Bacterial strain with obesity prevention and treatment effect and application thereof

By regulating lipid metabolism and improving insulin sensitivity through Lactobacillus paracasei Biohalo27, the treatment and prevention challenges of obesity and related metabolic diseases have been solved, achieving significant anti-obesity and metabolic abnormality improvement effects.

CN120944779APending Publication Date: 2025-11-14ZHIYU MEDICAL TECH (SHANDONG) CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202511453523.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-13
Publication Date
2025-11-14

AI Technical Summary

Technical Problem

There is a lack of effective and safe non-pharmacological interventions for the treatment and prevention of obesity and related metabolic diseases such as type 2 diabetes and non-alcoholic fatty liver disease. Current probiotic therapies have limitations in regulating the gut microbiota and improving metabolic abnormalities.

Method used

Using Lactobacillus paracasei Biohalo27 strain, microbial agents or products were prepared for the prevention and treatment of obesity by regulating lipid metabolism, improving insulin sensitivity, inhibiting inflammatory response, and reducing hepatic steatosis.

Benefits of technology

It significantly reduces abnormal accumulation of abdominal fat, inhibits metabolic inflammatory response, alleviates hepatic steatosis, improves glucose metabolism, lowers serum triglyceride and cholesterol levels, enhances insulin sensitivity, and provides anti-obesity and prevention and treatment effects for related metabolic diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120944779A_ABST
    Figure CN120944779A_ABST
Patent Text Reader

Abstract

The invention discloses a bacterial strain with an effect of preventing and treating obesity and application of the bacterial strain, the bacterial strain is Lactobacillus paracasei Biohalo 27, the bacterial strain is preserved in China General Microbiological Culture Collection Center (CGMCC), the preservation number is CGMCC NO.34917, the preservation number is CGMCC NO.34917, the preservation number is CGMCC NO.34917, the preservation number is CGMCC NO.34917, the preservation number is CGMCC NO.34917, and the preservation number is CGMCC NO.34917. The preservation time is June 16, 2025; according to the invention, a strain with the effect of preventing and treating obesity is obtained by screening, and the lactobacillus paracasei Biohalo 27 plays an anti-obesity role by regulating lipid metabolism, improving insulin sensitivity, inhibiting inflammatory response and relieving liver fatty degeneration; and important experimental basis and theoretical support are provided for application of the novel probiotic preparation in prevention and treatment of obesity and related metabolic diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, specifically to a strain with anti-obesity effects and its applications. Background Technology

[0002] Obesity is closely related to long-term excessive intake of energy-intensive diets, especially those rich in saturated fats, long-chain fatty acids, and refined carbohydrates. After these nutrients are metabolized in the body, excess energy is stored as triglycerides (TG) in adipocytes of white adipose tissue (WAT). With continued high energy intake, adipocytes undergo hypertrophic expansion due to excessive triglyceride accumulation, leading to hypoxia and dysfunction of adipose tissue. Hypoxic adipose tissue triggers oxidative stress (OS) and chronic low-grade inflammation, becoming a key pathological basis for the development of obesity-related chronic noncommunicable diseases (NCDs). Overweight or obesity is often accompanied by a series of metabolic abnormalities, including impaired glucose tolerance (IGT), insulin resistance (IR), type 2 diabetes mellitus (T2DM), hypertension, dyslipidemia, hyperuricemia, and gout. These metabolic abnormalities often promote each other and coexist, forming a vicious cycle, further accelerating the process of atherosclerosis and increasing the risk of serious complications such as cardiovascular disease (CVD) and chronic kidney disease (CKD). Among obesity-related metabolic diseases, type 2 diabetes mellitus (T2DM) and non-alcoholic fatty liver disease (NAFLD) are particularly prominent. Their pathogenesis involves multiple interrelated pathophysiological processes such as insulin resistance, chronic inflammation, lipotoxicity, and mitochondrial dysfunction.

[0003] In recent years, with the in-depth development of probiotic research, increasing evidence suggests that specific probiotic strains can effectively reduce abdominal fat accumulation and improve metabolic abnormalities in obese individuals. Multiple studies have confirmed that probiotics, represented by lactic acid bacteria, possess multiple physiological functions, including enhancing intestinal barrier function, regulating glucose and lipid metabolism, lowering serum cholesterol levels, inhibiting weight gain, and enhancing immune regulation. These findings provide new research directions for non-pharmacological interventions for obesity and related metabolic diseases. Probiotics demonstrate unique advantages in improving obesity and related metabolic disorders by regulating the balance of the gut microbiota, while avoiding the adverse reactions that may arise from traditional drug treatments. Existing research indicates that specific probiotic strains not only have significant anti-obesity effects but can also effectively improve obesity-related comorbidities such as type 2 diabetes, dyslipidemia, metabolic syndrome, and colorectal cancer. Their mechanisms of action may involve multiple aspects: 1) regulating oxidative stress (OS) levels; 2) improving chronic low-grade inflammation; 3) correcting gut microbiota dysbiosis; 4) enhancing insulin sensitivity; 5) regulating the secretion of adipokines (such as adiponectin and leptin); and 6) inhibiting abnormal weight gain. These findings offer new insights into obesity prevention and treatment strategies, and targeted interventions in the gut microbiota hold promise for establishing safer and more effective obesity management programs. Probiotic therapy, as a potential alternative or adjunctive treatment, shows broad application prospects in the prevention and treatment of metabolic diseases.

