Salt-tolerant cladosporium sp., microbial agent and application thereof

Abstract

The invention provides salt-tolerant cladosporium sp., a microbial agent and application of the salt-tolerant cladosporium sp. The cladosporium halotolerans is Cladosporium halotolerans TCJ1, the cladosporium halotolerans TCJ1 is preserved in the China General Microbiological Culture Collection Center on August 12, 2024, the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.41487, and the Cladosporium halotolerans is classified and named as Cladosporium halotolerans in Latin. The salt-tolerant cladosporium sp. Provided by the invention has strong phosphate solubilizing ability, can greatly increase the content of available phosphorus in water and soil in a short time, can assist phosphorus source mineralization to remove heavy metal cadmium, and has good application potential.

Description

Technical Field

[0001] This invention belongs to the field of microbial and its application technology, specifically relating to a salt-tolerant mycobacterium, a microbial agent, and its application. Background Technology

[0002] Insoluble phosphates (such as calcium phosphate and iron phosphate) account for 70% to 80% of global phosphorus reserves in soil, but their bioavailability is extremely low, leading to agricultural reliance on chemical phosphate fertilizers, which exacerbates resource waste and environmental pollution. Existing phosphate-solubilizing microorganisms (such as Pseudomonas and Aspergillus) can secrete organic acids to release phosphorus, but their phosphate-solubilizing efficiency is limited by factors such as environmental pH and heavy metal toxicity, and their activity decreases significantly under cadmium pollution conditions.

[0003] To optimize the phosphorus-solubilizing effect of phosphorus-solubilizing microorganisms, simultaneous operation of cadmium pollution remediation is necessary. However, cadmium (Cd) pollution is a serious challenge in the current remediation of soil and water environments. Cadmium is highly toxic, difficult to degrade, and bioaccumulates, easily threatening human health through the food chain, leading to kidney damage, bone metabolic diseases, and other problems. Traditional remediation methods, such as chemical leaching and solidification stabilization, are costly, easily damage soil structure, and cause secondary pollution. In contrast, microbial remediation technology has become a research hotspot due to its environmental friendliness and sustainability.

[0004] However, existing functional strains generally only have a single function of heavy metal adsorption or phosphate dissolution, making it difficult to simultaneously solve the combined problems of cadmium pollution and phosphorus resource scarcity. Summary of the Invention

[0005] To address the technical problem that functional strains in commonly used technologies cannot simultaneously solve the combined issues of cadmium pollution and phosphorus scarcity, this invention provides a salt-tolerant Cladosporium. The salt-tolerant Cladosporium is... Cladosporium halotolerans TCJ1 was deposited at the China General Microbiological Culture Collection Center on August 12, 2024, with accession number CGMCC No. 41487, and its Latin name is *Cladosporium halophilum*. Cladosporium halotolerans .

[0006] The present invention provides a microbial agent for decomposing insoluble phosphates and / or treating cadmium pollution, wherein the microbial agent includes the salt-tolerant Cladosporium.

[0007] This invention provides a microbial agent for decomposing insoluble phosphates, the microbial agent comprising, as described above, salt-tolerant Cladosporium;

[0008] The microbial agent further includes a first nutrient solution, wherein the first nutrient solution comprises an aqueous solution containing glucose, ammonium sulfate, sodium chloride, potassium chloride, magnesium sulfate, ferrous sulfate heptahydrate, and manganese sulfate monohydrate, and the phosphorus source comprises hydroxyapatite and / or calcium phosphate.

[0009] This invention provides the application of the microbial agent described above in increasing the available phosphorus content in soil or water.

[0010] Furthermore, when the microbial agent for decomposing insoluble phosphates is applied to water bodies, the increase in the effective phosphorus content in the water body is not less than 120 mg / L; when the microbial agent for decomposing insoluble phosphates is applied to soil, the increase in the effective phosphorus content in the soil is not less than 8 mg / kg.

[0011] Furthermore, when the microbial agent is applied to the soil, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / g; when the microbial agent is applied to water, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / mL.

[0012] This invention provides a microbial agent for treating cadmium pollution, the microbial agent comprising the salt-tolerant mycobacteria described above;

[0013] The microbial agent also includes a phosphorus source, which includes hydroxyapatite and / or calcium carbonate.

[0014] This invention provides the application of the microbial agent described above in the treatment of cadmium pollution in water or soil.

[0015] Furthermore, in the water body or the soil, cadmium exists in the form of divalent cadmium, and the cadmium fixation product is Ca. 3.6 (Ca 4.5 Cd 0.76 (PO4)6(OH) 1.6 .

[0016] Furthermore, the cadmium content in the water body is 5.0–15.0 mg / L, and the cadmium content in the soil is 1.0–2.0 mg / kg.

