sites such as restriction endonuclease recognition sites and / or guide RNA binding sites.
[0789] In some embodiments, the vector is a viral vector (e.g., an AAV vector). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a plasmid.
[0790] Those skilled in the art will recognize a variety of techniques suitable for producing recombinant polynucleotides (e.g., DNA or RNA) as described herein. For example, restriction digestion, reverse transcription, amplification (e.g., by polymerase chain reaction), Gibson assembly, and the like are long-established and useful tools and techniques. Alternatively or additionally, certain nucleic acids may be prepared or assembled by chemical and / or enzymatic synthesis. In some embodiments, a combination of known methods is used to prepare recombinant polynucleotides.
[0791] In some embodiments, the polynucleotides of this disclosure are contained in a DNA construct (e.g., a vector) suitable for transcription and / or translation.
[0792] In some embodiments, the expression vector comprises a polynucleotide encoding a protein and / or polypeptide disclosed herein, operably linked to one or more sequences controlling expression (e.g., promoters, start signals, stop signals, polyadenylation signals, activators, inhibitors, etc.). In some embodiments, one or more sequences controlling expression are selected to achieve a desired expression level. In some embodiments, more than one sequence controlling expression (e.g., promoters) is used. In some embodiments, more than one sequence controlling expression (e.g., promoters) is used to achieve desired expression levels of multiple polynucleotides encoding multiple proteins and / or polypeptides. In some embodiments, multiple recombinant proteins and / or polypeptides are expressed from the same vector (e.g., bicistronic, tricistronic, polycistronic). In some embodiments, multiple polypeptides are expressed, each expressed from a separate vector.
[0793] In some embodiments, the expression vector containing the polynucleotides of this disclosure is used to produce RNA and / or proteins and / or peptides in a host cell. In some embodiments, the host cell may be in vitro (e.g., a cell line), such as cells or cell lines suitable for producing the polynucleotides of this disclosure and proteins and / or peptides encoded by said polynucleotides (e.g., human embryonic kidney (HEK cells), Chinese hamster ovary cells, etc.).
[0794] In some embodiments, the expression vector is an RNA expression vector. In some embodiments, the RNA expression vector contains a polynucleotide template for generating RNA in a cell-free enzymatic mixture. In some embodiments, the RNA expression vector containing the polynucleotide template is enzymatically linearized prior to in vitro transcription. In some embodiments, the polynucleotide template is generated via PCR as a linear polynucleotide template. In some embodiments, the linearized polynucleotide is mixed with an enzyme suitable for RNA synthesis, RNA capping, and / or purification. In some embodiments, the resulting RNA is suitable for generating proteins encoded by the RNA.
[0795] Various methods for introducing expression vectors into host cells are known in the art. In some embodiments, the vector may be introduced into the host cell using transfection. In some embodiments, transfection is performed, for example, using calcium phosphate transfection, lipid transfection, or polyethyleneimine-mediated transfection. In some embodiments, the vector may be introduced into the host cell using transduction.
[0796] In some embodiments, after the vector is introduced into the host cell, the transformed host cell is cultured to allow expression of the recombinant polynucleotide. In some embodiments, the transformed host cell is cultured for at least 12, 16, 20, 24, 28, 32, 36, 40, 44, 48, 52, 56, 60, 64, 68, 72 hours, or longer. The transformed host cell is cultured under growth conditions (e.g., temperature, carbon dioxide level, growth medium) required by the selected host cell. Those skilled in the art will recognize that the culture conditions for the selected host cell are well known in the art.
[0797] X. Dosage regimen
[0798] In some embodiments, this disclosure provides a method for treating or preventing herpes simplex virus (HSV) infection, comprising administering a therapeutically effective amount of the composition to a subject in need during a treatment cycle comprising one or more doses (e.g., one, two, three, four, five, six, seven, eight, nine, or ten doses) of the composition disclosed herein. In some embodiments, the treatment cycle comprises two or more doses of the composition (e.g., two, three, four, five, six, seven, eight, nine, or ten doses). In some embodiments, the treatment cycle comprises two doses. In some embodiments, the first dose is an initiating dose of the composition disclosed herein. In some embodiments, the second dose is a booster dose of the composition disclosed herein.
