Pediococcus pentosaceus for preventing and / or treating metabolic diseases

Abstract

The invention relates to pediococcus pentosaceus BGI-N8, a composition containing the pediococcus pentosaceus BGI-N8 as an effective component, and application of the pediococcus pentosaceus BGI-N8, and the preservation number of the pediococcus pentosaceus BGI-N8 is CCTCC (China Center For Type Culture Collection) NO: M20232703. The pediococcus pentosaceus contains a nucleotide sequence of an rpoA gene as shown in SEQ ID NO: 5 and a nucleotide sequence of a pyrG gene as shown in SEQ ID NO: 6. The pediococcus pentosaceus BGI-N8 provided by the embodiment of the invention has good safety and excellent gastrointestinal tract environment tolerance, and can reduce the calorie conversion rate of food by increasing the serum level of energy regulation hormone casein peptide, thereby preventing or treating metabolic diseases such as hyperlipidemia, diabetes mellitus, obesity, fatty liver, hepatic fibrosis and the like.

Description

Technical Field

[0001] This invention relates to the field of microbiology, and more specifically to a Pediococcus pentosaceus, a composition containing it as an active ingredient, and its application. Background Technology

[0002] Numerous studies have shown that high-calorie diets are a major contributing factor to persistently high obesity rates. When people consume excessive amounts of high-calorie foods over a long period, the body often struggles to effectively metabolize this excess energy. These unburned calories are eventually converted into fat, accumulating in the body and leading to significant weight gain and obesity. The World Health Organization (WHO) has officially defined obesity as a chronic metabolic disease that not only affects an individual's appearance but also poses serious health risks. Obesity is closely linked to a range of health complications, such as diabetes, fatty liver disease, liver fibrosis, and even cancer. Furthermore, obesity can damage an individual's mental health, such as diminishing self-esteem, causing mood problems, and potentially triggering mental disorders like depression. Currently, with the continuous rise in global obesity rates, obesity has evolved into an urgent global public health challenge.

[0003] Methods to improve obesity caused by a high-calorie diet include drug therapy, surgical treatment, and dietary and exercise interventions. Regarding drugs, approved medications for long-term weight management include orlistat, phentermine, and naltrexone-bupropion combination preparations. They work through different mechanisms, such as inhibiting fat absorption, reducing hunger, and controlling appetite. Bariatric surgery is mainly suitable for patients with severe obesity or complications. Dietary and exercise interventions focus on adjusting dietary habits, reducing the intake of high-calorie foods, and increasing physical activity to help individuals gradually lose weight and alleviate obesity and related complications. However, all of these methods have inherent limitations. Drug therapy has strict requirements for the applicable population, has low universality, a high probability of weight rebound after discontinuation, and has significant side effects. For example, orlistat may cause indigestion and oily stools; phentermine and naltrexone-bupropion combination preparations may cause palpitations, high blood pressure, nausea, and dry mouth. Surgical procedures are only suitable for severely obese patients and carry the risk of postoperative weight rebound.

[0004] Therefore, there is an urgent need for a safe and effective method to prevent or treat metabolic diseases induced by a high-calorie diet. Summary of the Invention

[0005] This invention aims to at least partially solve one of the technical problems in the related art. To this end, the present invention provides a *Pediococcus pentosaceus* for the prevention or treatment of metabolic diseases caused by a high-calorie diet, a composition containing it as an active ingredient, and its application.

[0006] A first aspect of the present invention provides a Pediococcus pentosaceus containing the nucleotide sequence of the rpoA gene as shown in SEQ ID NO:5 and the nucleotide sequence of the pyrG gene as shown in SEQ ID NO:6.

[0007] In some embodiments, the strain is Pediococcus pentosaceus BGI-N8 with the preservation number CCTCC NO:M20232703.

[0008] A second aspect of the present invention provides a composition comprising an effective amount of Pediococcus pentosaceus as described in any of the first aspects above and optional pharmaceutically or food-acceptable excipients.

[0009] In some embodiments, the composition may further comprise other medicaments for the prevention and / or treatment of metabolic diseases.