[0017] Compared with the prior art, the present invention has at least the following advantages:

[0018] This invention provides a salt-tolerant Cladosporium that achieves functional coupling between the dissolution and release of available phosphorus from insoluble phosphates and the remediation of cadmium pollution: the salt-tolerant Cladosporium efficiently dissolves insoluble phosphates through the secretion of organic acids, significantly increasing the available phosphorus content in soil or water; simultaneously, the phosphate ions released during the dissolution of insoluble phosphates combine with cadmium ions to form stable mineral Ca. 3.6 (Ca 4.5 Cd 0.76(PO4)6(OH) 1.6 This achieved long-term fixation of cadmium.

[0019] It should also be noted that the salt-tolerant Cladosporium provided by this invention can synergistically reduce cadmium bioavailability through a dual pathway of cadmium mineralization with hydroxycalcium phosphate and intracellular enrichment, thus avoiding the problem of cadmium re-dissolution caused by phosphorus release. In contrast, although some functional strains in commonly used technologies can fix cadmium through phosphate mineralization, the resulting minerals have poor stability (e.g., CdCO3 is easily acid-soluble), posing a risk of re-dissolution; and while functional strains in commonly used technologies release available phosphorus by dissolving insoluble phosphates, the competitive adsorption of phosphorus and cadmium inevitably leads to the reactivation of cadmium, further increasing the risk of secondary pollution. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0021] Figure 1 These are colony morphology images and single colony growth images of strain Cladosporium halotolerans TCJ1 in Example 1 of the present invention after 5 days of culture in a culture medium.

[0022] Figure 2 Scanning electron micrographs of cells and spores of strain Cladosporium halotolerans TCJ1 from Example 1 of this invention;

[0023] Figure 3 This is the phylogenetic tree of strain Cladosporium halotolerans TCJ1 in Example 1 of the present invention;

[0024] Figure 4 The curves showing the changes in available phosphorus content and pH of strain Cladosporium halotolerans TCJ1 in NBRIP culture medium in Example 2 of this invention are shown.

[0025] Figure 5 This is a mineral XRD analysis diagram of the cadmium fixation assisted by strain Cladosporium halotolerans TCJ1 in Example 3 of the present invention.

[0026] Figure 6This is a mineral FTIR image of cadmium fixation assisted by strain Cladosporium halotolerans TCJ1 in Example 3 of the present invention.

[0027] Figure 7 This is a comparison chart of the available phosphorus content in the soil environment of strain Cladosporium halotolerans TCJ1 in Example 4 of the present invention.

[0028] Figure 8 This is a comparison chart of cadmium content in soil samples from Example 5 of the present invention;

[0029] Figure 9 This is a graph showing the cadmium ion dissolution and pH change during the early stage of the cadmium fixation process in Comparative Example 1 of this invention. Figure 9 (a) is a graph showing cadmium ion dissolution and pH changes during the early stage of cadmium fixation by Klebsiella pneumoniae (Wn). Figure 9 (b) Graph showing cadmium ion dissolution and pH changes during the early stage of cadmium fixation by strain Cladosporium halotolerans TCJ1. Detailed Implementation

[0030] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0031] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0032] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention, as well as the prior art known to those skilled in the art and the description of the invention, may be implemented using any prior art methods, devices, and materials similar to or equivalent to the methods, devices, and materials in the embodiments of the present invention.

[0033] This invention provides a salt-tolerant Cladosporium halotolerans TCJ1, belonging to the genus Cladosporium. This salt-tolerant Cladosporium halotolerans was deposited at the China General Microbiological Culture Collection Center on August 12, 2024, with the accession number CGMCC No. 41487, and its Latin classification name is Cladosporium halotolerans.

[0034] In this invention, the morphological characteristics of the salt-tolerant Cladosporium are as follows: the colony texture is velvety; irregular concentric rings are formed on the surface; the edges are irregular; the colony is dark green to dark green; the reverse side is slightly yellowish-white; and there is no exudate. The conidiophores are septate and short-branched; the conidia are ovoid to oblong, with slightly rough walls.

[0035] In this invention, the culture characteristics of salt-tolerant Cladosporium are as follows: it grows well on both potato dextrose agar (PDA) medium and NBRIP phosphorus-solubilizing solid medium.

[0036] In this invention, the screening of halophilic mycobacteria may include the following steps:

[0037] (1) Preparation of cadmium mother liquor: Weigh cadmium chloride and dissolve it in ultrapure water. Stir until dissolved, transfer to a volumetric flask and make up to the mark to obtain a cadmium mother liquor with a cadmium concentration of 10 g / L.

