Application of toxoplasma gondii gene deletion strain for expressing tumor specific antigen receptor in preparation of anti-tumor biological preparation

By using a Toxoplasma gondii gene-deleted strain (CAR-Tg) that expresses tumor-specific antigen receptors on the surface of Toxoplasma gondii, the problems of personalized CAR-T cell therapy and insufficient T cell infiltration have been solved. This significantly enhances the targeted killing ability of tumor cells, reduces the risk of carcinogenesis, and improves the efficacy of anti-tumor treatment and the quality of life of patients.

CN120939221APending Publication Date: 2025-11-14ZHEJIANG MEDICAL COLLEGE +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511044616.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-07-28
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

Current CAR-T cell therapy for anti-tumor treatment is time-consuming and labor-intensive due to its personalized approach, insufficient T-cell infiltration, and potential carcinogenic risks. In particular, its therapeutic effect on solid tumors is limited, and it has significant side effects.

Method used

Using CRISPR technology, tumor-specific antigen receptors were expressed on the surface of Toxoplasma gondii, and a Toxoplasma gondii gene deletion strain (CAR-Tg) expressing tumor-specific antigen receptors was constructed. The tumor-specific antigen receptor protein was fused to the Toxoplasma gondii surface antigen protein SAG1 or SAG3, SRS1 using CRISPR technology to construct the CAR-Tg strain. This solved the problems of personalized CAR-T cell customization and insufficient T cell infiltration, and reduced the risk of carcinogenesis.

Benefits of technology

It enhances the targeted killing ability of tumor cells, significantly improves the anti-tumor effect, reduces side effects, and improves the quality of life of patients, especially showing remarkable therapeutic effects on solid tumors such as melanoma, glioma, liver cancer, breast cancer, colon cancer, lung cancer, and gastric cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120939221A_ABST
    Figure CN120939221A_ABST
Patent Text Reader

Abstract

The invention discloses application of a toxoplasma gondii gene deletion strain for expressing a tumor specific antigen receptor in preparation of an anti-tumor biological preparation. The toxoplasma gondii gene deletion strain (CAR-Tg) for expressing a tumor specific antigen receptor is used for resisting tumors, and particularly, the thought and strategy for treating solid tumors have obvious advantages and innovations, so that the toxoplasma gondii gene deletion strain is a positive application for resisting tumors of toxoplasma gondii; compared with a CAR-T therapy method, the CAR-Tg strain for anti-tumor therapy can effectively overcome the defects that the treatment effects of individualized customization, time and labor waste, insufficient T cell infiltration, depletion and the like are limited, potential carcinogenic risks exist and the like, and has remarkable gain and effects; the CAR-Tg strain expresses a tumor specific antigen receptor on the basis of a toxoplasma gondii gene deletion strain, the targeted tumor killing capacity of toxoplasma gondii can be improved, the anti-tumor effect is improved, and the anti-tumor effect can be improved when the CAR-Tg strain is combined with an anti-tumor drug such as a small-molecule inhibitor.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of tumor vaccine immunotherapy and genetic engineering technology, and more specifically, to the use of Toxoplasma gondii gene-deleted strains expressing tumor-specific antigen receptors in the preparation of antitumor biological agents. Background Technology

[0002] Tumor immunotherapy is a novel treatment method for cancer, and related fields are developing rapidly. It mainly includes monoclonal antibody immune checkpoint inhibitors, therapeutic antibodies, CAR-T cell therapy, and cancer vaccines, especially CAR-T therapy, which stands for Chimeric Antigen Receptor T-Cell Immunotherapy. Chimeric antigen receptor T-cell (CAR-T cells) involve coupling an antibody that recognizes a specific tumor antigen to a chimeric protein, which is then introduced into the patient's T cells through gene editing to express the chimeric antigen receptor (CAR), enabling it to recognize and attack specific tumor cells. However, CAR-T immunotherapy has limitations in terms of adverse reactions, specificity, personalization, and carcinogenic risks, which restrict its therapeutic efficacy and clinical application, especially in targeting solid tumor tissues where T-cell penetration is insufficient, resulting in limited effectiveness.