[0010] In some embodiments, the composition further comprises prebiotics and / or probiotics.

[0011] In some embodiments, the composition is administered orally, intravenously, intramuscularly, or rectally.

[0012] In some embodiments, the composition is in the form of a powder, granules, capsules, tablets, solution, suspension, syrup, ointment, plaster, suppository, or injection.

[0013] In some embodiments, the composition comprises 1 × 10 based on the total volume or total weight of the composition. 5 Up to 1×10 12 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, preferably 1×10⁻⁶. 6 Up to 1×10 11 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, more preferably 1×10⁻⁶ CFU / mL or CFU / g. 8 Up to 1×10 11 Pediococcus pentosaceus BGI-N8, CFU / mL or CFU / g.

[0014] The use of Pediococcus pentosaceus as described in any embodiment of the first aspect above, or the composition as described in any embodiment of the second aspect above, in the preparation of a medicament for the prevention and / or treatment of metabolic diseases.

[0015] In some embodiments, the metabolic disease is selected from the group consisting of hyperlipidemia, diabetes, obesity, fatty liver, and liver fibrosis.

[0016] In some embodiments, the Pediococcus pentosaceus or the composition is used to increase serum levels of the energy-regulating hormone tyrosinase, selected from the group consisting of: reducing calorie conversion, increasing feed conversion ratio, improving peri-organ fat, and improving liver lesions.

[0017] The embodiments of the present invention achieve the following beneficial effects:

[0018] (1) Pediococcus pentosaccharis has a long history of use in traditional food products, has good safety profile, and is suitable for a wide range of people. At the same time, compared with drug intervention in high-calorie diets, the use of probiotic preparations is less likely to cause side effects, is suitable for long-term use, and does not cause drug dependence. (2) Pediococcus pentosaccharis BGI-N8 can resist the challenges of the gastrointestinal environment such as gastric acid and bile, and has excellent gastrointestinal tolerance, ensuring that its active ingredients can safely reach the intestines and exert their effects. (3) Pediococcus pentosaccharis BGI-N8 can prevent or treat metabolic diseases such as hyperlipidemia, diabetes, obesity, fatty liver, and liver fibrosis by increasing the serum level of the energy-regulating hormone PYY in the body. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in this invention or related technologies, the accompanying drawings used in the description of the embodiments or related technologies will be briefly introduced below. Obviously, the drawings described below are merely embodiments of this invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0020] Figure 1 This is a colony morphology diagram of Pediococcus pentosaceus BGI-N8 in Example 1 of the present invention;

[0021] Figure 2 The calorie conversion rate of the food for each group of rats in Example 3 of this application is shown.

[0022] Figure 3 This refers to the feed weight ratio of each group of rats in Example 3 of this application.

[0023] Figure 4 This refers to the total weight of perirenal and peritesticular fat in each group of rats in Example 3 of this application.

[0024] Figure 5 The serum levels of the energy-regulating hormone PYY in each group of rats in Example 3 of this application are shown.

[0025] Figure 6 The results are Masson staining and HE staining of rat livers in each group in Example 3 of this application. Detailed Implementation

[0026] The present invention will now be described in further detail with reference to specific embodiments. The embodiments given are merely illustrative of the invention and are not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0027] This invention is based on the inventor's following understanding:

[0028] Numerous studies have shown that high-calorie diets are a major contributing factor to persistently high obesity rates. When people consume excessive amounts of high-calorie foods over a long period, the body often struggles to effectively metabolize this excess energy. These unburned calories are eventually converted into fat, accumulating in the body and leading to significant weight gain and obesity. Methods to address obesity caused by high-calorie diets include medication, surgery, and dietary and exercise interventions. Regarding medications, approved long-term weight management drugs include orlistat, phentermine, and naltrexone-bupropion combination preparations, which work through different mechanisms such as inhibiting fat absorption, reducing hunger, and controlling appetite. Bariatric surgery is primarily suitable for severely obese patients or those with complications. Dietary and exercise interventions focus on adjusting dietary habits, reducing the intake of high-calorie foods, and increasing physical activity to help individuals gradually lose weight and alleviate obesity and its related complications. However, all of these methods have inherent limitations. Drug therapy has strict requirements regarding the applicable population, has low universality, a high probability of weight rebound after discontinuation, and carries significant side effects. For example, orlistat may cause indigestion and oily stools; phentermine and naltrexone-bupropion combination preparations may cause side effects such as palpitations, high blood pressure, nausea, and dry mouth. Surgical intervention is only suitable for severely obese patients and carries the risk of postoperative weight rebound.