[0004] In view of this, the present invention is hereby proposed. Summary of the Invention

[0005] The purpose of this invention is to provide a strain with anti-obesity effects and its application. The strain of this invention can regulate lipid metabolism, improve insulin sensitivity, inhibit inflammatory response and reduce hepatic steatosis, thereby exerting an anti-obesity effect.

[0006] In order to achieve the above-mentioned objectives of the present invention, the following technical solution is adopted: The first aspect of this invention provides a strain with anti-obesity effects, wherein the strain is Lacticaseibacillus paracasei Biohalo27, which is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC NO.34917; the deposit date is June 16, 2025.

[0007] A second aspect of the present invention provides a microbial agent containing the strain described above that has the effect of preventing and treating obesity.

[0008] Preferably, the microbial agent is obtained by inoculating the strain with the effect of preventing and treating obesity into a culture medium and then culturing it.

[0009] A third aspect of the present invention provides the application of the strain or microbial agent with the effect of preventing and treating obesity in the preparation of products for preventing and treating obesity.

[0010] Preferably, the obesity prevention and treatment product has at least one of the following functions (1) to (8):

[0011] (1) Treatment of obesity;

[0012] (2) Reduce abnormal accumulation of abdominal fat;

[0013] (3) Inhibit metabolic inflammatory responses;

[0014] (4) Reduces hepatic steatosis;

[0015] (5) Reduces non-alcoholic fatty liver disease;

[0016] (6) Reduce serum triglyceride, total cholesterol and low-density lipoprotein levels;

[0017] (7) Improves glucose metabolism;

[0018] (8) Reduce fasting blood glucose and insulin levels, and enhance insulin sensitivity.

[0019] A fourth aspect of the present invention provides a product having an effect in preventing and treating obesity, the product comprising the strain having the effect in preventing and treating obesity or the microbial agent.

[0020] Preferably, the viable count of the strain with anti-obesity effects is not less than 1×10⁻⁶. 7 cfu / g.

[0021] Preferably, the number of cells in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

[0022] Compared with the prior art, the beneficial effects of the present invention include at least the following:

[0023] The present invention screened a strain with anti-obesity effects. This strain, Lactobacillus paracasei Biohalo 27, exerts its anti-obesity effect by regulating lipid metabolism, improving insulin sensitivity, inhibiting inflammatory response and reducing hepatic steatosis. It provides important experimental evidence and theoretical support for the application of novel probiotic preparations in the prevention and treatment of obesity and related metabolic diseases. Attached Figure Description

[0024] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, the elements or parts are not necessarily drawn to scale.

[0025] Figure 1 The figure shows the morphological characteristics of Biohalo27 in Example 1 of the present invention. (A) Colony morphology of Biohalo27; (B) Morphology of Biohalo27 after staining under a light microscope.

[0026] Figure 2 This is the phylogenetic tree of Biohalo27 in Embodiment 1 of the present invention;

[0027] Figure 3 The figure shows the effect of Lactobacillus paracasei Biohalo 27 on body weight and abdominal adipose tissue in Example 2 of the present invention. In the figure, (A) is the initial body weight; (B) is the final body weight; (C) is the weight gain rate; and D is a picture of abdominal fat in rats.

[0028] Figure 4 The figure shows the effect of Lactobacillus paracasei Biohalo 27 on serum biochemical markers in rats fed a high-fat diet (HFD) in Example 2 of this invention. In the figure, (A) is triglycerides, (B) is total cholesterol, (C) is low-density lipoprotein cholesterol, and (D) is low-density lipoprotein cholesterol / high-density lipoprotein cholesterol.

[0029] Figure 5 To illustrate how *Lactobacillus paracasei* (Biohalo) alleviates inflammation in rats on a high-fat diet in Example 2 of this invention, the figures show: (A) serum MCP-1; (B) serum IL-6; (C) serum TNF-α; (D) F4 / 80 immunostaining of adipose tissue obtained from sacrificed rats at the end of the experimental period; (E) the percentage of positive F4 / 80 immunostaining areas in the adipose tissue obtained from sacrificed rats at the end of the experimental period; (F) expression of the pro-inflammatory cytokine IL-6 gene in adipose tissue; and (G) expression of the pro-inflammatory cytokine TNF-α gene in adipose tissue.

[0030] Figure 6This figure illustrates the effects of *Lactobacillus paracasei* Biohalo 27 on insulin resistance and glucose metabolism induced by a high-fat diet in Example 2 of this invention. In the figure, (A) is the initial blood glucose level; (B) is the blood glucose concentration in the glucose tolerance test after 12 hours of fasting in rats at week 8; (c) is the area under the curve in the glucose tolerance test after 12 hours of fasting in rats at week 8; (D) is the fasting blood glucose level at week 12; (E) is the fasting insulin level at week 12; (F) is the assessment of the insulin resistance homeostasis model; (G) is the expression of the insulin sensitivity regulation-related gene IRS-1 in adipose tissue; and (H) is the expression of the insulin sensitivity regulation-related gene PPAR-γ in adipose tissue.