[0003] Toxoplasma gondii is a strictly obligate intracellular parasitic apical protozoan. Its tachyzoites are approximately 6 μm × 2 μm in size, crescent-shaped, and capable of invading almost all nucleated cells. As an opportunistic pathogen, Toxoplasma gondii spreads throughout the body via the bloodstream after invading. Knocking out certain genes can reduce the virulence of Toxoplasma gondii to almost zero. After invading tumor cells, Toxoplasma gondii can induce the infiltration and upregulation of immune cells (including T cells, cytotoxic T cells, and macrophages), activate the immune response, and induce tumor cell apoptosis. Furthermore, the residues and proteins released into the environment after the lysis of tumor cells and Toxoplasma gondii somatic cells can help activate the body's recognition and response to cancer neoantigens, thereby stimulating the activation of the cancer immune response and improving the tumor microenvironment, achieving an anti-tumor effect.

[0004] For example, patent application CN108478601A discloses the application of Toxoplasma gondii gene-deleted strains in the preparation of antitumor biological agents. These Toxoplasma gondii gene-deleted strains are mutant strains of Toxoplasma gondii lacking both LDH1 and LDH2 genes, or both LDH1 and OMPDC genes. This invention aims to provide a method for treating solid tumors such as melanoma in animals using attenuated Toxoplasma gondii biological agents. It has established the dosage form, determined the inoculation procedure and dosage of the strain, and demonstrated good anti-melanoma and other solid tumor activity in mice through mouse experiments, showing promising application prospects.

[0005] Therefore, given the current limitations of personalized CAR-T cell therapy and insufficient T-cell infiltration leading to ineffective anti-tumor efficacy, there is an urgent need for a tumor vaccine that can potentially improve treatment efficacy, reduce side effects, and enhance patients' quality of life, especially in the treatment of solid tumors. Summary of the Invention

[0006] To address the shortcomings of existing technologies and meet the needs of tumor treatment, this invention provides a therapeutic approach and strategy for treating solid tumors using CAR-Tg, and provides a method for preparing a Toxoplasma gondii gene-deleted strain (CAR-Tg) expressing a tumor-specific antigen receptor and its application in solid tumor treatment. This method utilizes CRISPR technology combined with homologous recombination to express a tumor-specific antigen receptor protein via a flexible peptide fusion to the Toxoplasma gondii surface antigen protein SAG1 (or SAG3, SRS1).

[0007] Constructing CAR-Tg strains by expressing tumor-specific antigen receptors (CARs) on the surface of the parasite can further enhance its ability to recognize and target tumor cells. Based on the inherent characteristics of Toxoplasma gondii—its ability to invade almost all effective cells—CAR-Tg strains can overcome the limitations of personalized CAR-T cell development and insufficient T-cell infiltration leading to ineffective anti-tumor therapy. Furthermore, the construction of CAR-Tg strains does not involve lentiviral vectors, thus mitigating the carcinogenic risks associated with the potential integration of lentiviral sequences into human cells. Therefore, CAR-Tg, as a tumor vaccine, holds promise for improving treatment efficacy, reducing side effects, and enhancing patient quality of life, particularly in the treatment of solid tumors.

[0008] This invention provides the use of Toxoplasma gondii gene-deleted strains expressing tumor-specific antigen receptors in the preparation of antitumor biological agents. The Toxoplasma gondii gene-deleted strains are those that simultaneously delete the OMPDC and UPRT genes, or those that delete the OMPDC and CPSII genes.

[0009] The tumor-specific antigen receptor protein was fused and expressed into the Toxoplasma gondii surface antigen protein.

[0010] The starting strains were commercial RH strains (ATCC, PRA-319) or ME49 strains (ATCC, 506110). Gene knockout monoclonal strains were obtained by CRISPR technology and limiting dilution in 96-well plates.

[0011] The aforementioned Toxoplasma gondii gene-deleted strain (CAR-Tg) expressing tumor-specific antigen receptors was obtained by knocking the antigen receptor sequence into the Toxoplasma gondii surface antigen protein SAG1 or SAG3, SRS1 at specific sites using CRISPR technology. The coding sequences of the sgRNAs used were AGACGACGCACAGAGTTGTA, TACCGGGCGCGAACAGGTAC, and GCCCGTCCGGTGCTCTATAA, respectively. The CAR-Tg monoclonal strain was obtained by limiting dilution in 96-well plates.

[0012] The aforementioned Toxoplasma gondii gene-deleted strain (CAR-Tg) expressing tumor-specific antigen receptors, wherein the tumor-specific antigen receptors are antibody sequences that specifically express proteins on the surface of tumors, including but not limited to single-chain antibodies and nanobodies;

[0013] The Toxoplasma gondii strain lacking the OMPDC and UPRT genes was applied for as a Chinese invention patent on September 20, 2022, with application number CN202211144718.9.