[0029] Recent research has clearly linked gut microbiota imbalance to obesity, and regulating gut microbiota can effectively improve symptoms of obesity and related complications. Among these findings, live probiotics offer potential benefits as an effective means of gut microbiota regulation in combating weight gain and lipid accumulation caused by high-calorie diets. These probiotics provide a novel natural therapy for weight management by regulating gut microbiota balance, enhancing intestinal barrier function, and reducing inflammatory responses. However, while research on probiotics in weight management has shown some positive effects, current findings are not consistent. Existing research mainly focuses on Lactobacillus and Bifidobacterium, while research on other types of probiotics, such as Pediococcus, is relatively limited.

[0030] In this embodiment of the invention, "probiotics" should be understood as "live microorganisms that, by improving the intestinal microbial environment of the host in the gastrointestinal tract of animals, including humans, have a beneficial effect on the health of the host." When live microorganisms with probiotic activity are provided in the form of dried cells or fermentation products, either as single or multi-strain forms, probiotics can have a beneficial effect on the host's intestinal flora.

[0031] However, probiotics exhibit strain-specificity; different strains may differ in colony morphology, growth characteristics, metabolites, and physiological functions, naturally leading to varying therapeutic effects on patients with functional constipation. Therefore, there is a need to provide strains that can effectively prevent and treat metabolic diseases induced by high-calorie diets, particularly obesity, fatty liver, and liver fibrosis, while also possessing good safety and excellent gastrointestinal tolerance.

[0032] Based on the above-mentioned practical needs, the first aspect of the present invention provides a Pediococcus pentosaceus containing the nucleotide sequence of the rpoA gene as shown in SEQ ID NO: 5 and the nucleotide sequence of the pyrG gene as shown in SEQ ID NO: 6.

[0033] Nucleotide sequence of the rpoA gene in Pediococcus pentosaceus BGI-N8 (SEQ ID NO: 5)

[0034] TTTTAAGCAATTGTATGAACGGACCGAAAGATCTAATTCTTCAATTGTCATTTCAAGCATTTTTTCCTTGTGAGTTTCTTCTTTTTCAACCATAATTTCAGTCTCTTTAGCCTGATCATTAAGGTTAACAAAGATTGCAAGGTGTTCTGTTAAAATTTTAGCAGATAAACTTGTTGCCTCACTAGGAGTGATAGAACCATCAGTCCAAATATCGAGCGTAAGTTTATCATAGTCGTCTCGTTGACCAACACGAGTATTTTCAACTTGATAATTAACACGTTCAATTGGGGTATAAATAGAATCGATTGGTAATACACCGATTGGCATATCAACCTTTCGAGCCTTGTTTTCGTCCGCAGATGTATATCCACGGCCAGTGTCAGCAGTGAGTACTGCATGGAATGTAGTACCTTCAGCTACAGTACAGATTGGTAACTCAGGATTAAGAATCACTACGTCACCGTCTCCCATAATATCGCCAGCAGTTACATTAGCAGGTCCCGCAACATTGATTTCTAATGTTTTATCTTCATCAGATTCAATCTTCAACGAAACCTTCTTAAGATTCAAAATAATTTGTGTTACGTCTTCTACAACACCTTCAATGGTTGAGAATTCATGTAAGACACTATCAATTTGAACGCTAGTAATAGCTGCTCCTGGCAATGATGATAATAGGATACGACGAAGTGAATTACCAAGCGTTGTACCATATCCCCGTTCTAAGGGTTCAATAACAAATCGGCCATAATTGTCATTTTCGTCAATTTTATGAATTTTT

[0035] Nucleotide sequence of pyrG gene in Pediococcus pentosaceus BGI-N8 (SEQ ID NO: 6)

[0036]

[0037] In some embodiments, the strain is Pediococcus pentosaceus BGI-N8 with the preservation number CCTCC NO:M20221486.