[0031] Figure 7 To illustrate the ameliorative effect of *Lactobacillus paracasei* Biohalo 27 on metabolic disorders in NAFLD rats in Example 2 of this invention, the figures show: (A) serum alanine aminotransferase levels in each group for liver function assessment; (B) serum aspartate aminotransferase levels in each group for liver function assessment; (C) Oil Red O staining results; (D) percentage of lipid area to total area; (E) liver CHO expression; (F) liver TG expression; (G) expression of the adipogenesis-related gene SREBP-1c in the liver; and (H) expression of the adipogenesis-related gene FAS in the liver. Detailed Implementation

[0032] The embodiments of the technical solution of the present invention will be described in detail below with reference to the examples. The following embodiments are only used to illustrate the technical solution of the present invention more clearly, and are therefore only examples, and should not be used to limit the scope of protection of the present invention.

[0033] It should be noted that, unless otherwise stated, the technical or scientific terms used in this application should have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.

[0034] This invention provides a strain with anti-obesity effects. The strain is Lacticaseibacillus paracasei Biohalo27, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917 and deposit date of June 16, 2025.

[0035] The present invention screened a strain with anti-obesity effects. This strain, Lactobacillus paracasei Biohalo 27, exerts its anti-obesity effect by regulating lipid metabolism, improving insulin sensitivity, inhibiting inflammatory response and reducing hepatic steatosis. It provides important experimental evidence and theoretical support for the application of novel probiotic preparations in the prevention and treatment of obesity and related metabolic diseases.

[0036] Another embodiment of the present invention provides a microbial agent containing the strain with the effect of preventing and treating obesity.

[0037] In one embodiment, the microbial agent is obtained by inoculating the strain with the anti-obesity effect into a culture medium and culturing it.

[0038] Another embodiment of the present invention provides the application of the strain or microbial agent with the effect of preventing and treating obesity in the preparation of products for preventing and treating obesity.

[0039] In one embodiment, the obesity prevention product has at least one of the following functions (1) to (8):

[0040] (1) Treatment of obesity;

[0041] (2) Reduce abnormal accumulation of abdominal fat;

[0042] (3) Inhibit metabolic inflammatory responses;

[0043] (4) Reduces hepatic steatosis;

[0044] (5) Reduces non-alcoholic fatty liver disease;

[0045] (6) Reduce serum triglyceride, total cholesterol and low-density lipoprotein levels;

[0046] (7) Improves glucose metabolism;

[0047] (8) Reduce fasting blood glucose and insulin levels, and enhance insulin sensitivity.

[0048] In another embodiment of the present invention, a product having an effect in preventing and treating obesity is provided, the product comprising the strain having an effect in preventing and treating obesity or the microbial agent.

[0049] In one embodiment, the viable count of the strain having an anti-obesity effect is not less than 1 × 10⁻⁶. 7 cfu / g.

[0050] In one embodiment, the number of cells in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

[0051] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0052] Example 1

[0053] This example demonstrates the screening and identification of Lactobacillus paracasei Biohalo27;

[0054] The *Lacticaseibacillus paracasei* Biohalo27 strain of this invention was screened and deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917; the deposit date was June 16, 2025.

[0055] 1. Bacterial identification

[0056] (1) Morphological identification: Take a clean glass slide, take a small amount of bacterial suspension with a sterile inoculation loop, and spread it evenly on the slide to form a thin layer. Let the slide air dry naturally, or gently heat it with an alcohol lamp flame to accelerate drying. Pass the dried slide through an alcohol lamp flame 2-3 times to fix the bacteria on the slide. Be careful not to overheat it to avoid destroying the bacterial morphology. Add crystal violet solution to the slide, covering the entire slide, let it stand for 1 minute, and gently rinse with distilled water to remove excess staining solution. Add iodine solution, cover the slide, let it stand for 1 minute, and rinse with distilled water to remove excess iodine solution. Add 95% ethanol, gently shake the slide until no more purple dye flows out (usually about 10-30 s). Rinse immediately with distilled water to stop the decolorization process. Add safranin solution, cover the slide, and let it stand for 1 min. Rinse with distilled water to remove excess staining solution. Gently blot the slide dry with absorbent paper or allow it to air dry. Add a drop of cedarwood oil to the slide and observe using an oil immersion microscope (100x objective). Record the morphology, arrangement, and staining characteristics of the bacteria.

[0057] (2) Molecular biological identification: The 16S rRNA and pheS gene sequences of the strain were sequenced.

[0058] 2. Results

[0059] 1) Morphological identification results of the fungal strain, such as Figure 1 As shown, Figure 1 In the image, (A) the colony morphology of Biohalo27 and (B) the morphology of Biohalo27 after staining under a light microscope;

[0060] Depend on Figure 1 As can be seen, the colony characteristics are mainly round, smooth, and milky white. Under a microscope, they are rod-shaped, arranged singly, in pairs, or in short chains, and appear purple. Based on this, Biohalo27 can be identified as a Gram-positive bacterium.

