Leech polypeptide mutant with high anticoagulation, oxidation resistance and saccharification resistance and preparation method of leech polypeptide mutant

Abstract

The invention discloses a recombinant leech polypeptide with high anticoagulant activity as well as a preparation method and application thereof. A PelB-T2Y-N47K-N52Y mutant is constructed by carrying out structural optimization on a hirudin HV2 sequence, a polypeptide product with relatively high anticoagulant activity is obtained after induced expression and nickel affinity chromatography purification are carried out in a prokaryotic expression system, and the anticoagulant activity of the polypeptide product reaches 9135.8 ATU / mg and is remarkably superior to that of an initial sequence HV2. Meanwhile, the polypeptide shows a lower IC50 value in a hydroxyl radical scavenging experiment, and has the activity of inhibiting generation of AGEs in a non-enzymatic saccharification model. Molecular docking and binding free energy analysis show that the combination of the mutant and thrombin (PDB ID: 4HTC) is more stable. The leech polypeptide disclosed by the invention has the potential of being developed into a multifunctional bioactive peptide preparation, and is suitable for the related fields of anticoagulation, antioxidation and anti-saccharification.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a leech polypeptide mutant with high anticoagulation, antioxidant, and antiglycation properties and its preparation method. Background Technology

[0002] Currently, the main anticoagulants used clinically both domestically and internationally are unfractionated heparin, low molecular weight heparin, and warfarin. These drugs have drawbacks such as causing side effects like thrombocytopenia and bleeding, or having a slow onset of action. Peptide anticoagulants, such as hirudin, have a relatively independent inhibitory effect on thrombin, requiring no other coagulation factors. They exhibit selectivity and specificity towards thrombin, directly inhibiting its coagulation function. Furthermore, thrombin has a single target and is relatively safe among existing anticoagulants, making it a key area for future development in anticoagulant drugs. Natural hirudin is a single-chain polypeptide compound composed of 65 or 66 amino acid residues, extracted and isolated from the salivary glands of medicinal leeches. Its molecular weight is approximately 7000 Da, and it is currently the most potent antithrombin active substance discovered. However, due to the limited production of natural hirudin—each leech contains only 20 μg of hirudin—it cannot meet the needs of clinical applications. Therefore, recombinant hirudin is used as a substitute.

[0003] Recombinant hirudin is primarily expressed using systems such as *E. coli*, which offers advantages such as rapid growth, high expression levels, ease of operation, and low cost. However, this system cannot sulfonate the tyrosine residue at position 63 (Tyr63), leading to a decreased affinity for thrombin and consequently affecting its anticoagulant activity. Sulfonation may enhance its electrostatic interactions, improve hirudin's inhibitory effect on thrombin, and optimize its protein conformation, resulting in optimal anticoagulant biological activity. Summary of the Invention

[0004] To address the drawback of low anticoagulant activity in existing recombinant hirudin, this invention provides a high-anticoagulant-activity leech polypeptide mutant and its preparation method, which is beneficial to the industrialization and application of leech polypeptides.

[0005] In a first aspect, the present invention provides a leech polypeptide mutant obtained by mutating threonine at position 2 to tyrosine, asparagine at position 47 to lysine, and asparagine at position 52 to tyrosine in the amino acid sequence of the leech polypeptide HV2 shown in SEQ ID NO.2.

[0006] According to a preferred embodiment of the present invention, the N-terminus of the leech polypeptide mutant is fused with the PelB signal peptide.

[0007] According to a preferred embodiment of the present invention, the C-terminus of the leech polypeptide mutant is fused with a 6×His tag.

[0008] Preferably, the amino acid sequence of the leech polypeptide mutant is shown in SEQ ID NO.4.

[0009] In a second aspect, the present invention provides a coding gene for a leech polypeptide mutant, the sequence of which is shown in SEQ ID NO.3.