[0038] This invention provides a *Pediococcus pentosaceus*, such as... Figure 1 As shown, it belongs to the genus Pediococcus, and is named Pediococcus pentosaceus BGI-N8; the accession number is CCTCC NO:M20232703, the depository is China Center for Type Culture Collection, the address of the depository is No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, China; the postal code is 430072; the deposit date is December 28, 2023.

[0039] In this embodiment of the invention, *Pediococcus pentosaceus* BGI-N8, having the nucleotide sequences shown in SEQ ID NO:5 and SEQ ID NO:6, can be understood by those skilled in the art as the original strain. It is understood that strains such as *Pediococcus pentosaceus* BGI-N8 can undergo spontaneous mutations or be artificially cultured to form variant strains, for example, through nucleotide deletions, additions, or substitutions. The "variant strain" has highly identical gene sequences and extremely similar biological functions to *Pediococcus pentosaceus* BGI-N8. The mutated genes do not substantially affect the conserved sequences of *Pediococcus pentosaceus* BGI-N8, and therefore do not affect the genetic stability of *Pediococcus pentosaceus* BGI-N8. More specifically, this "variant strain" is also a strain of the BGI-N8 species, exhibiting the physiological activities and functional characteristics of the BGI-N8 species.

[0040] The *Pediococcus pentosaceus* BGI-N8 and its variants provided in this invention can reduce the conversion rate of food calories by increasing the serum level of the energy-regulating hormone tyrosinase, thereby preventing or treating metabolic diseases such as hyperlipidemia, diabetes, obesity, fatty liver, and liver fibrosis, while avoiding the drug dependence and side effects associated with traditional drug interventions. Furthermore, probiotic supplementation helps maintain the balance of the intestinal microecology, providing long-term benefits to intestinal health, reducing the risk of metabolic diseases caused by high-calorie diets, and achieving the effect of regulating the body's metabolism. *Pediococcus pentosaceus* BGI-N8 poses no potential harm to the body and has good safety. In addition, it can remain in the gastrointestinal environment for a long time and maintain a high survival rate, exhibiting excellent gastrointestinal tolerance, making it suitable for preventing or improving metabolic diseases caused by high-calorie diets.

[0041] An embodiment of the second aspect of the invention provides a composition comprising an effective amount of Pediococcus pentosaceus as described in any embodiment of the first aspect and optional pharmaceutically or food-acceptable excipients.

[0042] The compositions according to the invention are administered in a pharmaceutically effective amount. As used herein, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio suitable for medical treatment, and an effective dose can be determined by parameters including the type and severity of the patient's disease, drug activity, sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment and concurrent drugs, as well as other parameters well known in the medical field.

[0043] In this invention, "prevention" refers to all actions involving the suppression or delay of the onset of an expected disease, "treatment" refers to all actions involving the improvement or beneficial alteration of the disease and its metabolic abnormalities by applying the composition according to the invention, and "alleviation" refers to all actions involving the reduction of parameters (e.g., the severity of symptoms) associated with the expected disease by applying the composition according to the invention.

[0044] Throughout this specification, when a section “comprises” / “contains” a component, unless otherwise expressly stated, it means that it may also include other components rather than excluding them. When permissible manufacturing and material tolerances (which are inherent in their meaning) are presented, the terms “about” or “substantially” are used in or near numerical values. These terms are intended to prevent unscrupulous infringers from improperly using the disclosure, where accurate or absolute values ​​are cited to aid in understanding the invention.