[0038] Preparation of cadmium-containing NBRIP phosphorus-solubilizing medium: The formulation of cadmium-containing NBRIP phosphorus-solubilizing medium is as follows: 10g glucose, 0.5g ammonium sulfate, 0.3g sodium chloride, 0.3g potassium chloride, 0.3g magnesium sulfate, 0.036g ferrous sulfate heptahydrate, 0.03g manganese sulfate monohydrate, 5g hydroxyapatite, 1mL cadmium stock solution, and 1000mL distilled water. Adjust the pH of the cadmium-containing NBRIP phosphorus-solubilizing medium to 5-7.0 with 5mol / L NaOH solution or 5mol / L hydrochloric acid solution. In some embodiments of the present invention, the hydroxyapatite brand can be Maclean, and the cadmium content of this cadmium-containing NBRIP phosphorus-solubilizing medium can be 10mg / mL. In some embodiments of the present invention, if it is necessary to adjust the cadmium-containing NBRIP phosphorus-solubilizing medium to a solid medium, 20g agar can be added to the cadmium-containing NBRIP phosphorus-solubilizing medium.

[0039] Preparation of PDA solid culture medium: The formula for PDA solid culture medium is: 200g potato, 20g glucose, 18g agar, 1000mL distilled water, pH natural.

[0040] In some embodiments of the present invention, NBRIP phosphorus solubilizing medium, PDA solid medium, and glassware such as petri dishes can be sterilized in a high-pressure steam sterilizer at 100 kPa and 121°C for 20 minutes before use.

[0041] (2) Place the NBRIP phosphorus solubilizing medium in the air for 15 minutes, seal it with sealing film and invert it in a biochemical incubator at 28°C.

[0042] (3) Preliminary screening: Phosphate-solubilizing bacteria are preliminarily screened by observing whether a clear zone can be produced around the fungal colonies growing on the plate; fungal colonies with a relatively obvious clear zone are selected and transferred to PDA plates for purification culture, and used as the initial screening strains of phosphate-solubilizing bacteria; spore suspensions are prepared based on the initial screening strains.

[0043] (4) Expanded culture: 100 mL of NBRIP liquid culture medium was added to a 250 mL Erlenmeyer flask, and 200 μL of the prepared spore suspension was inoculated. The flask was cultured at 28 °C and 150 rpm / min for 5 days.

[0044] (5) Determination of available phosphorus: After centrifuging 2 mL of culture medium from each strain, take the supernatant and compare the available phosphorus concentration in the culture medium of each strain according to the method for determining available phosphorus content, and screen out highly efficient phosphorus-solubilizing bacteria, namely salt-tolerant Cladosporium.

[0045] In this invention, the identification of halophilic mycorrhizal fungi may include the following steps:

[0046] (1) Scanning electron microscopy and SEM analysis were performed on salt-tolerant mycospores.

[0047] (2) Fungal identification was performed by extracting DNA from fungus TCJ1 and amplifying its ITS gene sequence. The ITS sequence of the strain was then compared with the nucleic acid database of type strains in the NCBI website for homology. https: / / blast.ncbi.nlm.nih.gov / Blast.cgi A phylogenetic tree was constructed using the adjacency-joining method with MEGA 11 software.

[0048] In this invention, the salt-tolerant mycobacterium provided by this invention can be applied to the decomposition of insoluble phosphates in soil or water and the treatment of cadmium pollution.

[0049] This invention provides a novel, highly efficient phosphate-solubilizing bacterium, Cladosporium halotolerans TCJ1, which supplements the microbial resource library of phosphate-solubilizing bacteria. The culture conditions and methods for this strain are simple and easy to implement, and it has a strong phosphate-solubilizing ability. It can significantly increase the available phosphorus content in water and soil in a short period of time, and it can also assist in the mineralization of hydroxyapatite to remove the heavy metal cadmium. It can also maintain long-lasting phosphate-solubilizing activity in soil, has strong adaptability, and increases the available phosphorus content in soil. It has good application potential.

[0050] Specifically:

[0051] (1) Dual-function coupling: Simultaneously secreting organic acids to efficiently dissolve insoluble phosphates, significantly increasing the available phosphorus content in soil or water, while utilizing the released phosphate ions to combine with cadmium ions to generate stable mineral Ca. 3.6 (Ca 4.5 Cd 0.76 (PO4)6(OH) 1.6 This allows for the long-term fixation of cadmium.

[0052] (2) Strong resistance: It maintains its activity in high cadmium concentration environments and is functionally stable under neutral to weakly acidic conditions (pH 5.0-7.0), without relying on complex environmental regulation;

[0053] (3) Avoiding the risk of reactivation: Reduce the bioavailability of cadmium through a dual pathway of cadmium mineralization and intracellular enrichment, and avoid the problem of cadmium re-dissolution caused by phosphorus release.