[0014] The Toxoplasma gondii strain lacking the OMPDC and CPSII genes was applied for as a Chinese invention patent on September 20, 2022, with application number CN202211144733.3.

[0015] Preferably, the Toxoplasma gondii surface antigen protein is SAG1, SAG3, or SRS1, or other Toxoplasma gondii surface antigen proteins.

[0016] Preferably, the tumor is a hematoma; Toxoplasma gondii can spread throughout the body via blood vessels and can invade various blood cells, such as leukocytes, lymphocytes, and monocytes, causing apoptosis and necrosis. Therefore, hematomas caused by such cell abnormalities can be inhibited and killed by Toxoplasma gondii after invasion.

[0017] Preferably, the tumor is a solid tumor; more preferably, the solid tumor includes, but is not limited to, melanoma, glioma, liver cancer, breast cancer, colon cancer, lung cancer, or stomach cancer.

[0018] CAR-Tg strains can significantly induce apoptosis in tumor cells, achieving the effect of killing tumor cells. Mice treated with CAR-Tg survived until 40 days (the experiment only observed up to 40 days), and CAR-Tg treatment significantly inhibited or even completely eliminated tumor growth. Therefore, CAR-Tg can effectively exert anti-tumor effects and improve quality of life.

[0019] The present invention also provides an antitumor biological agent, wherein the antitumor biological agent is a suspension of tachyzoites of a Toxoplasma gondii gene-deleted strain expressing a tumor-specific antigen receptor.

[0020] The Toxoplasma gondii gene-deleted strains are those that simultaneously lack the OMPDC and UPRT genes, or those that lack the OMPDC and CPSII genes.

[0021] The tumor-specific antigen receptor protein was fused and expressed into the Toxoplasma gondii surface antigen protein.

[0022] Preferably, the Toxoplasma gondii surface antigen protein is SAG1, SAG3, or SRS1, or other Toxoplasma gondii surface antigen proteins.

[0023] Preferably, the tumor is a hematoma.

[0024] Preferably, the tumor is a solid tumor; more preferably, the solid tumor includes, but is not limited to, melanoma, glioma, liver cancer, breast cancer, colon cancer, lung cancer, or stomach cancer.

[0025] Preferably, the solvent for the tachyzoite suspension is serum-free DMEM solution or PBS, or a commonly used reagent such as physiological saline.

[0026] Preferably, the antitumor biological agent is injected into or near the tumor during use.

[0027] The present invention also provides the application of the above-mentioned antitumor biological agents and immunotherapy agents in the preparation of antitumor drugs, wherein the antitumor biological agents and immunotherapy agents are used in combination.

[0028] Preferably, the immunotherapy agent is a small molecule inhibitor; more preferably, the small molecule inhibitor is Dabrafenib.

[0029] Data from the embodiments of this invention show that, compared to using it alone, CAR-Tg strain treatment combined with the drug dabrafenib can further increase the proportion of tumor cells killed.

[0030] The beneficial effects of this invention are:

[0031] First, the anti-tumor approach and strategy mentioned in this invention, which utilizes Toxoplasma gondii gene deletion strains (CAR-Tg) expressing tumor-specific antigen receptors, has significant advantages and innovations, especially in the treatment of solid tumors, and represents a positive application of Toxoplasma gondii in anti-tumor treatment.

[0032] Furthermore, the anti-tumor therapy using Toxoplasma gondii gene-deleted strain (CAR-Tg) expressing tumor-specific antigen receptors in this invention can effectively address the shortcomings of CAR-T therapy, such as limited therapeutic effects due to its individualized customization, time-consuming and labor-intensive nature, insufficient T-cell infiltration and depletion, and potential carcinogenic risks, compared to CAR-T therapy, and has significant gains and effects.

[0033] Third, the Toxoplasma gondii gene-deleted strain (CAR-Tg) in this invention expresses tumor-specific antigen receptors, which can increase the targeted killing ability of Toxoplasma gondii and improve the anti-tumor effect.

[0034] Fourth, the Toxoplasma gondii gene deletion strain (CAR-Tg) expressing tumor-specific antigen receptor in this invention, when used in combination with anti-tumor drugs such as small molecule inhibitors, can enhance anti-tumor effects. Attached Figure Description

[0035] Figure 1 The image shows the PCR validation results of the CAR-Tg strain.

[0036] Figure 2 The graph shows the results of CAR-Tg strain inducing apoptosis in A375 and B16F10 tumor cells in vitro. A is a flow cytometry graph and B is a statistical graph. In the graph, ** indicates p<0.01, *** indicates p<0.001, and **** indicates p<0.0001.