[0010] A third aspect of the present invention provides a method for preparing a leech polypeptide mutant, comprising the following steps:

[0011] (1) The nucleotide sequence of the leech polypeptide mutant was cloned into the expression vector pET-28a(+), and the expression vector pET-28a(+) was transformed into Escherichia coli BL21(DE3) to obtain the recombinant strain;

[0012] (2) Induce expression of the recombinant strain obtained in step (1) and collect the bacterial culture;

[0013] (3) The bacterial solution collected in step (2) was purified by nickel affinity chromatography to obtain the target protein, namely the leech polypeptide mutant.

[0014] A fourth aspect of the invention provides the use of the leech polypeptide mutant in the preparation of anticoagulant, antioxidant, or antiglycation drugs.

[0015] The present invention has the following beneficial effects:

[0016] 1. This invention utilizes an E. coli expression system to efficiently secrete leech peptides, which simplifies the protein purification process. Simultaneously, based on big data machine calculations and molecular docking experiments to combine mutant peptides with anticoagulant activity, the leech peptide sequence with the highest anticoagulant activity is screened out.

[0017] 2. This invention achieves secretory expression of a leech peptide fusion protein under the coexistence of the PelB signal peptide, the leech peptide, and the His-tag. Recombinant leech peptides were successfully obtained through affinity purification, significantly improving anticoagulant activity. Furthermore, its potential for antioxidant and anti-glycation bioactivities was discovered, providing theoretical and experimental basis for the subsequent development of multifunctional natural bioactive peptides, facilitating future industrialization and applications. Attached Figure Description

[0018] Figure 1 This is a diagram showing the docking results of hirudin HV2 and thrombin 4HTC molecules.

[0019] Figure 2 The results of docking of leech peptides HV2, PelB-T2Y-N47K-N52Y with 4HTC molecules and the comparison of calculated free energies are presented.

[0020] Figure 3This is a sequencing result of the PelB-T2Y-N47K-N52Y mutant.

[0021] Figure 4 This is a graph showing the results of nickel affinity chromatography purification of PelB-T2Y-N47K-N52Y protein. Lane M is the protein molecular weight standard, lane 1 is the loading solution, lane 2 is the flow-through solution, lane 3 is the effluent from the equilibration buffer, and lanes 4 to 7 are the protein samples eluted with 20, 50, 100, and 300 mM imidazole, respectively. The molecular weight of the bands indicated by the arrows in the graph is consistent with the theoretical dimer of HV2.

[0022] Figure 5 This is the result of the scavenging effect of two leech polypeptides on hydroxyl free radicals.

[0023] Figure 6 This is the result of the inhibitory effect of aminoguanidine hydrochloride (AG) and leech peptides on AGEs. Detailed Implementation

[0024] To clarify the construction, preparation method, and bioactivity results of the highly anticoagulant leech polypeptide mutant of the present invention, specific embodiments are described below. The following embodiments are only for illustrating the technical solutions of the present invention and do not constitute a limitation on the scope of protection of the present invention. Furthermore, it should be understood that after reading the teachings of this invention, all those skilled in the art and in practice can make various modifications or alterations to the present invention, and these equivalent forms also fall within the scope of protection defined by the appended claims.

[0025] Examples 1-4 below test the functional activities of the constructed and expressed recombinant leech peptide PelB-T2Y-N47K-N52Y. Specifically, this includes the selection of mutation sites, the acquisition of mutants, anticoagulation activity, antioxidant capacity to scavenge hydroxyl radicals, and antiglycation activity to inhibit the formation of advanced glycation end products (AGEs). Specific experimental conditions are described in the descriptions of each example.

[0026] Unless otherwise specified, the experimental materials, operating methods, etc. used in the following embodiments can be obtained through conventional commercial channels, are known in the technical field, or are performed in accordance with the product instructions.