[0799] In some embodiments, one or more doses of the composition disclosed herein are administered to a subject prior to infection with HSV (e.g., HSV-1, HSV-2, or a combination thereof). In some embodiments, two or more doses of the composition disclosed herein are administered to a subject prior to infection with HSV (e.g., HSV-1, HSV-2, or a combination thereof). In some embodiments, three or more doses of the composition disclosed herein are administered to a subject prior to infection with HSV (e.g., HSV-1, HSV-2, or a combination thereof).
[0800] In some embodiments, after administering a therapeutically effective amount of the composition disclosed herein to a subject, the treatment duration is 1 day to 24 weeks, 3.5 days to 24 weeks, 1 week to 24 weeks, 2 weeks to 24 weeks, 4 weeks to 24 weeks, 6 weeks to 24 weeks, 8 weeks to 24 weeks, 10 weeks to 24 weeks, 12 weeks to 24 weeks, 16 weeks to 24 weeks, 20 weeks to 24 weeks, 1 day to 20 weeks, 3.5 days to 20 weeks, 1 to 20 weeks, 2 to 20 weeks, 4 to 20 weeks, 6 to 20 weeks, 8 to 20 weeks, 10 to 20 weeks, 12 to 20 weeks, 16 to 20 weeks, 1 day to 16 weeks, 3.5 days to 16 weeks, 1 week to 16 weeks, 2 weeks to 16 weeks, 4 weeks to 16 weeks, 6 weeks to 16 weeks, 8 weeks to 16 weeks, 10 weeks to 16 weeks, 12 weeks to 16 weeks, 1 day to 1 2 weeks, 3.5 days to 12 weeks, 1 week to 12 weeks, 2 weeks to 12 weeks, 4 weeks to 12 weeks, 6 weeks to 12 weeks, 8 weeks to 12 weeks, 10 weeks to 12 weeks, 1 day to 10 weeks, 3.5 days to 10 weeks, 1 week to 10 weeks, 2 weeks to 10 weeks, 4 weeks to 10 weeks, 6 weeks to 10 weeks, 8 weeks to 10 weeks, 1 day to 8 weeks, 3.5 days to 8 weeks, 1 week to 8 weeks, 2 weeks to 8 weeks, 4 A second dose of the composition is administered to the subject at intervals of 1 to 8 weeks, 6 to 8 weeks, 1 day to 6 weeks, 3.5 days to 6 weeks, 1 week to 6 weeks, 2 weeks to 6 weeks, 4 weeks to 6 weeks, 1 day to 4 weeks, 3.5 days to 4 weeks, 1 week to 4 weeks, 2 weeks to 4 weeks, 1 day to 2 weeks, 3.5 days to 2 weeks, 1 week to 2 weeks, 1 day to 1 week, 3.5 days to 1 week, or 1 day to 3.5 days. In some embodiments, a second dose of the composition is administered to the subject at intervals of 1 to 14 weeks after administration of a first dose of the composition disclosed herein at a therapeutically effective amount. In some embodiments, a second dose of the composition is administered to the subject at intervals of 4 to 12 weeks after administration of a first dose of the composition disclosed herein at a therapeutically effective amount. In some embodiments, a second dose of the composition is administered to the subject at intervals of 6 to 10 weeks after administration of a first dose of the composition disclosed herein at a th...
Claims
1. A combination comprising: Polynucleotides encoding HSV glycoprotein C (gC) antigen or its antigenic fragment, polynucleotides encoding HSV glycoprotein D (gD) antigen or its antigenic fragment, and polynucleotides encoding HSV glycoprotein E (gE) antigen or its antigenic fragment, wherein: (i) The polynucleotide encoding the HSV gC antigen or an antigen fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity with SEQ ID NO:336; (ii) The polynucleotide encoding the HSV gD antigen or an antigen fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity with SEQ ID NO:340; (iii) The polynucleotide encoding the HSV gE antigen or an antigen fragment thereof comprises a ribonucleic acid sequence having at least 90% sequence identity with SEQ ID NO:283; or (iv) Any combination thereof.