[0061] 2) Molecular biological identification of bacterial strains

[0062] pheS gene sequence as SEQ ID Shown in NO:2, specifically CAGACAGTCCAATGCAGGCGCGGACAATGGAAAAGCACGACTTTACCAAAGGACCGCTGAAAATGATTAGCCCTGGGGTGGTTTATCGACGTGATGACGACGATGCTACTCATAGCCATCAGTTTCACCAGATGGAAGGACTCGTCATTGACAAGCATATAACCATGGCTGATCTAAAGGGAACCTTGTTGGCCATGTGCCAACAC GTGTTTGGTAAAGATCGGACAATTCGCTTGCGGCCAAGTTATTTTCCATTTACGGAGCCATCCGTTGAAGTTGATGTTTCCTGTTTTCGTTGCGGCGGTAAAGGTTGCCCGGTTTGCAAATATACCGGTTGGATTGAAGTGTTAGGTGCCGGCATGGTGCATCCCAATGTGCTACGGGCAGCGAACATTGATGCTGACGTATACGGCGGCTTTGC.

[0063] 3) Phylogenetic tree analysis

[0064] The obtained sequencing sequences were compared with sequences with high similarity selected from the NCBI database using BLAST, and a phylogenetic tree was constructed using MEGA11.0 (e.g., Figure 2 As shown in the figure, strain Biohalo27 is on the same branch as Lactobacillu spuracuseisubsp. and has 100% homology, so the strain is named Lactobacillu spuracusei Biohalo27.

[0065] Example 2

[0066] This embodiment is a study on the efficacy of Lacticaseibacillus paracasei Biohalo27 in preventing and treating obesity.

[0067] 1. Experimental Methods

[0068] 1) Preparation of Lactobacillus paracasei Biohalo 27

[0069] Lactobacillus paracasei Biohalo 27 (Biohalo 27 for short) was inoculated into MRS liquid medium and incubated at 37°C for 12 hours. After incubation, the bacterial cells were collected by centrifugation and washed twice with phosphate-buffered saline (PBS, pH 7.4) to remove residual culture medium. The bacterial suspension was resuspended in PBS, then mixed with cryoprotectant, pre-frozen, and lyophilized to obtain Biohalo 27 bacterial powder.

[0070] 2) Laboratory animals and group design

[0071] Five-week-old weaned male Sprague-Dawley (SD) rats were purchased from MouseBerry Biotechnology Co., Ltd. (Wuhan, Hubei). The animals were housed in standard plastic cages, eight rats per group, under controlled temperature (25±1℃) and humidity (50±10%) conditions, maintaining a 12-hour light / dark cycle, with free access to water and feed. After one week of acclimatization, the animals were randomly divided into four groups (n=8 / group) based on body weight:

[0072] (1) Normal control group (NC): fed standard feed and gavaged with 1 mL of reverse osmosis (RO) water daily;

[0073] (2) High-fat diet group (HFD): fed with high-fat diet and gavaged with 1 mL of RO water daily;

[0074] (3) High-fat diet + Biohalo 27 low dosage group (HFD+Low dosage): fed with high-fat diet and administered by gavage daily containing 5×10 5 Biohalo 27 bacterial suspension with CFU / rat;

[0075] (4) High-fat diet + Biohalo 27 high-dose group (HFD+High dosage): fed with high-fat diet and administered via gavage daily containing 5×10 9 Biohalo 27 bacterial suspension (CFU / rat).

[0076] Table 1. Composition of Standard Diet and High-Fat Diet

[0077] 3) Fasting blood glucose and oral glucose tolerance test (OGTT)

[0078] Fasting blood glucose monitoring: Fasting blood glucose levels in rats were measured weekly during the experiment (6 hours after fasting). OGTT: In week 8 of the experiment, fasting blood glucose (0 min) was measured in rats after fasting for 12 hours using a handheld blood glucose meter. Subsequently, 2 g / kg body weight of glucose solution (50% w / v) was administered orally by gavage, and tail vein blood glucose levels were measured at 15, 30, 60, 90, and 120 min after administration. Blood glucose-time curves were plotted, and the area under the curve (AUC) was calculated.

[0079] 4) Endpoint sample collection

[0080] At the end of the experiment, rats were fasted for 12 hours and then euthanized by CO2 asphyxiation. Serum, liver, and adipose tissue were collected. Blood samples were allowed to stand at room temperature for 30 minutes to allow for complete coagulation, and then centrifuged at 4000×g for 10 minutes at 4°C to separate the supernatant serum. After aliquoting, the serum was temporarily stored at -20°C and then stored long-term at -80°C to avoid repeated freeze-thaw cycles. Adipose and liver tissues were fixed in 4% neutral formalin for subsequent histological analysis; the remaining tissues were rapidly frozen in liquid nitrogen and transferred to -80°C for long-term storage within 24 hours.

[0081] 5) Serum insulin and inflammatory cytokine detection

[0082] Serum biochemical parameters, including TG, LDL, HDL, cholesterol, AST, and ALT, were analyzed using an automated clinical analyzer (Hitachi High-Technologies Corporation, Tokyo, Japan). Blood glucose concentrations were measured using a Rightest GM550 (Bionime) glucometer. Serum levels of insulin, IL-6, TNF-α, and MCP-1 were measured using a commercially available rat ELISA kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions.