[0054] The present invention provides a microbial agent for decomposing insoluble phosphates, including the salt-tolerant Cladosporium described above.

[0055] In this invention, the microbial agent for decomposing insoluble phosphates may further include a first nutrient solution, wherein the first nutrient solution comprises an aqueous solution containing glucose, ammonium sulfate, sodium chloride, potassium chloride, magnesium sulfate, ferrous sulfate heptahydrate, and manganese sulfate monohydrate.

[0056] In some embodiments of the present invention, each 1000 ml of the first nutrient solution may include 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate, 0.036 g of ferrous sulfate heptahydrate, 0.03 g of manganese sulfate monohydrate, and 1000 mL of distilled water; that is, each 1000 ml of distilled water can dissolve 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate, 0.036 g of ferrous sulfate heptahydrate, and 0.03 g of manganese sulfate monohydrate to prepare the first nutrient solution.

[0057] In some embodiments of the present invention, the microbial agent for decomposing insoluble phosphates may further include a phosphorus source, which may include hydroxyapatite and / or calcium phosphate. In some embodiments of the present invention, the amount of phosphorus source added may be 2.0–3.0 g / (10⁻⁶) based on the CFU number of the salt-tolerant Cladosporium spore suspension. 8 CFU).

[0058] In some embodiments of the present invention, the insoluble phosphates include hydroxyapatite and / or calcium phosphate. In the application environment of the microbial agent for decomposing insoluble phosphates, when the microbial agent for decomposing insoluble phosphates is applied to water, the concentration of insoluble phosphates in the aquatic environment can be 0.2–1.0 g / 100 mL; when applied to soil, the concentration of insoluble phosphates in the soil can be 0.01–0.10 g / g. In some more specific embodiments, when the microbial agent for decomposing insoluble phosphates is applied to water, the concentration of insoluble phosphates in the aquatic environment can be 0.4–0.6 g / 100 mL; when applied to soil, the concentration of insoluble phosphates in the soil can be 0.02–0.04 g / g.

[0059] This invention provides the application of the microbial agent for decomposing insoluble phosphates as described above in increasing the available phosphorus content in soil or water.

[0060] In this invention, salt-tolerant mycobacteria efficiently dissolve insoluble phosphates to generate available phosphorus by secreting organic acids. The types of insoluble phosphates include hydroxyapatite and calcium phosphate.

[0061] In this invention, when the microbial agent for decomposing insoluble phosphates is applied to water, the increase in the effective phosphorus content in the water is not less than 120 mg / L; in some specific embodiments, the increase in the effective phosphorus content in the water can reach 131.96±6.71 mg / L to 170.43±2.90 mg / L. For example, when the microbial agent for decomposing insoluble phosphates is applied to water, the increase in the effective phosphorus content in the water can be 120 to 200 mg / L.

[0062] In this invention, when the microbial agent for decomposing insoluble phosphates is applied to soil, the increase in the available phosphorus content in the soil is not less than 8 mg / kg; in some specific embodiments, the increase in the available phosphorus content in the soil can be 8 to 25 mg / kg.

[0063] In this invention, when the microbial agent for decomposing insoluble phosphates is applied to soil, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / g; When the microbial agent for decomposing insoluble phosphates is applied to water, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / mL. In some more specific embodiments of the present invention, when the microbial agent for decomposing insoluble phosphates is applied to soil, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6~3.0×10 6 CFU / g; When the microbial agent for decomposing insoluble phosphates is applied to water, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~3.0×10 6 CFU / mL.

[0064] In this invention, when the microbial agent for decomposing insoluble phosphates is applied to water, the culture time of strain Cladosporium halotolerans TCJ1 in the water can be 8–20 days. In the application scenarios of the microbial agent for decomposing insoluble phosphates involved in this invention, when the microbial agent for decomposing insoluble phosphates is applied to water, the cadmium content in the water can be 5.0–15.0 mg / L; when the microbial agent for decomposing insoluble phosphates is applied to soil, the cadmium content in the soil can be 1.0–2.0 mg / kg. In some more specific embodiments of this invention, when the microbial agent for decomposing insoluble phosphates is applied to water, the cadmium content in the water can be 8.0–12.0 mg / L; when the microbial agent for decomposing insoluble phosphates is applied to soil, the cadmium content in the soil can be 1.2–1.8 mg / kg.

[0065] Given that the salt-tolerant mycobacterium provided by this invention has the dual function of dissolving insoluble phosphates and fixing cadmium ions, based on this characteristic, the microbial agent for decomposing insoluble phosphates developed by this invention can effectively function in high cadmium concentration environments, achieving simultaneous dissolution of insoluble phosphates and stable fixation of cadmium ions.

