High-salt-tolerance uridine cytidine kinase mutant and application thereof

Abstract

The invention discloses a high-salt-tolerance uridine and cytidine kinase mutant and application thereof, and relates to the technical field of uridine and cytidine kinase mutation, and the high-salt-tolerance uridine and cytidine kinase mutant is obtained by mutating sites R30D, Q35E, H55D, R86E and K104D of uridine and cytidine kinase. The uridine and cytidine kinase mutant generated by mutation has good salt tolerance, the salt tolerance is remarkably improved compared with that of traditional uridine and cytidine kinase, good activity is still kept in a high-concentration acetate environment, the catalytic efficiency is improved, and meanwhile the catalytic efficiency of uridine and cytidine kinase on reactants in more environments can be improved.

Description

Technical Field

[0001] This invention relates to the field of uridine cytidine kinase mutation technology, specifically to a highly salt-tolerant uridine cytidine kinase mutant and its applications. Background Technology

[0002] Uroside cytidine kinase is used to catalyze the phosphorylation of uridine and cytidine into uridine acid and cytidine acid, which can improve the production efficiency of uridine acid and cytidine acid. However, the activity of uridine cytidine kinase is inhibited in a high acetate environment, making it unsuitable for the industrial production of uridine acid and cytidine acid in a high-salt environment.

[0003] The existing uridine cytidine kinase has the following drawbacks:

[0004] 1. Existing technology CN114107246A discloses a uridine-cytidine kinase mutant and its application in the production of cytidine nucleotides. This technology uses site-directed mutagenesis to mutate uridine-cytidine kinase, improving its catalytic efficiency, and couples it with acetate kinase for catalysis, efficiently catalyzing the production of 5'-cytidine from 5'-cytidine, thus achieving efficient production of 5'-cytidine nucleotides (5'-CMP). Using the uridine-cytidine kinase mutant obtained in this invention, coupled with acetate kinase, 5'-cytidine nucleotides can be produced efficiently, with a conversion rate of up to 98% after 2.5 hours of catalysis, which can promote its application in medicine and other fields. This highly efficient uridine-cytidine kinase can be used to realize the industrial production of 5'-CMP, which is beneficial for reducing its production costs and environmental pollution, and realizing green biomanufacturing.

[0005] The above-mentioned technologies do not have the ability to increase the salt tolerance of uridine cytidine kinase. Urinidine cytidine kinase is not suitable for maintaining its catalytic ability in high-salt environments. Therefore, a highly salt-tolerant uridine cytidine kinase mutant is needed to solve this problem. Summary of the Invention

[0006] One objective of this application is to provide a highly salt-tolerant uridine cytidine kinase mutant and its applications, which can solve the technical problems raised in the prior art.

[0007] To achieve the above objectives, the present invention provides the following technical solution: a highly salt-tolerant uridine cytidine kinase mutant, wherein the highly salt-tolerant uridine cytidine kinase mutant is obtained by mutating the sites R30D, Q35E, H55D, R86E and K104D of uridine cytidine kinase.

[0008] Preferably, the forward primer sequence of R30D is ACCTTATACGACGAGCTCCGTGAGCAGGTTGG, and the reverse primer sequence is CCAACCTGCTCACGGAGCTCGTCGTATAAGGT.

[0009] Preferably, the forward primer sequence of Q35E is CTCCGTGAGGAAGTTGGCGATGAACATATTGG, and the reverse primer sequence is CCAATATGTTCATCGCCAACTTCCTCACGGAG.

[0010] Preferably, the forward primer sequence of H55D is AGATCAGTCAGATCTGAGCATGGAAGAGCGT, and the reverse primer sequence is ACGCTCTTCCATGCTCAGATCTGACTGATCT.

[0011] Preferably, the forward primer sequence of R86E is GCGCTGAAAGAGGGTTCAGCGATCGACCTCC, and the reverse primer sequence is GGAGGTCGATCGCTGAACCCTCTTTCAGCGC.

[0012] Preferably, the forward primer sequence of K104D is ACCCGTATGGACGAAACCGTCACGGTCGAA, and the reverse primer sequence is TTCGACCGTGACGGTTTCGTCCATACGGGT.

[0013] Preferably, the mutation sites of the uridine cytidine kinase also include V98D, P141E and N155D.