2. The combination of claim 1, wherein the polynucleotide encoding the HSV gC antigen or an antigen fragment thereof further encodes a secretion signal.
3. The combination of claim 2, wherein the secretion signal includes an HSV secretion signal.
4. The combination of claim 3, wherein the HSV secretion signal is the HSV glycoprotein D (gD) secretion signal.
5. The combination of claim 4, wherein the HSV gD secretion signal is the HSV1 gD secretion signal.
6. The combination of claim 5, wherein the HSV1 gD secretion signal comprises the amino acid sequence according to SEQ ID NO:
213.
7. The combination of claim 6, wherein the polynucleotide encoding the HSV gC antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
240.
8. The combination of any one of claims 1 to 7, wherein the polynucleotide encoding the HSV gD antigen or an antigen fragment thereof further encodes a secretion signal.
9. The combination of claim 8, wherein the secretion signal includes an HSV secretion signal.
10. The combination of claim 9, wherein the HSV secretion signal includes the HSV gD secretion signal.
11. The combination of claim 10, wherein the HSV gD secretion signal includes the HSV2 gD secretion signal.
12. The combination of claim 11, wherein the HSV2 gD secretion signal comprises the amino acid sequence according to SEQ ID NO:
29.
13. The combination of claim 12, wherein the polynucleotide encoding the HSV gD antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
56.
14. The combination of any one of claims 1 to 13, wherein the polynucleotide encoding the HSV gD antigen or an antigen fragment thereof further encodes a secretion signal.
15. The combination of claim 14, wherein the secretion signal includes an HSV secretion signal.
16. The combination of claim 15, wherein the HSV secretion signal includes the HSV gD secretion signal.
17. The combination of claim 16, wherein the HSV gD secretion signal includes the HSV2 gD secretion signal.
18. The combination of claim 17, wherein the HSV2 gD secretion signal comprises the amino acid sequence according to SEQ ID NO:
30.
19. The combination of claim 18, wherein the polynucleotide encoding the HSV gD antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
59.
20. The combination of any one of claims 1 to 19, wherein the polynucleotide encoding the HSV gC antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
349.
21. The combination of any one of claims 1 to 20, wherein the polynucleotide encoding the HSV gD antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
352.
22. The combination of any one of claims 1 to 21, wherein the polynucleotide encoding the HSV gE antigen or an antigen fragment thereof comprises a nucleic acid sequence having at least 90% sequence identity with SEQ ID NO:
353.
23. The combination of any one of claims 1 to 22, wherein at least one of the polynucleotides comprises a modified uridine.
24. The combination of any one of claims 1 to 23, wherein the modified uridine is N1-methyl-pseudouridine.
25. The combination of any one of claims 1 to 24, wherein one or more of the polynucleotides comprise, in a 5' to 3' sequence: (i)5'UTR; (ii) the polynucleotide as described in any one of claims 1 to 24; (iii) 3'UTR; and (iv) polyA tail sequence.
26. The combination of claim 25, wherein (i) the 5'UTR comprises or is composed of a modified human α-globin 5'-UTR; and (ii) The 3'UTR comprises or consists of a first sequence from an amino-terminal cleavage enhancer (AES) messenger RNA and a second sequence from a mitochondrial-encoded 12S ribosomal RNA.
27. The combination of claim 25 or 26, wherein the 5'UTR consists of a ribonucleic acid sequence according to SEQ ID NO:
152.
28. The combination of any one of claims 25 to 27, wherein the 3'UTR consists of a ribonucleic acid sequence according to SEQ ID NO:
158.
29. The combination of any one of claims 25 to 28, wherein the polyA tail sequence is a split polyA tail sequence.
30. The combination of claim 29, wherein the split polyA tail sequence comprises a ribonucleic acid sequence according to SEQ ID NO:
155.
31. The combination of any one of claims 25 to 30, further comprising a 5' cap.
32. The combination of claim 31, further comprising a cap proximal sequence comprising positions +1, +2, +3, +4, and +5 of the polynucleotide.