[0027] Example 1: Molecular docking of leech peptides with thrombin 4HTC

[0028] 1. Molecular docking

[0029] This invention employs the online tool Swiss-Model (https: / / swissmodel.expasy.org / ) to perform homology modeling using the leech peptide HV2 as a template, and obtains the three-dimensional structure of thrombin (PDB ID: 4HTC) from the protein database PDB. Since 4HTC is the refined structure of the complex formed by hirudin HV2 and thrombin, the L and H chains of thrombin in this structure are selected as receptors to simulate the active conformation when binding with hirudin. Simultaneously, the peptide obtained based on the HV2 sequence homology modeling is named the A chain and used as a ligand in docking analysis to explore its binding mode and key interaction sites with thrombin.

[0030] The obtained protein structure was preprocessed, including assigning bond order, adding hydrogen atoms, removing water molecules and cofactors, and optimizing the hydrogen bond network. Then, the OPLS_4 force field was applied to minimize the energy of the structure.

[0031] use Software (accessible via) https: / / www.schrodinger.com / Protein-protein docking was performed using the Protein-Protein Docking module (downloadable). The standard mode was used during docking, with 70,000 rotational conformations sampled for the ligand, resulting in 30 generated conformations. The Piper module clustered the 1000 generated rotational conformations and selected the representative conformation with the most neighboring conformations in each cluster as the candidate structure. The final result of the protein-peptide docking was selected from the group with the most clustered conformations. The binding free energy was evaluated using the MM-GBSA method; a lower (more negative) binding energy indicates a more stable binding between the mutant and thrombin, and a stronger affinity. High-affinity binding helps the hirudin mutant effectively occupy the active site and hydrophobic tail of thrombin, thereby blocking its recognition and cleavage of fibrinogen, exhibiting more significant anticoagulant activity.

[0032] According to the docking configuration, such as Figure 1 As shown, both the N-terminus and C-terminus of the HV2 peptide are involved in binding to thrombin, providing a theoretical basis for subsequent site-directed mutagenesis to optimize the amino acid side chain structure and enhance the stability and activity of binding to thrombin.

[0033] 2. Point mutation analysis

[0034] The lowest-energy conformation within the cluster with the highest number of clusters obtained from protein-peptide docking was selected as the basis for this research. The Residue Scanning module in the software performs residue scanning analysis on this conformation. Using the stability and affinity of protein-protein binding as evaluation indicators, the binding interface between the HV2 leech polypeptide A chain and the thrombin protein L and H chains is set as the analysis region. Virtual saturation mutations are performed on multiple amino acid residues of the A chain, replacing them with 18 amino acid residues other than histidine.

[0035] Based on the evaluation results of affinity changes, mutation sites are sorted to screen out key mutation sites that may affect protein binding performance and biological activity, which can guide the construction and optimization of subsequent mutants.

[0036] Furthermore, the key mutation sites identified above were homology-modeled using Swiss-Model to obtain the corresponding three-dimensional structural models of the mutants. Using the obtained mutant structures as ligands, molecular docking analysis was performed again with thrombin protein. The conformation ranked first in the docking results was selected for MM-GBSA binding free energy calculation to evaluate the binding ability of the mutated peptide to thrombin.

[0037] Based on the binding free energy analysis results, corresponding leech peptide mutants were prepared and their in vitro anticoagulant activity was tested. The final mutant sequence T2Y-N47K-N52Y, exhibiting high anticoagulant activity, has optimized structural stability and functional properties.

[0038] In actual experiments, the N-terminus of the leech polypeptide HV2 carries a methionine residue, denoted as M-HV2. To improve protein secretion efficiency, the signal peptide PelB (see patent CN107082801A for PelB) was linked to one end of the mutant T2Y-N47K-N52Y, resulting in the recombinant polypeptide PelB-T2Y-N47K-N52Y. M-HV2 and the recombinant polypeptide PelB-T2Y-N47K-N52Y were molecularly docked with thrombin 4HTC, and their MM-GBSA binding free energies were calculated. The results are as follows: Figure 2 As shown in the figure, the analysis results indicate that M-HV2 is located far from the active site of thrombin in the docking model, which may result in a weaker binding ability to the target enzyme, thus affecting its anticoagulant effect. In contrast, PelB-T2Y-N47K-N52Y binds more stably near the active site of thrombin with a lower binding free energy, indicating that it has a stronger targeting binding ability and potential anticoagulant activity.