[0014] Preferably, the mutation sites of the uridine cytidine kinase also include K63E, V98D, T108D, P141E, N155D, P192D, R193E and I199D.

[0015] Preferably, the mutation sites of the uridine cytidine kinase also include K63E, A89E, V98D, T108D, P141E, N155D, G158D, K170D, Q178E, Q185E, P192D, R193E, K196D, and I199D.

[0016] Preferably, the highly salt-tolerant uridine cytidine kinase mutant is used in the preparation of cytidine acid, uridine acid, cytidine triphosphate, and uridine triphosphate.

[0017] Compared with the prior art, the beneficial effects of the present invention are:

[0018] 1. The uridine cytidine kinase mutant generated by the present invention has good salt tolerance, which is significantly improved compared with the traditional uridine cytidine kinase. It still maintains good activity in high-concentration acetate environment, improves catalytic efficiency, and enables uridine cytidine kinase to increase the catalytic efficiency of reactants in more environments.

[0019] 2. The uridine cytidine kinase mutant generated by the mutation of the present invention can efficiently catalyze the production of uridine acid and cytidine acid, improve the production efficiency of uridine acid and cytidine acid, reduce the production time, and can still efficiently catalyze the production of uridine acid and cytidine acid in a high-concentration acetate environment.

[0020] 3. The uridine cytidine kinase mutant generated by the mutation of the present invention can efficiently catalyze the production of cytidine triphosphate, improve the production efficiency of cytidine triphosphate, reduce the production time, and can still efficiently catalyze the production of cytidine triphosphate in a high-concentration acetate environment.

[0021] 4. The uridine cytidine kinase mutant generated by the mutation of the present invention can efficiently catalyze the production of uridine triphosphate, improve the production efficiency of uridine triphosphate, reduce the production time, and can still efficiently catalyze the production of uridine triphosphate in a high-concentration acetate environment. Attached Figure Description

[0022] Figure 1 This is an enzyme activity diagram of uridine cytidine kinase at different salt concentrations according to the present invention;

[0023] Figure 2 The images show the enzyme activity of different mutants of the present invention at different concentrations of NHAc.

[0024] Figure 3 The enzyme activity diagrams of different mutants of the present invention at different concentrations of NaAc are shown.

[0025] Figure 4 The images show the enzyme activity of different mutants of the present invention at different concentrations of KAc. Detailed Implementation

[0026] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0027] Please see Figure 1 , Figure 2 , Figure 3 and Figure 4 A highly salt-tolerant uridine cytidine kinase mutant is obtained by mutating the R30D, Q35E, H55D, R86E and K104D sites of uridine cytidine kinase.

[0028] The forward primer sequence for R30D is ACCTTATACGACGAGCTCCGTGAGCAGGTTGG, and the reverse primer sequence is CCAACCTGCTCACGGAGCTCGTCGTATAAGGT.

[0029] The forward primer sequence for Q35E is CTCCGTGAGGAAGTTGGCGATGAACATATTGG, and the reverse primer sequence is CCAATATGTTCATCGCCAACTTCCTCACGGAG.

[0030] The forward primer sequence for H55D is AGATCAGTCAGATCTGAGCATGGAAGAGCGT, and the reverse primer sequence is ACGCTCTTCCATGCTCAGATCTGACTGATCT.

[0031] The forward primer sequence for R86E is GCGCTGAAAGAGGGTTCAGCGATCGACCTCC, and the reverse primer sequence is GGAGGTCGATCGCTGAACCCTCTTTCAGCGC.

[0032] The forward primer sequence for K104D is ACCCGTATGGACGAAACCGTCACGGTCGAA, and the reverse primer sequence is TTCGACCGTGACGGTTTCGTCCATACGGGT.

[0033] Mutation sites for uridine cytidine kinase also include V98D, P141E, and N155D.

[0034] Mutation sites for uridine cytidine kinase also include K63E, V98D, T108D, P141E, N155D, P192D, R193E, and I199D.

[0035] Mutation sites for uridine cytidine kinase also include K63E, A89E, V98D, T108D, P141E, N155D, G158D, K170D, Q178E, Q185E, P192D, R193E, K196D, and I199D.