33. The combination of claims 31 and 32, wherein the 5' cap comprises or is composed of m7(3'OMeG)(5')ppp(5')(2'OmeA1)pG2, wherein A1 is position +1 of the polynucleotide and G2 is position +2 of the polynucleotide.
34. The combination of claim 32 or 33, wherein the proximal cap sequence comprises A1 and G2 of the cap 1 structure and comprises A3A4U5 (SEQ ID NO:150) at corresponding positions +3, +4 and +5 of the polynucleotide.
35. The combination of any one of claims 1 to 34, wherein the composition further comprises one or more HSV glycoproteins.
36. The combination of claim 35, wherein the one or more HSV glycoproteins comprise HSV glycoprotein B (gB) antigen or an antigen fragment thereof, HSV glycoprotein E (gE) antigen or an antigen fragment thereof, HSV glycoprotein G (gG) antigen or an antigen fragment thereof, HSV glycoprotein H (gH) antigen or an antigen fragment thereof, HSV glycoprotein I (gI) antigen or an antigen fragment thereof, HSV glycoprotein L (gL) antigen or an antigen fragment thereof, or a combination thereof.
37. The combination of any one of claims 1 to 36, wherein one or more of the polynucleotides are wholly or partially encapsulated in lipid nanoparticles, polymeric complexes (PLX), lipotropic polymeric complexes (LPLX), or liposomes.
38. The combination of any one of claims 1 to 37, wherein the polynucleotide sequence is in a single composition.
39. The combination of any one of claims 1 to 38 for the prevention of HSV infection, the prevention comprising administering one or more doses of the pharmaceutical composition to a subject.
40. The combination of any one of claims 1 to 38 for the treatment of HSV infection, said treatment comprising administering one or more doses of said pharmaceutical composition to a subject.
41. A composition comprising the combination as described in any one of claims 1 to 38.
42. A pharmaceutical composition comprising the combination as described in any one of claims 1 to 38.
43. A method comprising administering to a subject the combination as described in any one of claims 1 to 38.
44. A method comprising administering the composition of claim 41 to a subject.
45. A method comprising administering one or more doses of the pharmaceutical composition of claim 42 to a subject.
46. The method of any one of claims 43 to 45, wherein the method is a method for treating HSV infection.
47. The method of any one of claims 43 to 45, wherein the method is a method for preventing HSV infection.
48. Use of the combination of any one of claims 1 to 38 for the prevention of HSV infection.
49. Use of the composition of claim 41 for the prevention of HSV infection.
50. Use of the pharmaceutical composition of claim 42 for the prevention of HSV infection.
51. Use of the combination of any one of claims 1 to 38 for the treatment of HSV infection.
52. Use of the composition of claim 41 for the treatment of HSV infection.
53. Use of the pharmaceutical composition of claim 42 for the treatment of HSV infection.
54. A combination comprising: Polynucleotides encoding polypeptides containing the following (i) an amino acid sequence having at least 90% identity with SEQ ID NO:213, and (ii) An amino acid sequence that is at least 90% identical to SEQ ID NO:260; Polynucleotides encoding polypeptides containing the following (i) an amino acid sequence having at least 90% identity with SEQ ID NO:29, and (ii) an amino acid sequence having at least 90% identity with SEQ ID NO:2; and Polynucleotides encoding polypeptides containing the following (i) an amino acid sequence having at least 90% identity with SEQ ID NO:30, and (ii) An amino acid sequence that is at least 90% identical to SEQ ID NO:
3.
55. The combination of claim 54, wherein A polynucleotide encoding a polypeptide containing an amino acid sequence having at least 90% identity with SEQ ID NO:159; A polynucleotide encoding a polypeptide containing an amino acid sequence having at least 90% identity with SEQ ID NO:70; and The polynucleotide encodes a polypeptide containing an amino acid sequence that is at least 90% identical to that of SEQ ID NO:75.
Citation Information
Patent Citations
Lipid formulation
US20100324120A1
Lipid encapsulating interfering RNA
US20110060032A1
Novel lipids and compositions for the delivery of therapeutics
US20110311582A1
Biodegradable lipids for the delivery of active agents
US20120027803A1
Lipid encapsulated interfering RNA
US20120058188A1