[0039] These results demonstrate that structural optimization and signal peptide-guided modification strategies can help improve the functional activity of recombinant peptides and enhance their application potential in the biomedical field.

[0040] Example 2: Construction of PelB-T2Y-N47K-N52Y leech polypeptide mutant

[0041] Using pET-28a(+) plasmid as the starting plasmid, a recombinant plasmid was constructed for the expression of leech peptides. After enzyme digestion and PCR reaction, the enzyme digestion products were separated by 1% agarose gel electrophoresis, and the target band was recovered using a low melting point gel.

[0042] The nucleotide sequence of the target gene HV2 is shown in SEQ ID NO.1, and the corresponding amino acid sequence is shown in SEQ ID NO.2. In the nucleotide sequence, positions 1 to 3 are the start codons; positions 4 to 198 encode the target leech polypeptide; positions 199 to 204 are the XhoI restriction enzyme recognition sequence; positions 205 to 222 are the 6×His tag coding sequence; and positions 223 to 225 are the stop codons.

[0043] The full-length gene sequence described above was synthesized artificially by Anshengda Biotechnology Co., Ltd., and ligated into the pET-28a(+) expression vector. The artificially synthesized HV2 gene fragment was first linked to the nucleotide sequence of the PelB signal peptide to form a fusion expression cassette. This fusion gene fragment was then cloned into the pET-28a(+) expression vector and transformed into the competent E. coli cell line DH5α. Point mutations were performed in DH5α cells, and the recombinant plasmid was amplified. After plasmid extraction, the mutated recombinant vector was transformed into the expression host strain E. coli BL21(DE3). Sequencing verification confirmed the correctness of the mutation, and the construction results met expectations, ready for subsequent protein expression and functional verification experiments.

[0044] 1. Connection between the HV2 encoding gene and the PelB signal peptide

[0045] Based on molecular docking results, it was found that the N-terminal methionine protein has a significant impact on the anticoagulant activity of leech peptides. In order to improve purification efficiency, the nucleotide sequence of the PelB signal peptide was added to the N-terminus of the target gene. The sequence gene was loaded onto the pET-22b plasmid (a commercial plasmid), and the plasmid PelB-HV2 was constructed by homologous recombination technology.

[0046] Based on the gene sequences encoding the PelB signal peptide and the HV2 polypeptide, the following four primers were designed using primer design software:

[0047] PelB-F: 5'GGAGATATACCATGAAATATCTGCTGCCGACCGCGGC3'

[0048] PelB-R: 5'GGTATAGGTAATCGCCATCGCCGGCTG3'

[0049] HV2-F: 5'CAGCAGATATTTCATGGTATATCTCCTTCTTAAAG3'

[0050] HV2-R: 5'GGTATAGGTAATCGCCATCGCCGGCTG3'

[0051] The 5' end of the PelB-F fragment has 26 complementary base pairs with the 3' end of the HV2-R fragment, and the 3' end of the PelB-R fragment has 24 complementary base pairs with the 5' end of the HV2-F fragment. The PelB-F and PelB-R fragments are used to amplify the PelB signal peptide coding gene sequence, and the HV2-F and HV2-R fragments are used to amplify the HV2 polypeptide coding gene sequence.

[0052] (1) Using PrimeSTAR high-fidelity enzyme premix, the PelB fragment was amplified using pET-22b stored in the laboratory as a DNA template and primers PelB-F / R. At the same time, the HV2 circular p fragment was amplified using plasmid synthesized by Anshengda as a DNA template and primers HV2-F / R. The PCR conditions were as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 70-55℃ gradient annealing for 20 s, -1℃ / cycle, 72℃ extension for 30 s / kb, 15 cycles; 98℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 5 s / kb, 15 cycles; and finally, 72℃ extension for 5 min.