[0066] The present invention provides a microbial agent for treating cadmium pollution, including the salt-tolerant mycobacteria described above.

[0067] In this invention, the microbial agent for treating cadmium pollution also includes a phosphorus source, which may include hydroxyapatite and / or calcium phosphate. In some embodiments of this invention, when the microbial agent for treating cadmium pollution is applied to soil, the amount of phosphorus source added can be 1–8 g / (10⁻⁶) based on the CFU number of the halophilic Cladosporium spore suspension. 8 When microbial agents for treating cadmium pollution are applied to water bodies, the amount of phosphorus source added can be 0.01–0.5 g / (10⁻⁶ CFU), based on the CFU count of the salt-tolerant Cladosporium spore suspension. 8 In some more specific embodiments of the present invention, when the microbial agent for treating cadmium pollution is applied to soil, the amount of phosphorus source added can be 1-6 g / (10⁻⁶ CFU), based on the CFU count of the salt-tolerant Cladosporium spore suspension. 8When microbial agents for treating cadmium pollution are applied to water bodies, the amount of phosphorus source added can be 0.01–0.2 g / (10⁻⁶ CFU), based on the CFU count of the salt-tolerant Cladosporium spore suspension. 8 CFU).

[0068] In this invention, the microbial agent for treating cadmium pollution may further include a second nutrient solution. The first nutrient solution may include an aqueous solution containing glucose, ammonium sulfate, sodium chloride, potassium chloride, magnesium sulfate, ferrous sulfate heptahydrate, and manganese sulfate monohydrate. In some embodiments of this invention, each 500 ml of the second nutrient solution may include 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate, 0.036 g of ferrous sulfate heptahydrate, and 0.03 g of manganese sulfate monohydrate.

[0069] In this invention, when the microbial agent for treating cadmium pollution is applied to soil, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / g; When the microbial agent for treating cadmium pollution is applied to water bodies, the dosage of the microbial agent is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / mL.

[0070] In this invention, when the microbial agent for treating cadmium pollution is applied to water, the culture time of strain Cladosporium halotolerans TCJ1 in water can be 10 to 30 days; when the microbial agent for treating cadmium pollution is applied to soil, the culture time of strain Cladosporium halotolerans TCJ1 in water can be 10 to 30 days.

[0071] This invention provides the application of the microbial agent for treating cadmium pollution as described above in the treatment of cadmium pollution in water bodies or soil.

[0072] In this invention, cadmium exists in the water or soil as divalent cadmium, and the cadmium fixation product is Ca. 3.6 (Ca 4.5 Cd 0.76 (PO4)6(OH) 1.6 .

[0073] In this invention, the cadmium removal rate on the 30th day is not less than 99%.

[0074] In this invention, the cadmium content in the water body can be 5.0–15.0 mg / L, and the cadmium content in the soil can be 1.0–2.0 mg / kg; in some more specific embodiments of this invention, the cadmium content in the water body can be 8.0–12.0 mg / L, and the cadmium content in the soil can be 1.2–1.8 mg / kg.

[0075] To facilitate a further understanding of the present invention by those skilled in the art, the following examples are provided:

[0076] Example 1

[0077] Screening and identification of strain Cladosporium halotolerans TCJ1:

[0078] Prepare cadmium stock solution: Weigh 20.317g of cadmium chloride and dissolve it in 500mL of ultrapure water. Stir until dissolved, transfer to a 1L volumetric flask and dilute to the mark. The cadmium concentration of this solution is 10g / L. Transfer to a 1L glass bottle, label it, and use it for later use.

[0079] Prepare cadmium-containing NBRIP phosphate-solubilizing medium with the following formula: 10g glucose, 0.5g ammonium sulfate, 0.3g sodium chloride, 0.3g potassium chloride, 0.3g magnesium sulfate, 0.036g ferrous sulfate heptahydrate, 0.03g manganese sulfate monohydrate, 5g hydroxyapatite, 1mL cadmium stock solution, and 1000mL distilled water. Adjust the pH to 7.0 with 5mol / L NaOH solution or 5mol / L hydrochloric acid solution. The hydroxyapatite used is from Maclean, and the cadmium content of this medium is 10mg / mL. Add 20g agar to the solid medium.

[0080] Prepare PDA solid culture medium with the following formula: 200g potato, 20g glucose, 18g agar, 1000mL distilled water, pH natural.

[0081] All NBRIP solid phosphorus solubilizing medium and related glassware such as petri dishes were sterilized in a high-pressure steam sterilizer at 100 kPa and 121°C for 20 minutes before use.