[0036] High salt-tolerant uridine cytidine kinase mutants are used in the preparation of cytidine acid, uridine acid, cytidine triphosphate, and uridine triphosphate.

[0037] Example 1: Cloning and expression of uridine cytidine kinase:

[0038] The uridine cytidine kinase (udk gene of Escherichia coli str. K-12 substr. MG1655, GenBank: AY192983.1) was optimized for rare codons based on E. coli codon preference. An NcoI restriction site (CCATGG, because the second codon starts with G, only CC was added) was added before the start codon, and an XhoI restriction site was added to the end of the stop codon. These sequences were sent to Beijing Qingke for whole-genome synthesis, and the pET28a(+)-UCK expression vector was constructed by ligating the NcoI / XhoI double restriction site into the pET28a(+) vector. The constructed plasmid was centrifuged at 10,000 rpm for 10 min, and dissolved in 50 μL of ddH2O using a vortex mixer. After dissolution, the bacteria were transformed into *E. coli* BL21(DE3), and the transformed *E. coli* BL21(DE3) was activated and incubated at 37 °C and 220 rpm for 1 hour. The culture was then spread onto LB agar plates containing 50 µg / mL kanamycin resistance and incubated upside down at 37 °C overnight. Single colonies were picked from the plates and inoculated into TB liquid medium containing a final concentration of 50 µg / mL kanamycin, with the addition of glucose and lactose to a final concentration of 5 g / L. The culture was then incubated at 37 °C and 220 rpm. 600 The concentration was increased to 0.8-1.2 (preferably 0.9), the temperature was changed to 28 ºC, and the cells were cultured at 220 rpm for 14 h. Then, the cells were centrifuged at 4 ºC and 8000 rpm for 10 minutes to obtain wet bacterial cells containing uridine cytidine kinase.

[0039] Example 2: Purification of uridine cytidine kinase:

[0040] The wet bacterial cells obtained in Example 1 were suspended in buffer A (pH 8.0 containing 0.5 M NaCl, 20 mM imidazole, and 20 mM Tris buffer), sonicated for 15 minutes (ice bath, power 400 W, 3 seconds of disruption, 5 seconds of pause), centrifuged at 4°C and 12000 rpm for 20 minutes, and the supernatant was collected. Protein purification was performed using a Ni affinity column (1.6 × 10 cm, Bio-Rad, USA). The specific procedures were as follows: ① Equilibrate the Ni column with 5 column volumes of binding buffer (pH 8.0 containing 0.5 M NaCl, 20 mM imidazole, and 20 mM Tris buffer) until the baseline stabilized; ② Load the sample at a flow rate of 1 mL / min, with a sample volume of 25-40 mg / mL protein, allowing the target protein to adsorb onto the Ni column; ③ Wash with 6 column volumes of buffer A (pH 8.0 containing 0.5 M NaCl, 20 mM imidazole, and 20 mM Tris buffer) at a flow rate of 1 mL / min until the baseline stabilized; ④ Elute with buffer B (pH 8.0 containing 0.5 M NaCl, 400 mM imidazole, and 20 mM Tris buffer) at a flow rate of 1 mL / min and collect the target protein. The target protein was dialyzed overnight in pH 8.0, 20 mM Tris buffer to obtain purified deoxyadenosine kinase; the Ni column was washed with 5 column volumes of binding buffer (pH 8.0, 20 mM Tris buffer containing 0.5 M NaCl) until the baseline stabilized, and the Ni column was stored in 5 column volumes of ultrapure water containing 20% ​​ethanol.

[0041] Example 3: Determination of uridine cytidine kinase activity and salt tolerance:

[0042] An enzyme activity unit (U) is defined as the amount of enzyme required to generate 1 µmol of UMP per minute at 35 °C and pH 8.0.

[0043] Enzyme activity detection standard conditions: 4.12 g / L uridine, 6.92 g / L ATP-Na2, 2.0 g / L MgCl2∙6H2O, 12.1 g / L Tris, appropriate amount of enzyme solution, reaction at 35℃ for 10 minutes, sample processing and HPLC detection and analysis.