[0053] (2) The amplified PelB fragment and HV2 loop p fragment were purified using a low-melting-point agarose gel. Since the PelB fragment carries the homologous arm of the HV2 loop p fragment, homologous recombination was performed based on the homologous arm. The purified products were ligated using the recombinase 2×Hieff Clone Enzyme Premix. The recombination reaction program was 50℃ for 50 min.

[0054] (3) The recombinant plasmid was transformed into DH5α competent cells. After completing the single clone screening and identification, the positive clone plasmid was sequenced for verification.

[0055] 2. Construction of PelB-T2Y-N47K-N52Y plasmid

[0056] Based on the coding gene sequence and mutation site of the HV2 polypeptide, the following six primers were designed using primer design software:

[0057] T2Y-F: 5'AGCCGGCGATGGCGATTTATTACACTGATTGTACAGAATCGGGTC3'

[0058] T2Y-R: 5'AATCGCCATCGCCGGCT3'

[0059] N47K-F: 5'GGCGAAGGTACACCGAAGCCTGAAAGCCATAACAACGGC3'

[0060] N47K-R: 5'CGGTGTACCTTCGCCAGT3'

[0061] N52Y-F: 5'CGAAGCCTGAAAGCCATTATAACGGCGATTTCGAAG3'

[0062] N52Y-R:5'ATGGCTTTCAGGCTTCG3'

[0063] Specifically, the 5' ends of the T2Y-F fragment and the T2Y-R fragment have 26 complementary base pairs, the 5' ends of the N47K-F fragment and the N47K-R fragment have 17 complementary base pairs, and the 5' ends of the N52Y-F fragment and the N52Y-R fragment have 17 complementary base pairs.

[0064] Using PrimeSTAR high-fidelity enzyme premix, PelB-HV2 synthesized in the above experiments was used as a template. The T2Y-F and T2Y-R fragments were used to mutate threonine (Thr, T) at position 2 of the HV2 coding gene sequence to tyrosine (Tyr, Y); the N47K-F and N47K-R fragments were used to mutate asparagine (Asn, N) at position 47 of the HV2 coding gene sequence to lysine (Lys, K); and the N52Y-F and N52Y-R fragments were used to mutate asparagine (Asn, N) at position 52 of the HV2 coding gene sequence to tyrosine (Tyr, Y), in order to achieve site-directed mutagenesis. The PCR conditions were as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 10 s, 70-55℃ gradient annealing for 20 s, -1℃ / cycle, 72℃ extension for 30 s / kb, 15 cycles; 98℃ denaturation for 10 s, 55℃ annealing for 20 s, 72℃ extension for 5 s / kb, 15 cycles; and a final extension at 72℃ for 5 min.

[0065] DH5α competent cell transformation and single-clone identification were performed, and positive clone plasmids were sequenced for verification. Expression plasmids with correct sequencing results were re-transformed into BL21(DE3) competent cells for subsequent protein expression. Sequencing results are shown below. Figure 3 As shown. After successful site-directed mutagenesis and codon optimization, the target gene PelB-T2Y-N47K-N52Y was obtained, and its nucleotide sequence is shown in SEQ ID NO.3 of the sequence listing. The corresponding amino acid sequence is shown in SEQ ID NO.4 of the sequence listing.

[0066] Example 3: PelB-T2Y-N47K-N52Y protein expression and anticoagulant activity test

[0067] 1. Protein expression

[0068] 100 μL of PelB-T2Y-N47K-N52Y-BL21(DE3) glycerol bacterial suspension was inoculated into 5 mL of LB liquid medium containing 0.1% kanamycin and cultured overnight at 37°C in a shaker. The next day, 1 mL of the overnight bacterial suspension was inoculated into 100 mL of the same LB medium and cultured at 37°C and 220 rpm in a shaker until the bacterial growth rate reached OD. 600 The value reached approximately 0.6.

[0069] Subsequently, IPTG was added to the bacterial culture to a final concentration of 0.8 mM, and the culture was induced at 37°C and 220 rpm for 8 h. After induction, the bacterial culture was collected and purified by affinity chromatography.