[0082] The screening of bacterial strains includes the following steps:

[0083] (1) NBRIP solid phosphorus solubilizing medium was placed in the air for 15 min, sealed with sealing film and inverted in a biochemical incubator for 28℃ culture.

[0084] (2) Preliminary screening: Phosphate-solubilizing bacteria were initially screened by observing whether fungal colonies on the plate could produce a clear zone. Fungal colonies with a relatively obvious clear zone were selected and transferred to PDA plates for purification and culture, serving as the initial screening strains for phosphate-solubilizing bacteria. A spore suspension was prepared based on the initial screening strains, with a concentration of approximately 10%.8 CFU / mL.

[0085] (3) Expanded culture: 100 mL of NBRIP liquid culture medium was added to a 250 mL Erlenmeyer flask, and 200 μL of the prepared spore suspension was inoculated. The flask was cultured at 28 °C and 150 rpm / min for 5 days.

[0086] (4) Determination of available phosphorus: After centrifuging 2 mL of culture medium from each strain, take the supernatant and compare the available phosphorus concentration in the culture medium of each strain according to the method for determining available phosphorus content, and screen out the highly efficient phosphorus-solubilizing bacteria TCJ1.

[0087] The colony morphology and single colony growth of TCJ1 selected in Example 1 after 5 days of culture in the culture medium are shown in the figure. Figure 1 After sample pretreatment for scanning electron microscopy (SEM), SEM analysis was performed, and the resulting scanning electron micrographs of cells and spores are shown below. Figure 2 .

[0088] Fungal identification was performed by extracting DNA from fungus TCJ1 and amplifying its ITS gene sequence. The ITS sequence of the strain was then compared with the nucleic acid database of type strains on the NCBI website for homology. https: / / blast.ncbi.nlm.nih.gov / Blast.cgi Using MEGA 11 software, a phylogenetic tree was constructed using the adjacency-join method. The results are as follows: Figure 3 As shown.

[0089] The ITS sequence of this strain, Cladosporium halotolerans TCJ1, is as follows:

[0090] GGTTGACCCGGCCCTCGGGCCGGGATGTTCACAACCCTTTGTTGTCCGACTCTGTTGCCTCCGGGGCGACCCTGCCTCCGGGCGGGGGCCCCGGGTGGACATTTCAAACTCTTGCGTAACTTTGCAGTCT GAGTAAATTTAATTAATAAATTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGC ACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGACGCGGTCCGCCGCGCGCCTCAAATCGACCGGCTGGGTCTTTCGTCCCCT CAGCGTTGTGGAAACTATTCGCTAAAGGGTGCCGCGGGAGGCCACGCCGTGAAACAACCCATTTCTAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAA.

[0091] Example 2

[0092] Quantitative analysis of the phosphorus-solubilizing ability of strain Cladosporium halotolerans TCJ1:

[0093] Prepare the phosphorus-solubilizing medium with the following formula: 10g glucose, 0.5g ammonium sulfate, 0.3g sodium chloride, 0.3g potassium chloride, 0.3g magnesium sulfate, 0.036g ferrous sulfate heptahydrate, 0.03g manganese sulfate monohydrate, 5g hydroxyapatite, and 1000mL distilled water. Adjust the pH to 7.0 with 5mol / L NaOH solution or 5mol / L hydrochloric acid solution. The hydroxyapatite used is from the brand Maclean.

[0094] 100 ml of phosphorus-solubilizing medium was added to a 250 mL Erlenmeyer flask and sterilized in a high-pressure steam sterilizer at 100 kPa and 121 °C for 20 min. Then, 1 mL of the spore suspension prepared in Example 1 was added to a clean bench and placed in a shaker for incubation at 30 °C and 150 rpm / min. Samples were taken periodically, filtered through a 0.22 μm filter, and the inorganic phosphorus content in the solution was quantitatively determined by the phosphomolybdic blue colorimetric method.

[0095] See the graph showing the changes in available phosphorus content and pH value. Figure 4 The soluble phosphorus content can be reduced from insoluble phosphates to 170.43 ± 2.90 mg / L.

[0096] Example 3

[0097] Application of strain Cladosporium halotolerans TCJ1 in the fixation of heavy metal cadmium in water:

[0098] Prepare cadmium stock solution: Weigh 20.317g of cadmium chloride and dissolve it in 500mL of ultrapure water. Stir until dissolved, transfer to a 1L volumetric flask and dilute to the mark. The cadmium concentration of this solution is 10g / L. Transfer to a 1L glass bottle, label it, and use it for later use.