[0083] 6) Total RNA extraction and cDNA preparation

[0084] Total RNA was extracted from liver and adipose tissue homogenates using the Viogen Total RNA Mini Kit, following the manufacturer's instructions. The specific steps were as follows: the tissue homogenate was thoroughly mixed with lysis buffer, the RNA was purified by centrifugation, and finally, the total RNA was obtained by elution with RNase-free water. The extracted total RNA was immediately aliquoted and stored at -70°C for later use.

[0085] Dilute 2 μL of RNA sample with 98 μL of sterile water and determine the OD260 / OD280 ratio using a UV spectrophotometer. Calculate the RNA concentration by subtracting the RNA absorbance from the OD260 and OD280 ratios. RNA concentration (μg / μL) = [OD260 value × 40 × dilution factor] / 1000. Prepare cDNA from the calculated RNA concentration, which is equivalent to 1 μg of RNA.

[0086] cDNA synthesis was performed using the SuperScript II reverse transcription kit. First, the reaction mixture was prepared in a nuclease-free centrifuge tube: 1 μg of total RNA was added, along with Oligo(dT)15 primers, dNTP Mix, and sterile water, to a total reaction volume of 13 μl. After thorough mixing, the mixture was incubated at 65°C for 5 minutes to denature the RNA, and then immediately stopped by incubating on ice for 1 minute. After brief centrifugation, 5× First-Strand Buffer, 0.1 M DTT, RNaseOUT nuclease inhibitor, and SuperScript II reverse transcriptase were added sequentially, adjusting the total volume to 20 μL. The reaction program was set as follows: pre-incubation at 25°C for 5 minutes, reverse transcription at 50°C for 60 minutes, inactivation at 70°C for 15 minutes, and final storage at 4°C. The synthesized cDNA product was stored at -20°C as a template for subsequent quantitative real-time PCR (qRT-PCR).

[0087] 7) Analysis of gene expression related to liver and adipose tissue

[0088] In this study, liver tissue was obtained after animal sacrifice, homogenized, and total RNA was extracted using a commercial kit. The expression levels of the following key genes were detected by real-time quantitative PCR (qRT-PCR): (1) lipid synthesis regulator—sterol regulatory element binding protein 1c (SREBP-1c); (2) lipid metabolism regulator—peroxisome proliferator-activated receptor γ (PPARγ); (3) inflammatory markers—TNF-α, IL-6; (4) FAS; (5) IRS-1. This analysis aims to elucidate the molecular mechanism by which Biohalo 27 may improve NAFLD by regulating hepatic lipid metabolism and inflammatory response.

[0089] 8) Adipose tissue and liver pathological sections

[0090] To directly observe the effect of Biohalo 27 on improving non-alcoholic fatty liver disease in diabetic rats, adipose tissue collected after rat sacrifice was stained with anti-F4 / 80 antibody (Nichirei, Tokyo, Japan) to detect macrophage infiltration. Sections were incubated with anti-F4 / 80 antibody (dilution, 1:100) at 4°C for 30 minutes along with Histofine Simple Stain Max PO (rat) secondary antibody. Images were captured using the Zeiss Stallion Dual Detector Imaging System (Carl Zeiss Microimaging Inc., NY, USA).

[0091] Freshly isolated rat liver tissue was fixed in 10% neutral buffered formalin at 4°C for two days, transferred to 20% sucrose solution for two days, and then frozen in Tissue-Tek for Oil Red O staining. Frozen tissue was sectioned at a thickness of 8 μm on a Microm cryostat set to -19°C and then air-dried. Liver sections were rehydrated and diluted with 5% stock solution of Oil Red O in isopropanol at a 3:2 ratio with distilled water for 20 minutes. Mayer hematoxylin was used for counterstaining. Staining results were observed and photographed using an Olympus microscope (Olympus Corporation, Tokyo, Japan).

[0092] Table 2 Primer sequences used for quantitative real-time fluorescence PCR

[0093] 10) Statistical Analysis

[0094] Data were analyzed using SPSS software. One-way analysis of variance (ANOVA) was used to test whether there were significant differences between the experimental groups. If there were significant differences (P < 0.01), Duncan's new multiple range test was used for further analysis.

[0095] 2. Experimental Results

[0096] 1) Administration of *Lactobacillus paracasei* Biohalo 27 can reduce obesity and lipid accumulation in rats fed a high-fat diet. Experimental results are as follows: Figure 3 As shown, Figure 3 In the table, A represents initial body weight; B represents final body weight; C represents the weight gain rate; and D represents an image of abdominal fat in rats. Each value is expressed as SD ± mean (n = 8). NC = normal diet rats; HFD = high-fat diet rats; HFD+Low dosage = high-fat diet + 5 × 10⁻⁶.5 Biohalo 27 bacterial suspension (CFU / rat); HFD + Low dosage = high-fat diet + 5 × 10 9 CFU / rat Biohalo 27 bacterial suspension).