[0045] The pharmaceutical compositions of the present invention can be administered alone or in combination with other therapeutic agents, sequentially or simultaneously with conventional therapeutic agents, or in single or multiple doses. Taking all the above parameters into consideration, it is important to achieve the maximum effect with the minimum possible dose without producing side effects, and such a dose can be readily determined by those skilled in the art.

[0046] In some embodiments, the composition may further comprise other medicaments for the prevention and / or treatment of metabolic diseases.

[0047] In some embodiments, the composition further comprises prebiotics and / or probiotics.

[0048] In some embodiments, the composition is administered orally, intravenously, intramuscularly, or rectally.

[0049] In some embodiments, the composition is in the form of a powder, granules, capsules, tablets, solution, suspension, syrup, ointment, plaster, suppository, or injection.

[0050] In some embodiments, the pharmaceutically acceptable excipient is, for example, a carrier, excipient, diluent, adjuvant, medium, excipient, carrier or combination thereof, and / or other substances having a concentration that does not affect the activity of the microorganism, which is not limited by the present invention.

[0051] The term "pharmaceutically acceptable carrier" refers to any formulation or carrier medium capable of delivering an effective amount of the active substance of this invention without interfering with the biological activity of the active substance and without toxic side effects on the host or patient. Representative carriers include water, oil, vegetables and minerals, ointment bases, lotion bases, and ointment bases. These bases include suspending agents, thickeners, transdermal penetration enhancers, etc. Their formulations are well known to those skilled in the art of cosmetics or topical pharmaceuticals. For further information on carriers, see Remington: The Science and Practice of Pharmacy, 21st Ed., Lippincott, Williams & Wilkins (2005), the contents of which are incorporated herein by reference.

[0052] In some embodiments, the composition comprises 1 × 10 based on the total volume or total weight of the composition. 5 Up to 1×10 12 (e.g. 1×10) 6 1×10 7 1×10 8 1×10 9 1×10 10 1×10 11 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, preferably 1×10⁻⁶. 10 Up to 1×10 11 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, more preferably 1×10⁻⁶ CFU / mL or CFU / g. 8 Up to 1×10 11 Pediococcus pentosaceus BGI-N8, CFU / mL or CFU / g.

[0053] Understandably, probiotics are prepared into powder through conventional microbial industrial processes such as high-density fermentation, filtration and centrifugation, freeze-drying, or spray drying, with a live bacteria count of 1.0 × 10⁻⁶. 5 Up to 1.0×10 12 CFU / g. The above-mentioned bacterial powder can be prepared in various forms as described above for application. In some embodiments, the bacterial powder is dissolved in water to obtain different bacterial concentrations (e.g., 50 billion CFU / ml).

[0054] The embodiments of the third aspect of the present invention propose the use of Pediococcus pentosaceus as described in any embodiment of the first aspect or the composition as described in any embodiment of the second aspect in the preparation of a medicament for the prevention and / or treatment of metabolic diseases.

[0055] In some embodiments, the metabolic disease is selected from the group consisting of hyperlipidemia, diabetes, obesity, fatty liver, and liver fibrosis.

[0056] In some embodiments, the Pediococcus pentosaceus or the composition is used to increase serum levels of the energy-regulating hormone tyrosinase, selected from the group consisting of: reducing calorie conversion, increasing feed conversion ratio, improving peri-organ fat, and improving liver lesions.

[0057] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0058] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0059] The experimental materials used in the embodiments of this invention are as follows:

[0060] MRS broth culture medium (product number 027319, purchased from Huankai Microbial Technology Co., Ltd.) has the following formula (per liter): peptone 10.0g, beef extract 10.0g, yeast powder 5.0g, glucose 20.0g, sodium acetate 5.0g, diammonium hydrogen citrate 2.0g, Tween-80 1.0mL, dipotassium hydrogen phosphate 2.0g, magnesium sulfate heptahydrate 0.2g, and manganese sulfate heptahydrate 0.05g. Instructions for use: Take 55.25g of this product, add 1000mL of deionized or distilled water, adjust the pH to 6.2–6.4, and sterilize in an autoclave at 121℃ for 15 minutes.