[0070] 2. Affinity chromatography purification

[0071] Purification of *E. coli* fermentation broth (PelB-T2Y-N47K-N52Y) was performed using 6×His-tag affinity chromatography, mainly involving...

[0072] (1) Buffer composition:

[0073] Buffer 1: Dissolve 19 mL of 0.5 M NaH2PO4, 81 mL of 0.5 M Na2HPO4, and 29.3 g of NaCl in an appropriate amount of water, then bring the volume to 1000 mL and adjust the pH to 7.4.

[0074] Buffer 2: Dissolve 19 mL of 0.5 M NaH2PO4, 81 mL of 0.5 M Na2HPO4, 29.3 g of NaCl, and 34 g of imidazole in an appropriate amount of water and bring the volume to 1000 mL. Adjust the pH to 7.4.

[0075] Buffer 3 with different imidazole concentrations was prepared by mixing buffers 1 and 2 in different proportions, as follows: with a total volume of 100 mL, when the imidazole concentration was 20 mM, the volumes of buffer 1 and buffer 2 were 96 mL and 4 mL, respectively; at 50 mM, they were 90 mL and 10 mL, respectively; at 100 mM, they were 80 mL and 20 mL, respectively; and at 300 mM, they were 40 mL and 60 mL, respectively.

[0076] (2) Pack the nickel agarose gel column and equilibrate it with buffer 1 at a volume of 2–5 times the column bed volume at a flow rate of 2 mL / min.

[0077] (3) After concentrating the fermentation broth by ultrafiltration with buffer 1 and adjusting the pH, filter it through a 0.45 μm filter membrane and load it onto the chromatography column at a flow rate of 1 mL / min. After loading, continue washing the column with buffer 1 for 2–5 column volumes at a flow rate of 2 mL / min.

[0078] (4) Elution was performed stepwise with buffer 3 containing 20, 50, 100 and 300 mM imidazole, respectively, at a flow rate of 2 mL / min. The eluents were collected and their purity was determined by Tricine-SDS-PAGE.

[0079] (5) After elution, rinse the column with pure water for 5 column volumes, and then rinse with 20% ethanol for 3 column volumes at a flow rate of 2 mL / min. Store the column at 4℃ for later use.

[0080] (6) Tricine-SDS-PAGE protein electrophoresis: Tricine gels were prepared, and pre-electrophoresis was performed at 30V for 10 min. Then, 10 μL of sample was loaded, and electrophoresis was carried out at 150V until bromophenol blue reached the bottom of the separating gel. After staining and destaining, the elution fraction containing the target protein band was selected for ultrafiltration concentration for subsequent experiments. The affinity chromatography purification results are as follows: Figure 4 As shown.

[0081] 3. Anticoagulant activity test

[0082] The Markwardt thrombin titration method was used. This method involves titrating thrombin solution in the sample solution to the test solution. The titration endpoint is reached when fibrin flocculent material appears in the sample solution. The anticoagulant activity of the sample solution is determined based on the recorded titration time and the volume of thrombin solution consumed.

[0083] (1) Preparation of fibrinogen and thrombin solutions: Dilute bovine fibrinogen solution with 50 mM Tris-HCl buffer (pH 7.4) to prepare a working solution with a mass fraction of 0.5% (w / v) for later use. Take an appropriate amount of thrombin reagent and dilute it with 0.9% sodium chloride to prepare a thrombin solution with a final concentration of 100 U / mL.

[0084] (2) At 37℃, mix 50 μL of 0.5% fibrinogen solution with 5 μL of the test sample thoroughly, then add 5 μL of 100 U / mL thrombin solution dropwise while gently mixing. Observe whether a coagulation reaction occurs in the mixture within 1 min. The anticoagulant activity of hirudin is evaluated by its ability to inhibit the thrombin-catalyzed fibrinogen-to-fibrin process. If a clot appears within 1 min, the reaction endpoint is considered reached. If no coagulation occurs, it indicates that the activity of the test sample completely inhibits the thrombin-catalyzed fibrinogen process. Continue adding 5 μL of 100 U / mL thrombin until coagulation occurs within 1 min.