[0037] Figure 3 This is a statistical graph showing the data on apoptosis induced in GL261 tumor cells by the CAR-Tg strain in vitro; where **** indicates p<0.0001.

[0038] Figure 4 Flow cytometry analysis (A) and statistical data (B) of the CAR-Tg strain synergistic with the small molecule inhibitor Dabrafenib in in vitro induction of apoptosis in A375 cells; where **** indicates p<0.0001.

[0039] Figure 5 The survival curves of C57BL / 6 mice infected with CAR-Tg and RH strains are shown in the figure.

[0040] Figure 6 Blood routine analysis at different time points (days 0, 4, 9, and 16) after CAR-Tg strain was injected into C57BL / 6 mice; where ns indicates p>0.05.

[0041] Figure 7 Survival curves (A), tumor size (B), and tumor size (C) of CAR-Tg strain treated melanoma-bearing mice.

[0042] Figure 8 The result of CAR-Tg parasite targeting and invading melanoma B16F10 cells, affecting their migration ability. Detailed Implementation

[0043] This technology is further described in conjunction with the accompanying drawings and specific embodiments. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0044] The embodiments of the present invention are as follows:

[0045] Example 1: Construction of a Toxoplasma gondii gene-deleted strain expressing tumor-specific antigen receptors (CAR-Tg)

[0046] A. Construction of gene-deleted strains. The Toxoplasma gondii gene-deleted strain is a Toxoplasma gondii strain that simultaneously deletes the OMPDC and UPRT genes, or deletes the OMPDC and CPSII genes. The starting strain is a commercially available Toxoplasma gondii strain, either the RH strain (ATCC, PRA-319) or the ME49 strain (ATCC, 506110). In this embodiment, the RH strain is selected. The operation method is also applicable to the ME49 strain. The operation steps for the Toxoplasma gondii gene-deleted strain that simultaneously deletes the OMPDC and UPRT genes are the same as those in patent application number 202211144718.9, and the Toxoplasma gondii strain that deletes the OMPDC and CPSII genes is the same as those in patent application number 202211144733.3, and the nucleotide sequences of the deleted genes are the same.

[0047] B. Construction of the CAR-Tg strain.

[0048] (1) The originating strain

[0049] The larval strain used in this embodiment is the ΔompdcΔuprt strain.

[0050] (2) pSAG1-Cas9-TgU6-sgsag3 plasmid

[0051] Using pSAG1-Cas9-TgU6-sguprt plasmid as a template, the uprt target-specific gRNA was replaced with the sag3 target-specific gRNA (coding sequence TACCGGGCGCGAACAGGTAC) using the NEB Q5 Site-Directed Mutagenesis Kit. The specific steps are as follows:

[0052] ① Design target sites for the target gene using the online gRNA design website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html), and design gRNA primers based on the designed target sequence:

[0053] Upstream primer (gRNA-sag3-Fw): 5'-GGCTGCAATCCTCCGCTTCCGTTTTAGAGCTAGAAATAGC-3',

[0054] The downstream primer (gRNA-R) is: 5'-AACTTGACATCCCCATTTAC-3'.

[0055] ② Prepare the following reaction mixture (total 20 μl) in a PCR tube:

[0056] Q5 hot start High-Fridelity 2×Master Mix 10μl,

[0057] gRNA-sag3-Fw (10μM) 1μl,

[0058] gRNA-R (10μM) 1μl,

[0059] pSAG1-Cas9-TgU6-sguprt template (20ng / μl) 1μl,

[0060] 7 μl of deionized water

[0061] ③PCR reaction conditions are as follows: 98℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 56℃ annealing for 30 s, 72℃ extension for 6 min, 25 cycles; 72℃ complete extension for 5 min; 16℃ cooling.

[0062] ④ Take a new PCR tube and prepare the following reaction mixture (total 10 μl):

[0063] 2×KLD reaction buffer 5μl,

[0064] 1 μl of 10×KLD enzyme Mix

[0065] 1 μl of the PCR product in ③

[0066] 3 μl of deionized water

[0067] In the PCR instrument, the reaction was carried out at 25°C for 15 minutes.

[0068] ⑤ Take all the PCR products from step ④ and transform them into 100 μl of DH5α competent cells. Plate the cells on LB / Amp plates and incubate them upside down at 37°C overnight.