[0097] Depend on Figure 3 It can be seen that there was no statistically significant difference in the initial body weight of rats in each group (p>0.05). Figure 3 (A). The final body weight of rats in the HFD group (587.000±61.263g) increased by 23.87% compared with that in the NC group (473.875±29.469g) (p<0.0001). Figure 3 (Middle B). Notably, intervention with *Lactobacillus paracasei* Biohalo 27 significantly inhibited HFD-induced weight gain, with the low-dose group (508.750±35.620 g) showing a 13.33% reduction compared to the HFD group (587.000±61.263 g) (p<0.01), and the high-dose group (408.3±9.8 g) showing a 17.33% reduction compared to the HFD group (p<0.001). Anatomical observations ( Figure 3 Further investigation (D) confirmed that the HFD group rats exhibited significant abdominal fat accumulation, while the degree of abdominal fat deposition in the Lactobacillus paracasei (Biohalo 27) treatment group was significantly reduced compared to the HFD group. These results indicate that Lactobacillus paracasei (Biohalo 27) can effectively alleviate obesity symptoms induced by a high-fat diet in rats and significantly improve their abnormal lipid accumulation.

[0098] 2) Administration of Lactobacillus paracasei Biohalo 27 can improve blood lipid levels in rats fed a high-fat diet.

[0099] Excessive fat accumulation is often closely related to metabolic disorders. To assess lipid metabolism status, serum levels of total cholesterol (T-CHO), triglycerides (TG), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were measured; the results are as follows: Figure 4 As shown, Figure 4 In the table, (A) triglycerides (TG), (B) total cholesterol (TC), (C) low-density lipoprotein cholesterol (LDL), and (D) LDL / HDL ratio. Each value is expressed as SD ± mean (n = 8). NC = normal diet rats; HFD = high-fat diet rats; HFD+Low dosage = high-fat diet + 5 × 10⁻⁶ 5 Biohalo 27 bacterial suspension (CFU / rat); HFD + Low dosage = high-fat diet + 5 × 10 9Biohalo 27 bacterial suspension (CFU / rat).

[0100] Depend on Figure 4 It can be seen that, compared with the NC group, the HFD group rats exhibited typical characteristics of dyslipidemia: serum T-CHO (increased by 18.80%, p<0.001), TG (increased by 62.84%, p<0.0001), LDL-C (increased by 74.46%, p<0.001) levels and LDL / HDL ratio (increased by 1.26 times, p<0.0001) were all significantly increased.

[0101] Notably, the intervention with *Lactobacillus paracasei* Biohalo 27 demonstrated a significant dose-dependent improvement. Compared to the HFD group, the low-dose intervention group showed significant decreases in serum T-CHO (reduced by 10.93%, p<0.05), TG (reduced by 48.31%, p<0.01), LDL-C (reduced by 34%, p<0.05), and the LDL / HDL ratio (reduced by 22.3%, p<0.01). The high-dose intervention group showed even more significant improvements in all indicators (T-CHO decreased by 12.21%, p<0.01; TG decreased by 69.76%, p<0.001; LDL-C decreased by 36.13%, p<0.01; LDL / HDL ratio decreased by 45%, p<0.001). These data fully demonstrate that *Lactobacillus paracasei* Biohalo 27 has a significant lipid-lowering effect and exhibits a clear dose-response relationship.

[0102] 3) Lactobacillus paracasei Biohalo 27 inhibits high-fat diet-induced inflammatory responses in rats.

[0103] Obesity is often accompanied by chronic low-grade inflammation, which is considered a hallmark of obesity, resulting in... Figure 5 As shown, Figure 5 (AC) Serum MCP-1, IL-6, and TNF-α; (D) F4 / 80 immunostaining of adipose tissue obtained from sacrificed rats at the end of the experimental period (12 weeks) to assess macrophage infiltration in adipose tissue. Histological sections of rat adipose tissue were observed at 200× magnification. (E) Percentage of F4 / 80 immunostaining positive areas in adipose tissue obtained from sacrificed rats at the end of the experimental period; (FG) Expression of pro-inflammatory cytokine genes (IL-6 and TNF-α) in adipose tissue. Each value is expressed as SD ± mean (n=8). NC = normal diet rats; HFD = high-fat diet rats; HFD+Lowdosage = high-fat diet + 5×10 5 Biohalo 27 bacterial suspension (CFU / rat); HFD + Low dosage = high-fat diet + 5 × 109 Biohalo 27 bacterial suspension with CFU / rat; Depend on Figure 5 It was found that, compared with the control group, rats fed a high-fat diet (HFD) exhibited a significant systemic inflammatory response, manifested by significantly elevated plasma levels of MCP-1 (increased by 59.55%, p<0.001), TNF-α (increased by 17.42%, p<0.01), and IL-6 (increased by 40.97%, p<0.001). Figure 5 (A, B, and C). However, intervention with different doses of Lactobacillus paracasei Biohalo 27 showed good anti-inflammatory effects: the low-dose group reduced the levels of MCP-1, TNF-α, and IL-6 by 25.73% (p<0.05), 13.46% (p<0.01), and 20.90% (p<0.01), respectively; the high-dose group further reduced the levels of MCP-1, TNF-α, and IL-6 by 32.51% (p<0.05), 14.81% (p<0.01), and 28.23% (p<0.001), respectively, showing a clear dose-response relationship.