[0099] Preparation of cadmium-fixing experimental solution: To ensure the bacterial agent can function better, add 10g glucose, 0.5g ammonium sulfate, 0.3g sodium chloride, 0.3g potassium chloride, 0.3g magnesium sulfate, 0.036g ferrous sulfate heptahydrate, 0.03g manganese sulfate monohydrate, 0.5g hydroxyapatite, and 1mL cadmium stock solution to 500mL ultrapure water. Transfer to a 1L volumetric flask and make up to volume. Dispense 100mL of the solution into 250mL Erlenmeyer flasks for later use.

[0100] After sterilizing the experimental solution in a high-pressure steam sterilizer at 100 kPa and 121 °C for 20 min, 1 mL of the prepared spore suspension was added in a clean bench and then placed in a shaker and cultured at 30 °C and 150 rpm / min for 30 days. The supernatant was filtered through a 0.22 μm filter and the cadmium content in the water was determined by ICP-OES. The centrifuged precipitate was freeze-dried and then measured by XRD and FTIR.

[0101] The cadmium removal rate reached 99.71% on day 30. The XRD data analysis of the cadmium-fixed products is shown in the figure below. Figure 5 As shown, the FTIR data analysis graph is as follows: Figure 6 As shown, the final product is Ca, which is tightly bound to the salt-tolerant mycobacterium TCJ1. 3.6 (Ca 4.5 Cd 0.76 (PO4)6(OH) 1.6 .

[0102] Example 4

[0103] Determination of phosphorus solubility of strain Cladosporium halotolerans TCJ1 in soil:

[0104] Prepare the nutrient solution for the experiment: Add 10g of glucose, 0.5g of ammonium sulfate, 0.3g of sodium chloride, 0.3g of potassium chloride, 0.3g of magnesium sulfate, 0.036g of ferrous sulfate heptahydrate, and 0.03g of manganese sulfate monohydrate to 500mL of ultrapure water. Transfer to a 1L volumetric flask and make up to volume. Sterilize in a high-pressure steam sterilizer at 100Kpa and 121℃ for 15min and cool for later use.

[0105] Preparation of experimental soil samples: Soil samples from farmland with severe cadmium pollution were collected from Hongsheng Rice Planting Professional Cooperative in Heishan District, Yiyang. After air drying, the samples were ground through a 10-mesh sieve. 15g of soil sample was placed in each sealed and breathable glass culture bottle and sterilized in a high-pressure steam sterilizer at 100Kpa and 121℃ for 30 minutes and then cooled for later use.

[0106] The experiment included three control groups: no treatment (CK), CK+HAP group (0.5g hydroxyapatite), and a control group (CK+TCJ1 group) inoculated with 200μL spore suspension. An experimental group (TCJ1+HAP, T1 group, 0.5g hydroxyapatite) was also included, containing both hydroxyapatite and 200μL spore suspension. To eliminate the influence of other microorganisms, the experiment was conducted in a clean bench. 20mL of nutrient solution was added to each culture bottle to simulate the actual farmland environment. The culture bottles were placed in a 30℃ constant temperature greenhouse and allowed to react for 10 days. Soil samples were then removed, air-dried, ground, and passed through a 10-mesh sieve. The available phosphorus content in the soil was determined using the sodium bicarbonate extraction-molybdenum antimony spectrophotometric method (HJ 704-2014).

[0107] The comparison chart of available phosphorus content of TCJ1 in the soil environment is shown below. Figure 7 It can be seen that under soil conditions, this fungus TCJ1 can increase the soil available phosphorus content by 8.5 mg / kg.

[0108] Example 5

[0109] Application of strain Cladosporium halotolerans TCJ1 in cadmium fixation in soil:

[0110] Preparation of experimental soil samples: Soil samples from farmland with severe cadmium pollution were collected from Hongsheng Rice Planting Professional Cooperative in Heishan District, Yiyang. After air drying, the samples were ground through a 10-mesh sieve. 15g of soil sample was placed in each sealed and breathable glass culture bottle and sterilized in a high-pressure steam sterilizer at 100Kpa and 121℃ for 30 minutes and then cooled for later use.

[0111] The experiment included three control groups: no treatment (CK), CK+HAP group (0.5g hydroxyapatite), and a control group (CK+TCJ group) inoculated with 200μL spore suspension; and experimental group (TCJ1+HAP, T1 group; 0.5g hydroxyapatite) inoculated with both hydroxyapatite and 200μL spore suspension. To eliminate the influence of other microorganisms, the experiment was conducted in a clean bench. 20mL of NBRIP liquid medium was added to each sample bottle to simulate the actual farmland environment. The bottles were placed in a 30℃ constant temperature chamber and allowed to react for 10 days. Soil samples were then removed, air-dried, ground, and sieved through a 10-mesh sieve. A 1mol / L MgCl2 solution was added at a soil-to-liquid ratio of 1:8, and the mixture was shaken at 25℃ and 180rpm / min for 2 hours before filtration. The cadmium content was determined using ICP-OES.