[0069] ⑥ Pick a single colony and place it in 5 ml of LB / Amp liquid medium. Incubate at 37℃ with shaking at 180 rpm for 10-12 h until the culture becomes turbid. Select 5 single colonies and send them to a biotechnology company for sequencing. The sequencing primer is the M13 reverse primer (sequence CAGGAAACAGCTATGAC). If the sequencing results show that the target sequence has been completely replaced, the plasmid has been successfully constructed.

[0070] ⑦ The plasmid pSAG1-Cas9-TgU6-sgsag3 was extracted using the TRANSGEN plasmid extraction kit (Hipure Plasmid MaxiPrep Kit), and the concentration was determined for later use.

[0071] (3) Preparation of homologous templates for tumor-specific antigen receptor proteins

[0072] ① Enter the Gene ID of the gene SGA3 to be knocked in on the ToxoDB website to determine the locus where the gene is located, and determine its 5' homologous arm (sag3-5'UTR) and 3' homologous arm (sag3-3'UTR) through the genome sequence of the gene;

[0073] ② The tumor-specific antigen receptor sequence with a flexible fragment (in this example, the CD20scFv sequence, as shown in SEQ ID NO.6) was synthesized by Shanghai Sangon Biotech Co., Ltd. and inserted into the pLoxP-DHFR-mCherry plasmid (addgene 70147) to construct the CD20 scFv-loxp-DHFR plasmid. Primers with 40bp 5' homologous arms (sag3-5'UTR) and 3' homologous arms (sag3-3'UTR) were designed, respectively.

[0074] Upstream primer sag3-5'UTR-F: 5'-CCTGGCGTTCCTTCTCGGTCTCCTTGTGCATGTGGCTGCCGGCAGCGCGGGCAGCGCGGCGGGCAGCGGCG-3',

[0075] Downstream primer sag3-3'UTR-R: 5'-GAAATAATGCTCCAGTTTGGTGTGCTGCACCCTCTGAAATCCATGATTACGCCCataacttc-3';

[0076] This primer pair is a universal primer pair. Other tumor-specific antigen receptors can be constructed into the pLoxP-DHFR-mCherry plasmid and then amplified by PCR using this primer pair to obtain homologous arm fragments.

[0077] ③ Using the designed primers and the CD20 scFv-loxp-DHFR plasmid as a template, the fragment was amplified by PCR using high-fidelity enzyme (KODplus). The PCR reaction system is as follows (total 50 μl):

[0078] 10×PCR buffer for KOD-plus- 5μl,

[0079] 2mM dNTPs 5μl,

[0080] 25mM MgSO4 2μl,

[0081] Upstream primer (10 μM) 1.5 μl,

[0082] Downstream primer (10 μM) 1.5 μl,

[0083] CD20 scFv-loxp-DHFR template (50ng / μl) 1μl,

[0084] KOD-plus-(1.0U / μl) 1μl,

[0085] 33 μl of deionized water.

[0086] The PCR program is as follows: 98℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing for 30 s, 72℃ extension for 2 min, 25 cycles; 72℃ complete extension for 5 min; 16℃ cooling.

[0087] The target fragment was recovered, and the concentration of the recovered product was determined using NanoDrop2000. It was then stored at -20°C for later use.

[0088] (4) Obtaining CAR-Tg strains

[0089] ① Collect the tachyzoites of the starting strain Toxoplasma gondii ΔompdcΔuprt that are about to overflow from the worm vesicles described in step (1), filter them with a sterile filter membrane with a pore size of 5μm to remove host cell debris, centrifuge at 1000rcf for 10min, discard the supernatant, resuspend the worm pellet in 7-8ml of Cytomix (120mM KCl, 0.15mM CaCl2, 10mM K2HPO4 / KH2PO4, 25mM HEPES, 2mM EGTA, 5mM MgCl2, pH=7.6), centrifuge again at 1000rcf for 10min, and discard the supernatant.

[0090] ② Resuspend the precipitate of parasites in 250-300 μl of Cytomix, count the parasites, and separate the precipitate containing 1×10⁻⁶ parasites. 7A suspension of *Toxoplasma gondii* was added to a 2 mm electroporation cuvette. 7.5 μg of the pSAGl-Cas9-TgU6-sgsag3 plasmid (2) and 10.0 μg of the CD20 scFv-loxp-DHFR homologous template fragment (3) were added to the cuvette, along with 3 μl of ATP (0.2 M) and 3 μl of glutathione (0.5 M), for a total reaction volume of 300 μl.

[0091] ③ Use a pipette to mix the DNA and Toxoplasma gondii suspension evenly, avoiding the formation of air bubbles.