[0104] Previous studies have shown that macrophage infiltration in adipose tissue is closely related to adipocyte inflammation. Therefore, this study further evaluated the effect of *Lactobacillus paracasei* Biohalo 27 on macrophage infiltration in adipose tissue using F4 / 80 immunohistochemical staining. Figure 5 (Middle D). The results showed that, compared with the control group, the number of F4 / 80 positive cells in adipose tissue was significantly increased in the HFD group (p < 0.01), while low-dose and high-dose Biohalo 27 treatment significantly reduced macrophage infiltration (p < 0.01). These data suggest that the mechanism by which Biohalo 27 improves adipose tissue inflammation may be related to its inhibition of macrophage infiltration.

[0105] To further investigate the molecular mechanism by which Biohalo 27 improves metabolic disorders in HFD rats, the expression levels of inflammation-related genes in adipose and liver tissues were detected. Real-time quantitative PCR (qPCR) analysis showed that, compared with the control group, the mRNA expression levels of insulin resistance-related inflammatory cytokines TNF-α and IL-6 in the adipose tissue of the HFD group were significantly upregulated (p < 0.0001), and treatment with *Lactobacillus paracasei* Biohalo 27 significantly reversed this trend (p < 0.0001). Figure 5 The presence of E and F in the middle provides important evidence for elucidating the molecular mechanism by which Biohalo 27 improves metabolic disorders.

[0106] 4) Lactobacillus paracasei Biohalo 27 improves insulin resistance and glucose metabolism disorders induced by a high-fat diet.

[0107] Numerous studies have demonstrated that chronic inflammation is a core mechanism in the development of insulin resistance (IR). Based on the aforementioned experimental results confirming the significant anti-inflammatory effect of Biohalo 27, further investigation was conducted into its impact on insulin resistance induced by a high-fat diet (HFD). The results are as follows: Figure 6 As shown, Figure 6 In the table, (A) initial blood glucose; (BC) blood glucose concentration (B) and area under the curve (AUC, C) in the oral glucose tolerance test (OGTT) at week 8 after fasting for 12 hours; (DE) fasting blood glucose (D) and fasting insulin (E) at week 12; (F) assessment of insulin resistance homeostasis model (HOMA-IR); (GH) expression of genes related to insulin sensitivity regulation in adipose tissue (PPAR-γ and IRS-1). All values ​​are expressed as SD ± mean (n = 8). NC = normal diet rats; HFD = high-fat diet rats; HFD + Low dosage = high-fat diet + 5 × 10⁻⁶ 5 Biohalo 27 bacterial suspension (CFU / rat); HFD + Low dosage = high-fat diet + 5 × 10 9 Biohalo 27 bacterial suspension with CFU / rat;

[0108] Insulin sensitivity was assessed using an oral glucose tolerance test (OGTT) and the homeostasis model of insulin resistance (HOMA-IR). At the beginning of the experiment, there were no significant differences in baseline blood glucose levels among the groups (p > 0.05). Figure 6 (A) For example Figure 6 As shown in the middle BC, compared with the control group, the HFD group showed significant impaired glucose tolerance, as evidenced by a significantly increased area under the curve (AUC) of the OGTT (p < 0.05), while high-dose Biohalo 27 intervention significantly improved this abnormality (p < 0.01).

[0109] Furthermore, the levels of fasting blood glucose (FBG) and fasting insulin (FINS) in the HFD group were significantly higher than those in the NC group (FBG increased by 13.41%, FINS increased by 1.27 times, p < 0.0001). Figure 6 (DE), leading to a significant increase in the HOMA-IR index ( Figure 6(F). Notably, after intervention with Lactobacillus paracasei Biohalo 27, FBG, FINS, and HOMA-IR all showed dose-dependent decreases (HFD vs HFD+Low dosage: FBG decreased by 6.83%, p < 0.05, FINS decreased by 43.89%, and HOMA-IR decreased by 47.80%, p < 0.0001; HFD vs HFD+High dosage: FBG decreased by 10.78%, FINS decreased by 55.17%, and HOMA-IR decreased by 60.06%, all p < 0.0001), indicating that it can effectively alleviate HFD-induced insulin resistance.

[0110] To elucidate the molecular mechanism by which *Lactobacillus paracasei* Biohalo 27 improves insulin resistance, the expression levels of key genes in the insulin signaling pathway were examined in adipose and liver tissues. The results showed that HFD significantly downregulated the mRNA expression of PPAR-γ and IRS-1 (PPAR-γ: p < 0.0001; IRS-1: p < 0.01). However, after intervention with Biohalo 27, the expression of both PPAR-γ and IRS-1 recovered in a dose-dependent manner (HFD vs HFD+Low dosage: PPAR-γ p < 0.0001, IRS-1 p < 0.01; HFD vs HFD+High dosage: both p < 0.0001). Figure 6 These data suggest that Biohalo 27 may improve insulin sensitivity in obese rats by upregulating the expression of PPAR-γ and IRS-1, thereby enhancing insulin signaling.

[0111] 5) Lactobacillus paracasei Biohalo 27 improves non-alcoholic fatty liver disease induced by a high-fat diet.

[0112] Obesity is a major risk factor for non-alcoholic fatty liver disease (NAFLD), which is characterized by hepatocyte steatosis, inflammatory infiltration, ballooning degeneration, and fibrosis.