[0061] MRS agar medium is prepared by adding 20 g / L agar to the formula of MRS broth medium, adjusting the pH to 6.2-6.4, and then sterilizing it in an autoclave at 121°C for 15 min.

[0062] Bacterial genomic DNA extraction kit (catalog number DP302, purchased from Tiangen Biotech Beijing Co., Ltd.), phosphate buffered saline (PBS, catalog number B640011, purchased from Sangon Biotech Shanghai Co., Ltd.).

[0063] The remaining experimental materials and equipment were common consumables and equipment used in microbiology laboratories.

[0064] Example 1: Screening, identification and preservation of Pediococcus pentosaceus BGI-N8

[0065] In this embodiment, Pediococcus pentosaceus BGI-N8 was isolated, identified, and preserved.

[0066] (1) Isolation of strains

[0067] One sample of traditional Chinese homemade fermented yogurt was collected and placed in an anaerobic chamber. 0.2 g of the fermented yogurt sample was mixed in 1 mL of sterile phosphate-buffered saline (PBS) and then serially diluted. The dilutions were from 10⁻⁶ to 10⁻⁶. 4 Take 100 μL of the sample diluted 1:1, plate it on MRS agar, and incubate anaerobically at 37°C for 48 to 72 hours. Then, select a single colony for streak isolation to obtain a pure culture strain. See the colony image for details. Figure 1 The colonies of this strain are round on the plate, with relatively neat edges and clear boundaries. They are milky white or milky yellow, and the colonies are smooth, moist and have a distinct luster.

[0068] (2) Identification of strains

[0069] DNA was extracted from the isolated pure culture strain using a bacterial genomic DNA extraction kit. Multiple sequence analysis (MLST) was performed using the extracted genomic DNA as a template to accurately identify the species. Housekeeping gene loci included the rpoA and pyrG genes. The base sequences of the PCR primers used are shown in Table 1. The PCR amplification products were sequenced using the Sanger method to obtain the rpoA and pyrG gene sequences of the strain (SEQ ID NO:5 and SEQ ID NO:6). By comparing these gene sequences with the NCBI database, the strain with the highest homology was identified as *Pediococcus pentosaceus*, which was named *Pediococcus pentosaceus* BGI-N8.

[0070] Table 1. Amplification sites and primer sequences for Multiple Site Sequence Analysis (MLST)

[0071]

[0072] (3) Preserved strains

[0073] Pediococcus pentosaceus BGI-N8 strain was deposited at the China Center for Type Culture Collection (CCTCC); accession number: CCTCC NO: M20232703; address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, 430072, China; deposit date: December 28, 2023.

[0074] Example 2: Gastrointestinal environment tolerance of Pediococcus pentosaceus BGI-N8

[0075] This embodiment evaluated the tolerance of *Pediococcus pentosaceus* BGI-N8 to a simulated human gastrointestinal environment. The *Pediococcus pentosaceus* BGI-N8 strain was activated and counted using conventional methods. The bacterial suspensions were placed in simulated gastric fluid (pH=3.0), simulated intestinal fluid (pH=6.8), and MRS liquid medium containing 0.3% bile salts (prepared using the aforementioned MRS broth medium (catalog number 027319, purchased from Huankai Microbial Technology Co., Ltd.)) and incubated at 37°C for 2 hours. The initial viable count was taken as 100% survival rate. Viable counts were performed at the end of the experiment for each group, and the survival rate (%) was calculated as 100% × viable count after 2 hours / initial viable count.

[0076] Table 2. Gastrointestinal environment tolerance of Pediococcus pentosaceus BGI-N8

[0077]

[0078] The gastrointestinal environment tolerance of *Pediococcus pentosaceus* BGI-N8 is shown in Table 2. The survival rate of *Pediococcus pentosaceus* BGI-N8 after 2 hours under gastric acid conditions was (75.40±2.80)%, the survival rate after 2 hours under simulated small intestinal fluid conditions was (88.50±5.08)%, and the survival rate after 2 hours under 0.3% bile salt conditions was (85.80±5.31)%. These results indicate that *Pediococcus pentosaceus* BGI-N8 in this embodiment of the invention exhibits excellent tolerance to gastric acid, intestinal fluid, and bile salts in the gastrointestinal system, and can survive in the gastrointestinal tract, which is a prerequisite for it to exert its probiotic effects.