[0092] ④ Transfection: Place the electroporation cuvette in the Bio-Rad electroporator, set the program to 1700V, 25μF, 50Ω, 2mm, and electrolyze twice. Quickly aspirate the DNA-worm suspension mixture after electrolysis and add it to a T25 cell flask (HFF host cells + DMEM + 2% FBS + double antibiotics), and incubate in an incubator.

[0093] ⑤ After 60-80% of the transfected parasites escape from the HFF host cells, the cells are lysed to release the parasites from the host cells; about 1000 μl of parasite suspension is added to fresh host cells (T25), and pyrimethamine is added to the culture medium to make the final concentration 3 μM for drug screening.

[0094] ⑥ Following the method described in ⑤, perform continuous drug screening for three to five generations. After the drug screening is stable, place the insects in a 96-well plate containing host cells for monoclonal screening. After culturing in the 96-well plate for 10-12 days, observe whether there are monoclonals. Use a sterile pipette tip to scrape the host cells from the well corresponding to the monoclonal and add them to a 24-well plate containing host cells. Culture for about 5 days. When 60% to 70% of the host cells are lysed, use a sterile pipette tip to scrape 100 μl of insect fluid into a new 24-well plate for continued culturing. The remaining insect fluid is used for DNA extraction and PCR identification of monoclonals.

[0095] ⑦ Figure 1 The diagram shows the knock-in process. PCR1, PCR2, and PCR3 target bands to detect whether CD20-scfv has integrated into the Toxoplasma gondii genome. The primers are:

[0096] SAG3-CD20 scfv-F1: 5'-ACTACAGCTCTTCGTGGTGG-3',

[0097] SAG3-CD20 scfv-R1: 5'-CCGGTTTCTGCTGATACCAATG-3';

[0098] SAG3-CD20 scfv-F2: 5'-AGGATGAATTCCGACCCAGC-3',

[0099] SAG3-CD20 scfv-R2: 5'-CATACAGCGAGGCAGCAAAG-3';

[0100] SAG3-CD20 scfv-F3:5'-ATTGTGCTGACCCAGAGCCC-3',

[0101] SAG3-CD20 scfv-R3: 5'-GCTATCTTCGCTGGTCAGGC-3'.

[0102] The target band in PCR4 is for detecting the 529 gene of Toxoplasma gondii. As a control, the primers are:

[0103] 529bp-F: 5'-CGCTGCAGGGAGGAAAGACGAAAGTTG-3',

[0104] 529bp-R: 5'-CGCTGCAGACACAGTGCATCTGGATT-3'.

[0105] If PCR1, PCR2, PCR3, and PCR4 all show specific target bands (e.g.) Figure 1 As shown in the figure, this indicates that the monoclonal strain is the gene knock-in strain CAR-Tg. The strain identified as CAR-Tg was transferred from a 24-well plate to a T25 culture flask for expansion culture. The gene knockout strain after expansion culture in T25 was identified again by PCR1 and PCR2. The PCR reaction system is as follows. If the identification results are consistent with the previous ones, the strain can be frozen after expansion.

[0106] ⑧ Prepare the following reaction mixture (total 25 μl) in a sterile PCR tube:

[0107] 2×Master Mix 12.5vl

[0108] 1 μl of upstream primer (10 μM),

[0109] 1 μl of downstream primer (10 μM),

[0110] DNA template (50 ng / μl) 1.5 μl,

[0111] 9 μl of deionized water.

[0112] The PCR reaction conditions were as follows: 98℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 60℃ annealing for 30 s, 72℃ extension for 1 min, 30 cycles; 72℃ complete extension for 5 min; cooling at 16℃.

[0113] ⑨ Identification of PCR products: Take 10 μl of the PCR product after the reaction is completed and identify it by agarose gel electrophoresis.

[0114] Example 2: In vitro antitumor cell effect of CAR-Tg strain

[0115] The CAR-Tg parasite strain constructed in Example 1 was used to infect melanoma cells A375 (ATCC, CRL 1619) and B16-F10 (ATCC, CRL 6475) at different parasite-to-tumor cell infection ratios (MOI = 10:1, 1:1, 1:5). 24 hours post-infection, cell apoptosis was detected using an apoptosis detection kit (Beyotime, C1062) following the kit's instructions. Figure 2 As shown in A and 2B, when the infection ratio is in the range of 10:1 to 1:5, significant apoptosis is induced in tumor cells.