[0113] Regarding liver function assessment ( Figure 7In both groups A and B, serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels were significantly higher in the HFD group than in the control group (ALT increased by 40.45%, AST increased by 56.71%, p < 0.0001), indicating significant liver damage. However, intervention with *Lactobacillus paracasei* Biohalo 27 dose-dependently reversed the abnormal changes in ALT and AST (HFD vs HFD + Low dosage: ALT decreased by 17.62%, p < 0.05, AST decreased by 20.02%, p < 0.001; HFD vs HFD + High dosage: ALT decreased by 26.15%, p < 0.001, AST decreased by 44.48%, p < 0.0001), suggesting a hepatoprotective effect.

[0114] Oil Red O staining results showed ( Figure 7 In the control group (C and D), the liver tissue showed normal tissue structure with only trace lipid droplet deposition. In contrast, the HFD group exhibited significant diffuse macrovesicular and microvesicular steatosis (p < 0.001), accompanied by a large amount of lipid droplet accumulation. However, treatment with *Lactobacillus paracasei* Biohalo 27 significantly reduced the degree of HFD-induced hepatic steatosis (HFD vs HFD + Low dosage: p < 0.01; HFD vs HFD + High dosage: p < 0.001).

[0115] Further analysis revealed significantly elevated levels of hepatic triglycerides (TG) and cholesterol (CHO) in the HFD group, while Biohalo 27 intervention selectively reduced these parameters in HFD-fed rats (p < 0.0001). Liver tissue analysis confirmed that Biohalo 27 significantly reduced TG and CHO levels in the liver of HFD rats (p < 0.0001), but no significant effect was observed in the normal diet group. Figure 7 The results (E and F) indicate that its lipid-lowering effect is diet-dependent.

[0116] The results of this study show that ( Figure 7 In the high-fat diet (HFD) groups (F and G), compared with the control group, the mRNA expression levels of key genes for hepatic lipogenesis—fatty acid synthase (FAS) and sterol regulatory element-binding protein-1c (SREBP-1c)—were significantly increased (p < 0.0001). Notably, the expression of these pro-lipogenesis genes was significantly downregulated after both low-dose and high-dose Biohalo 27 intervention (p < 0.0001).

[0117] Figure 7(AB) Serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST); (CD) Representative photomicrographs of livers obtained from sacrificed rats at the end of the experimental period (12 weeks) after Oil Red O staining to assess hepatic steatosis. Histological sections of rat livers were observed at 200× magnification. (E) Liver CHO. (F) Liver TG; (GH) Expression of adipogenesis-related genes (FAS, SREBP-1c) in the liver. Each value is expressed as SD ± mean (n = 8). NC = normal diet rats; HFD = high-fat diet rats; HFD+Low dosage = high-fat diet + 5×10 5 Biohalo 27 bacterial suspension (CFU / rat); HFD + Low dosage = high-fat diet + 5 × 10 9 Biohalo 27 bacterial suspension (CFU / rat).

[0118] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features therein. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention, and they should all be covered within the scope of the claims and specification of the present invention.

Claims

1. A bacterial strain with anti-obesity effects, characterized in that, The strain is *Lactobacillus paracasei* (… Lacticaseibacillus paracasei Biohalo27 is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34917; the deposit date is June 16, 2025.

2. A microbial agent containing the strain of claim 1 that has the effect of preventing and treating obesity.

3. The microbial agent according to claim 2, characterized in that, The microbial agent is obtained by inoculating the strain with the effect of preventing and treating obesity into a culture medium and then culturing it.

4. The use of the strain with anti-obesity effect as described in claim 1 or the microbial agent as described in any one of claims 2 to 3 in the preparation of anti-obesity products.

5. The application according to claim 4, characterized in that, The obesity prevention and treatment product has at least one of the following functions (1) to (8): (1) Treatment of obesity; (2) Reduce abnormal accumulation of abdominal fat; (3) Inhibit metabolic inflammatory responses; (4) Reduces hepatic steatosis; (5) Reduces non-alcoholic fatty liver disease; (6) Reduce serum triglyceride, total cholesterol and low-density lipoprotein levels; (7) Improves glucose metabolism; (8) Reduce fasting blood glucose and insulin levels, and enhance insulin sensitivity.

6. A product with the effect of preventing and treating obesity, characterized in that, Includes the strain with anti-obesity effect as described in claim 1 or the microbial agent as described in any one of claims 2 to 3.

7. The product according to claim 6, characterized in that, The viable count of the strain with anti-obesity effects is not less than 1×10⁻⁶. 7 cfu / g.

8. The product according to claim 6, characterized in that, The cell count in the microbial agent is not less than 1×10⁻⁶. 7 cells / g.

Citation Information

Patent Citations

  • Lactobacillus paracasei GKS6 for improving metabolic syndrome, its uses, pharmaceutical compositions and edible compositions.

    CN111164201B

  • Bacterial strain with anti-tumor effect and application thereof

    CN120843378A

  • Lactobacillus paracasei AO356 strain having Anti-obesity activity and method for preventing, alleviating or treating obesity using the same

    US20210393706A1