[0079] Example 3: In vivo study of the efficacy of Pediococcus pentosaceus BGI-N8 in improving high-calorie diets.

[0080] Fifty 6-week-old SPF-grade male SD rats were used to study the in vivo efficacy of Pediococcus pentosaceus BGI-N8 in improving a high-calorie diet. The maintenance diet used in the experiment was formulated according to the nutritional composition of compound feed for laboratory animals in GB 14924.3-2010, with a calorie value of 3.87 kcal / g. The high-calorie diet consisted of 57.6% maintenance diet plus 20.0% sucrose, 15.0% lard, 5% casein, 1.2% cholesterol, 0.6% dicalcium phosphate, 0.4% limestone powder, and 0.2% sodium cholate, with a calorie value of 4.69 kcal / g.

[0081] After acclimatization for 7 days, rats were randomly divided into 5 groups according to their body weight: normal control group (experimental group A), model control group (experimental group B), low-dose BGI-N8 intervention group (experimental group C), medium-dose BGI-N8 intervention group (experimental group D), and high-dose BGI-N8 intervention group (experimental group E). Experimental group A was fed a maintenance diet, while the remaining groups were fed a high-calorie diet. Experimental groups E and C were administered BGI-N8 bacterial suspension by gavage once daily, with each gavage dose being 1 mL, containing 1.0 × 10⁻⁶ cells. 5 CFU, 1.0×10 7 CFU, 1.0×10 9 The experimental group (A and B) was administered CFU of Pediococcus pentosaceus BGI-N8 via gavage daily with an equal volume of sterile saline for 35 days. Rats' body weight and food intake were recorded weekly. At the end of the experiment, rats were dissected to measure visceral fat weight, and livers were collected for Masson and HE staining to observe histopathological changes. The experimental results are shown in the attached figures. * indicates a difference between this group and the model control group (p < 0.05), ** indicates a significant difference (p < 0.01), and *** indicates an extremely significant difference (p < 0.001).

[0082] The food calorie conversion rate of rats in each group is shown in the figure. Figure 2 After consuming the same amount of calories, the food energy conversion rate of the model control group, which only consumed a high-calorie diet, was (19.945±3.660)%. However, when different doses of Pediococcus pentosaceus BGI-N8 were administered while feeding a high-calorie diet, the lowest food energy conversion rate was (14.413±1.671)%, meaning that the use of BGI-N8 reduced energy conversion by up to 27.74%. These results indicate that taking Pediococcus pentosaceus BGI-N8 while on a high-calorie diet can significantly reduce the conversion rate of ingested food calories into body weight.

[0083] The feed conversion ratio data for each group of rats are shown below. Figure 3 The data indicate the amount of food required to gain 1 gram of body weight. In the model control group rats that only consumed a high-calorie diet, the amount of food required to gain 1 gram of body weight was (4.906±0.682) g. However, when fed a high-calorie diet and ingested different doses of Pediococcus pentosaceus BGI-N8, the feed conversion ratio reached as high as (7.023±0.815) g. These results indicate that the use of Pediococcus pentosaceus BGI-N8 significantly improved the feed conversion ratio of rats on a high-calorie diet.

[0084] The weights of perirenal and peritesticular fat in each group of rats are shown in the figure. Figure 4The data indicate the accumulation of body fat in rats under a high-calorie diet. In the model control group, which only consumed a high-calorie diet, the total weight of perirenal and peritesticular fat was (18.284±4.958) g. In contrast, the intervention groups that were simultaneously fed Pediococcus pentosaceus BGI-N8 had the lowest fat weight, which was (10.909±4.098) g. This suggests that the use of Pediococcus pentosaceus BGI-N8 can effectively improve the increase of local fat, especially visceral fat, caused by a high-calorie diet.