[0116] CAR-Tg parasites were infected with GL261 glioma cells (Oricell, M8-0301) at infection ratios of 10:1, 1:1, and 1:5. Samples were collected 24 hours after infection and analyzed by flow cytometry using an apoptosis detection kit (Beyotime, C1062). Figure 3 As shown, the CAR-Tg strain can significantly induce apoptosis in GL261 tumor cells, achieving the effect of killing tumor cells.

[0117] Example 3. CAR-Tg strain combined with small molecule inhibitors significantly improves antitumor efficacy.

[0118] Dabrafenib is a kinase inhibitor targeting the BRAF V600 mutation, primarily used to treat unresectable or metastatic melanoma harboring this mutation. A375 cells are BRAF melanoma cells. In this example, Dabrafenib was purchased from MCE (catalog number GSK2118436). A375 cells were seeded into 6-well plates (1 × 10⁶ cells per well). 6 Cells were divided into three groups: a control group (no treatment), a CAR-Tg parasite treatment group (infection ratio 1:1), a Dabrafenib treatment group (final drug concentration per well 2 nM), and a CAR-Tg parasite infection combined with Dabrafenib treatment group (infection ratio 1:1, final drug concentration 2 nM). Each treatment was performed in triplicate. 24 hours after treatment, cell apoptosis was detected using an apoptosis detection kit (Beyotime, C1062) following the instructions. Figure 4 As shown, compared with the control group, both the CAR-Tg strain treatment group and the Dabrafenib treatment group could significantly induce apoptosis of A375 cells on their own, while the CAR-Tg strain treatment synergistic with the drug Dabrafenib could further increase the proportion of tumor cells killed.

[0119] Example 4: Safety index detection of CAR-Tg strain

[0120] CAR-Tg strains or originating RH strains (1×10⁻⁶ each) were respectively used. 6 (Number) 6-8 week old female C57BL / 6 mice were injected with the CAR-Tg parasite strain, and the survival time of the mice was recorded; blood samples were collected from the mice injected with the CAR-Tg strain at different time points for routine blood tests. Figure 5 As shown, all mice infected with the wild-type strain died on day 6 post-infection, while mice infected with the CAR-Tg strain remained alive. Figure 6 As shown, there were no significant differences in the blood routine results of mice injected with the CAR-Tg strain before injection (day 0) and on days 4, 9 and 16 after injection. The levels of various blood cells remained consistent, indicating that the CAR-Tg strain injection caused almost no lesions or harm to mice.

[0121] Example 5: Validation of the antitumor effect of the CAR-Tg parasite strain in tumor-bearing mice.

[0122] B16-F10 cells were subcutaneously injected into 6-8 week old female C57BL / 6 mice (1×10⁶ cells per mouse). 6 (Number of mice) were used to construct melanoma-bearing mice. On days 8 (when tumors had grown), 10, 12, and 14 post-injection, 1×10⁻⁶ CAR-Tg strains were injected intratumorally. 7 Each mouse was treated, and the survival rate and tumor growth were recorded afterwards. For example... Figure 7 As shown in A and 7B, all untreated mice died within 30 days, while all mice treated with CAR-Tg survived until 40 days (the experiment only observed up to 40 days), and CAR-Tg treatment significantly inhibited or even completely eliminated tumor growth.

[0123] Hepa cell carcinoma cells Hepa 1-6 were subcutaneously injected into 6-8 week old female C57BL / 6 mice (1×10⁶ cells per mouse). 6 A mouse model bearing Hepa 1-6 liver cancer cells was constructed. On days 8 (when tumor masses had grown), 10, 12, and 14 post-injection, 1×10⁻⁶ CAR-Tg parasite strains were injected intratumorally. 7 Each mouse was treated, and the survival rate and tumor growth were recorded afterwards. For example... Figure 7 As shown in Figure C, in the Hepa 1-6 tumor-bearing mouse model of liver cancer cells, the CAR-Tg strain has the same therapeutic effect on Hepa 1-6 tumor-bearing mice.

[0124] In summary, the CAR-Tg strain not only effectively exerts anti-tumor effects on melanoma B16F10 cells, but also exhibits the same anti-tumor effects on hepatocellular carcinoma Hepa 1-6 cells, thus improving the quality of life.

[0125] Example 6: Transwell evaluation of the targeted invasion ability of CAR-Tg strains against tumor cells.