[0085] (3) Record the dilution factor of the sample to be tested and the volume of thrombin added, and calculate the activity of the sample to be tested. The formula for calculating anticoagulant activity is:

[0086]

[0087] In the formula, U represents thrombin activity units (ATU / mg), C1 is the concentration of thrombin solution (ATU / mL), C2 is the concentration of the sample to be tested (mg / mL), V1 and V2 are the volumes of thrombin and sample added to the reaction system (μL), respectively, and A represents the dilution factor of the sample.

[0088] (4) Anticoagulant activity results

[0089] Under the same detection conditions, the anticoagulant activity of M-HV2 was 2131 ATU / mg, while the anticoagulant activity of the peptide PelB-T2Y-N47K-N52Y, which was mutated at the T2Y, N47K, and N52Y sites and fused with the PelB signal peptide, was significantly improved, reaching 9135.8 ATU / mg. In comparison, the anticoagulant activity of this mutant was increased by approximately 4.3 times, indicating that the present invention significantly improved the anticoagulant activity of the peptide through structural optimization.

[0090] Example 4: Validation of the antioxidant and anti-glycation bioactivity of PelB-T2Y-N47K-N52Y

[0091] 1. Method for determining the antioxidant activity of leech peptides

[0092] The salicylic acid capture method was used to determine the scavenging ability of samples against hydroxyl radicals. The hydroxyl radicals generated by the Fenton reaction react with salicylic acid to generate 2,3-dihydroxybenzoic acid, which has a special absorption at 510 nm. If an analyte with hydroxyl radical scavenging function is added to the reaction system, the amount of hydroxyl radicals generated will be reduced, thereby reducing the amount of colored compounds generated accordingly.

[0093] The experiment was set up with experimental groups (different concentrations of leech peptides M-HV2 and PelB-T2Y-N47K-N52Y), positive control group (different concentrations of vitamin C), blank control group and background control group, with 3 replicates in each group.

[0094] (1) Add 50 μL of 9 mM FeSO4 solution, 20 μL of 9 mM salicylic acid-ethanol solution and 80 μL of 8 mM H2O2 solution to the 96-well plate in sequence.

[0095] (2) Leech peptide samples and positive control drugs were diluted with PBS to different concentrations, and 100 μL of sample and positive control drug solution was added to a 96-well plate. The specific reaction system is shown in Table 1.

[0096] (3) Incubate at 37℃ for 5 min, and measure the absorbance at 510 nm using a microplate reader. The formula for calculating the hydroxyl radical scavenging rate is:

[0097]

[0098] Table 1. Reaction system for detecting hydroxyl radical scavenging activity

[0099]

[0100] 2. Method for determining the anti-glycation activity of leech peptides

[0101] This experiment used a fructose-BSA non-enzymatic glycation system to evaluate the inhibitory effect of hirudin peptides on advanced glycation end products (AGEs). The experiment included experimental groups (different concentrations of hirudin peptides M-HV2 and PelB-T2Y-N47K-N52Y), a positive control group (different concentrations of aminoguanidine hydrochloride), a glycosylation control group (containing only fructose and BSA), and a blank control group (containing only an equal volume of PBS buffer), with three replicates for each group.

[0102] (1) Add 25 μL of 1M fructose solution and 125 μL of 10 g / L BSA solution to a brown 1.5 mL EP tube.

[0103] (2) Leech polypeptide samples and positive control drugs were diluted with PBS (0.2M, pH 7.4) to 62.5, 125 and 250 μg / mL respectively. 100 μL of sample and positive control drug solution were added to a brown 1.5 mL EP tube.

[0104] (3) Any fraction of the reaction mixture less than 250 μL was supplemented with PBS (0.2 M, pH 7.4). The mixture was incubated in a 37°C incubator in the dark for 7 days. After incubation, the mixture was centrifuged at 12,000 rpm for 5 min, and the supernatant was collected into a 96-well plate. The fluorescence intensity (F) of the supernatant was measured using a fluorescence spectrophotometer under the conditions of excitation wavelength 370 nm and emission wavelength 440 nm.