[0085] Serum levels of the energy-regulating hormone tyrosine peptide (PYY) in each group of rats are shown in the table below. Figure 5 After consuming a high-calorie diet, the serum level of the energy-regulating hormone tyrosine peptide (PYY) in rats decreased. However, when the rats were fed a high-calorie diet, intervention with Pediococcus pentosaceus BGI-N8 significantly increased the serum PYY content.

[0086] The results of liver histopathological analysis are shown in Figure 6 In the Masson staining results of the liver, the fibrosis of the liver tissue of rats treated with different doses of Pediococcus pentosus BGI-N8 was significantly reduced compared with the model control group. In the HE staining results of the liver, the degree of steatosis in the liver of rats treated with different doses of Pediococcus pentosus BGI-N8 was significantly improved compared with the model control group, and the degree of improvement was directly proportional to the dose.

[0087] The above results indicate that Pediococcus pentosaceus BGI-N8 can significantly improve hepatic steatosis and hepatic fibrosis induced by a high-calorie diet in rats, and its effect is directly proportional to the dose.

[0088] In the description of this specification, the references to terms such as "one embodiment," "some embodiments," "example," "specific example," or "some examples," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the present invention. In this specification, the illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples. Moreover, without contradiction, those skilled in the art can combine and integrate the different embodiments or examples described in this specification, as well as the features of different embodiments or examples.

[0089] It should be noted that, in this document, relational terms such as "first" and "second" are used merely to distinguish one entity or operation from another, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Furthermore, the term "comprising" or any other variations thereof is intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such a process, method, article, or apparatus. Without further limitations, an element defined by the phrase "comprising one..." does not exclude the presence of other identical elements in the process, method, article, or apparatus that includes said element.

[0090] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A type of Pediococcus pentosaceus, characterized in that, It includes the nucleotide sequence of the rpoA gene as shown in SEQ ID NO: 5 and the nucleotide sequence of the pyrG gene as shown in SEQ ID NO:

6.

2. The *Pediococcus pentosaceus* according to claim 1, characterized in that, The strain is Pediococcus pentosaceus BGI-N8, which has the preservation number CCTCCNO:M20232703.

3. A composition, characterized in that, It contains an effective amount of Pediococcus pentosaceus as described in claim 1 or 2 and optional pharmaceutically or food-acceptable excipients.

4. The composition according to claim 3, characterized in that, It also includes other medications for the prevention and / or treatment of metabolic diseases; Optionally, the composition may further comprise prebiotics and / or probiotics.

5. The composition according to claim 3 or 4, characterized in that, The composition is administered orally, intravenously, intramuscularly, or rectally.

6. The composition according to any one of claims 3 to 5, characterized in that, The composition is in the form of powder, granules, capsules, tablets, solutions, suspensions, syrups, ointments, plasters, suppositories, or injections.

7. The composition according to any one of claims 3 to 6, characterized in that, Based on the total volume or total weight of the composition, the composition contains 1×10 5 Up to 1×10 12 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, preferably 1×10⁻⁶. 6 Up to 1×10 11 Pediococcus pentosaceus BGI-N8 at CFU / mL or CFU / g, more preferably 1×10⁻⁶ CFU / mL or CFU / g. 8 Up to 1×10 11 Pediococcus pentosaceus BGI-N8, CFU / mL or CFU / g.

8. The use of Pediococcus pentosaceus as described in claim 1 or 2, or the composition as described in any one of claims 3 to 7, in the preparation of a medicament for the prevention and / or treatment of metabolic diseases.

9. The application according to claim 8, characterized in that, The metabolic diseases were selected from the group consisting of hyperlipidemia, diabetes, obesity, fatty liver, and liver fibrosis.

10. The application according to claim 9, characterized in that, The Pediococcus pentosaceus or the composition is used to increase serum levels of the energy-regulating hormone tyrosinase, selected from the group consisting of: reducing calorie conversion, increasing feed conversion ratio, improving peri-organ fat, and improving liver lesions.

Images