[0126] Transwell assays were used to assess the migration ability of B16F10 melanoma cells treated with the CAR-Tg strain, thereby analyzing the targeting and invasion levels of tumor cells by the wild-type RH strain. B16F10 melanoma cells were spaced at 1 × 10⁻⁶ cells per well. 6 Cells were seeded into 6-well plates and cultured under standard conditions for 12 hours until cell attachment. Then, 100 μL of a solution containing 1 × 10⁻⁶ cells was added to each well. 6 A suspension of *Toxoplasma gondii* containing wild-type RH and CAR-Tg strains (infection ratio 1:1) was cultured for 1 hour using standard methods. After the strains had successfully invaded the cells, the supernatant was washed away to remove any uninvaded strains. 8.0 μm pore size Transwell culture chambers (Corning, 353096) were placed in 24-well plates, divided into two groups of three replicates each. 100 μL of a solution containing 1 × 10⁻⁶ cells was added to the upper chamber of each chamber. 4 B16-F10 melanoma cells, inoculated with different strains of parasites and treated, were cultured for 24 hours. The chambers were then removed, fixed with 4% paraformaldehyde for 15 minutes, stained with 0.1% crystal violet for 20 minutes, and the upper layer of cells was wiped away with a cotton swab. The lower layer of cells was then photographed under a fluorescence microscope, with 9 fields of view per well, and the cells were counted. Figure 8 As shown, the number of B16F10 melanoma cells treated with the wild-type RH strain that penetrated the Transwell and migrated was significantly higher than that of B16F10 melanoma cells treated with the CAR-Tg strain. This indicates that the CAR-Tg strain invaded more B16F10 cells, causing apoptosis and weakening the migration ability. In other words, compared with the wild-type Toxoplasma gondii RH strain, the CAR-Tg strain targeted and invaded more B16F10 melanoma cells and had a stronger targeting ability.

[0127] This invention has been described in conjunction with the preferred embodiments. However, after reading the above description of this invention, those skilled in the art can make various alterations or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims.

Claims

1. The use of Toxoplasma gondii gene-deleted strains expressing tumor-specific antigen receptors in the preparation of antitumor biological agents, wherein the Toxoplasma gondii gene-deleted strain is a Toxoplasma gondii strain that simultaneously deletes the OMPDC and UPRT genes, or deletes the OMPDC and CPSII genes. The tumor-specific antigen receptor protein was fused and expressed into the Toxoplasma gondii surface antigen protein.

2. The use according to claim 1, characterized in that, The Toxoplasma gondii surface antigen protein is SAG1, SAG3, or SRS1.

3. The use according to claim 1, characterized in that, The tumor is a hematologic malignancy.

4. The use according to claim 1, characterized in that, The tumor is a solid tumor; The solid tumor is melanoma, glioma, liver cancer, breast cancer, colon cancer, lung cancer, or stomach cancer.

5. An antitumor biological agent, characterized in that, The antitumor biological agent is a suspension of tachyzoites from a Toxoplasma gondii gene-deleted strain expressing a tumor-specific antigen receptor. The Toxoplasma gondii gene-deleted strains are those that simultaneously lack the OMPDC and UPRT genes, or those that lack the OMPDC and CPSII genes. The tumor-specific antigen receptor protein was fused and expressed into the Toxoplasma gondii surface antigen protein.

6. The antitumor biological agent according to claim 5, characterized in that, The Toxoplasma gondii surface antigen protein is SAG1, SAG3, or SRS1.

7. The antitumor biological agent according to claim 5, characterized in that, The tumor is a hematologic malignancy.

8. The antitumor biological agent according to claim 5, characterized in that, The tumor is a solid tumor; The solid tumor is melanoma, glioma, liver cancer, breast cancer, colon cancer, lung cancer, or stomach cancer.

9. The antitumor biological agent according to claim 5, characterized in that, The solvent for the tachyzoite suspension is serum-free DMEM solution or PBS.

10. The antitumor biological agent according to claim 5, characterized in that, When used, the antitumor biological agent is injected next to or into the tumor.

11. The use of the antitumor biological agent and immunotherapy agent according to any one of claims 5 to 10 in the preparation of antitumor drugs, characterized in that, When applied, the antitumor biological agent is used in combination with an immunotherapy agent.

12. The application according to claim 11, characterized in that, The immunotherapy agent is dabrafenib.

Citation Information

Patent Citations

  • Use of toxoplasma gondii gene-deleted strain in preparation of anti-tumor biological agent

    CN108478601A

  • Toxoplasma gondii attenuated live vaccine with deletion of CPS II and OMPDC genes

    CN115926990A

  • Toxoplasma gondii attenuated live vaccine with deletion of OMPDC and UPRT genes

    CN116024091A