[0112] The comparison chart of cadmium content in the obtained soil samples is shown below. Figure 8 As shown, the TCJ1+HAP group treated with this invention had the highest cadmium removal rate. Compared with the untreated control group CK (1.67±0.03 mg / kg), the cadmium removal rate was significantly lower. 2+ The concentration decreased significantly by 56.80% (p<0.001).

[0113] Comparative Example 1

[0114] Compared to Example 3, all other conditions remained the same in this comparative example, except that the strain Cladosporium halotoleransTCJ1 was replaced with Klebsiella pneumoniae Wn.

[0115] Figure 9 This is a graph showing cadmium ion dissolution and pH changes during the early stage of cadmium fixation. Figure 9 (a) is a graph showing cadmium ion dissolution and pH changes during the early stage of cadmium fixation by Klebsiella pneumoniae (Wn). Figure 9 (b) Graph showing cadmium ion dissolution and pH changes during the early stage of cadmium fixation by strain Cladosporium halotolerans TCJ1. It can be seen that for both Klebsiella pneumoniae Wn and halophilic TCJ1, the cadmium ion dissolution during acid production by halophilic TCJ1 was significantly lower than that by Klebsiella pneumoniae Wn in the short term.

[0116] In addition, the selected salt-tolerant Cladosporium TCJ1 is characterized by slower acid production during phosphorus solubilization, a more gradual change in system pH, and the ability to return to a slightly acidic state in the later stages, with minimal impact on system pH. The content of preliminarily fixed effective cadmium released in the early stages of cadmium fixation is 62.57% lower than that of Klebsiella pneumoniae Wn, which is a significant advantage of salt-tolerant Cladosporium TCJ1 over Klebsiella pneumoniae Wn.

[0117] The above technical solutions of the present invention are merely preferred embodiments of the present invention and do not limit the patent scope of the present invention. All equivalent structural transformations made under the technical concept of the present invention using the contents of the present invention specification and drawings, or direct / indirect applications in other related technical fields, are included in the patent protection scope of the present invention.

Claims

1. A salt-tolerant mycorrhizal fungus, characterized in that, The salt-tolerant Cladosporium halotolerans TCJ1 was deposited at the China General Microbiological Culture Collection Center on August 12, 2024, with accession number CGMCCNo.41487 and Latin classification name Cladosporium halotolerans.

2. A microbial agent for decomposing insoluble phosphates and / or treating cadmium pollution, characterized in that, The microbial agent includes the salt-tolerant spore-forming bacteria as described in claim 1.

3. A microbial agent for decomposing insoluble phosphates, characterized in that, The microbial agent includes the salt-tolerant cladoceran fungus as described in claim 1; The microbial agent further includes a first nutrient solution, wherein the first nutrient solution comprises an aqueous solution containing glucose, ammonium sulfate, sodium chloride, potassium chloride, magnesium sulfate, ferrous sulfate heptahydrate, and manganese sulfate monohydrate, and the phosphorus source comprises hydroxyapatite and / or calcium phosphate.

4. The application of a microbial agent as described in claim 2 or 3 in increasing the available phosphorus content in soil or water.

5. The application according to claim 4, characterized in that, When the microbial agent for decomposing insoluble phosphates is applied to water bodies, the increase in the available phosphorus content in the water body is not less than 120 mg / L; when the microbial agent for decomposing insoluble phosphates is applied to soil, the increase in the available phosphorus content in the soil is not less than 8 mg / kg.

6. The application according to claim 4, characterized in that, When the microbial agent is applied to the soil, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / g; when the microbial agent is applied to water, the amount of the microbial agent added is 1.0 × 10⁻⁶. 6 ~5.0×10 6 CFU / mL.

7. A microbial agent for treating cadmium pollution, characterized in that, The microbial agent includes the salt-tolerant cladocerans as described in claim 1; The microbial agent also includes a phosphorus source, which includes hydroxyapatite and / or calcium carbonate.

8. The application of a microbial agent as described in claim 2 or 7 in the treatment of cadmium pollution in water or soil.

9. The application according to claim 8, characterized in that, In the water or soil, cadmium exists in the form of divalent cadmium, and the cadmium fixation product is Ca. 3.6 (Ca 4.5 Cd 0.76 (PO4)6(OH) 1.6 .

10. The application according to claim 8, characterized in that, The cadmium content in the water body is 5.0–15.0 mg / L, and the cadmium content in the soil is 1.0–2.0 mg / kg.

Images