[0105] (4) The formula for calculating the inhibition rate of AGEs is:

[0106]

[0107] 3. Experimental Results

[0108] In the determination of antioxidant capacity, such as Figure 5 As shown, both PelB-T2Y-N47K-N52Y and M-HV2 exhibit good hydroxyl radical scavenging activity, with a concentration-dependent increasing trend. Specifically, the IC50 of PelB-T2Y-N47K-N52Y is... 50 The value was 13.63 μg / mL (3.06 μM), significantly lower than that of M-HV2 (24.82 μg / mL, 3.55 μM) and the positive control VC (86.51 μg / mL, 491.19 μM), indicating that the mutant of this invention has a stronger ability to scavenge hydroxyl radicals. This enhanced performance may be related to its surface charge distribution, increased hydrophilic residues, and improved conformational stability.

[0109] In anti-glycation experiments, such as Figure 6 As shown, AG, PelB-T2Y-N47K-N52Y, and M-HV2 all inhibited AGE formation within a concentration range of 0.0625–0.25 mg / mL, with the inhibitory effect increasing with increasing concentration. At the highest concentration, PelB-T2Y-N47K-N52Y exhibited an inhibition rate of 9.48%, significantly superior to M-HV2 (6.99%). This improved effect may be related to its enhanced competitive binding ability to sugars or saccharification intermediates after structural optimization.

[0110] Although the positive control AG showed a significantly higher inhibition rate than the leech peptide sample at the same concentration, considering its molar mass of only 110.56 g / mol, while that of leech peptide is approximately 7000 g / mol, further calculations show that when the concentration of AG is 565.30 μM, its inhibition rate is 16.26%, while PelB-T2Y-N47K-N52Y achieves an inhibition rate of 9.48% at a concentration of only 35.72 μM. Although the concentrations differ by approximately 15 times, the inhibition rates differ by only 1.7 times, indicating that leech peptide exhibits high activity potential in anti-glycation.

[0111] The above description is only a preferred embodiment of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A leech polypeptide mutant, characterized in that, The leech polypeptide mutant was obtained by mutating threonine at position 2 to tyrosine, asparagine at position 47 to lysine, and asparagine at position 52 to tyrosine in the amino acid sequence of the leech polypeptide HV2 shown in SEQ ID NO.

2.

2. The leech polypeptide mutant according to claim 1, characterized in that, The N-terminus of the leech polypeptide mutant is fused with the PelB signal peptide.

3. The leech polypeptide mutant according to claim 1, characterized in that, The C-terminus of the leech polypeptide mutant is fused with a 6×His tag.

4. The leech polypeptide mutant according to claim 3, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

4.

5. The encoding gene of the leech polypeptide mutant according to any one of claims 1 to 4.

6. The encoding gene of the leech polypeptide mutant according to claim 5, characterized in that, Its sequence is shown in SEQ ID NO.

3.

7. The method for preparing the leech polypeptide mutant according to claim 1, characterized in that, Includes the following steps: (1) The nucleotide sequence of the leech polypeptide mutant was cloned into the expression vector pET-28a(+), and the expression vector pET-28a(+) was transformed into Escherichia coli BL21(DE3) to obtain the recombinant strain; (2) Induce expression of the recombinant strain obtained in step (1) and collect the bacterial culture; (3) The bacterial solution collected in step (2) was purified by nickel affinity chromatography to obtain the target protein, namely the leech polypeptide mutant.

8. The application of the leech polypeptide mutant according to any one of claims 1 to 4, characterized in that, Used to prepare anticoagulant drugs.

9. The application of the leech polypeptide mutant according to any one of claims 1 to 4, characterized in that, Used to prepare antioxidant drugs.

10. The application of the leech polypeptide mutant according to any one of claims 1 to 4, characterized in that, Used to prepare anti-glycation drugs.

Images