[0044] Liquid chromatography detection conditions for uridine, uridine monophosphate, adenosine diphosphate, and adenosine triphosphate: Inert Sustain column TM C18 (4.6 × 150 mm, 5µm, Shimadzu) column, mobile phase acetonitrile:0.1M PBS=5:95, flow rate 1.0 mL / min, detection wavelength 259 nm, injection volume 10 μL, column temperature 25℃.

[0045] Salt tolerance study of uridine cytidine kinase: NaAc, KAc, and NH4Ac were added to the uridine cytidine kinase enzyme activity assay system at concentrations of 0 mM, 300 mM, 600 mM, 900 mM, 1200 mM, 1500 mM, and 2000 mM, respectively. The uridine cytidine kinase was diluted to a certain factor and then placed at 35°C. o Enzyme activity was determined by C assay. Results are as follows: Figure 1 As shown, uridine cytidine kinase activity is increased under low salt concentrations, but decreases with increasing salt concentration above 600 mM. Under 2000 mM NaAc conditions, uridine cytidine kinase activity is 24% of that at 0 mM; under 2000 mM KAc conditions, it is 22% of that at 0 mM; and under 2000 mM NH4Ac conditions, it is 28% of that at 0 mM.

[0046] Example 4: Constructing a high salt-tolerant UCK through multiple sequence alignment, surface charge analysis, and rational design:

[0047] 1. Using the UCK amino acid sequence from *E. coli* as a probe, the BLASTp tool was used to search the NCBI database for amino acid sequences highly similar to the UCK sequence. UCK amino acid sequences from other sources with greater than 30% homology were selected, and multiple sequence alignment (MSA) was performed on these homologous proteins using the ESPript 3.0 tool. By aligning a series of homologous protein sequences, highly conserved amino acid residues during evolution can be identified. These conserved residues are often closely related to protein activity, binding sites, or structural stability. In protein engineering, by purposefully modifying these key residues, the activity, selectivity, or stability of proteins can be altered.

[0048] 2. Homology modeling is used to predict the structure of the UK protein. By inputting the amino acid sequence of UCK into SWISS-MODEL, the target protein sequence is aligned with the template sequence to construct a preliminary three-dimensional model. The template with the highest GMQE score is selected for modeling, thereby obtaining a PDB file containing the three-dimensional structure of the UK protein.

[0049] 3. The activity of UCK derived from *E. coli* is easily affected by the accumulation of phosphates and acetates during catalysis. Therefore, it is necessary to develop highly salt-tolerant UCK through rational design. Salt tolerance depends on the number of acidic amino acids on the surface. Highly salt-tolerant enzyme proteins often contain fewer lysine and cysteine, and more glutamic acid and aspartic acid. The protein surface has a high negative charge density, which easily forms an electrostatic barrier, preventing high concentrations of external salt ions from penetrating into the enzyme protein, thus protecting the active site and making it more suitable for industrial catalytic production in high-salt environments. Therefore, the PDB file of UCK was imported into PyMOL to analyze the distribution of its surface amino acids, and its surface electrostatic potential was analyzed using the PyMOL plugin APBS. The environment variable was set to a high-salt environment, and APBS was run. The calculated electrostatic potential results were mapped onto the UCK protein surface. Red represents the region of densely negatively charged acidic amino acids, and blue represents the region of densely positively charged basic amino acids. Based on the highly conserved amino acid sites in the multiple sequence alignment results, molecular modification of the UK surface amino acids was carried out based on rational design. The principle of the relevant modification is as follows:

[0050] ① Preferentially mutate the basic amino acid residues on the surface of UCK to acidic amino acids;

[0051] ② Based on the results of multiple sequence alignment, when mutating amino acids on the surface of UCK, highly consistent amino acids in the sequence alignment should be avoided, i.e., highly conserved sites. These sites significantly affect the structure and function of the enzyme protein and have a significant impact on the activity of UCK.

[0052] ③ Prioritize selecting amino acid residue sites with the greatest differences in sequence alignment results. These sites are highly variable and have a smaller impact on the overall activity of the enzyme protein.

[0053] ④ Based on the calculated electrostatic potential, the amino acid residues in the dense blue region are mutated into acidic amino acids;

[0054] ⑤ Combining RMSD and RMSF analysis, mutation sites are preferentially selected in regions with large fluctuations in RMSF. These regions are more flexible, and the mutation has a smaller impact on the overall protein.

[0055] Example 5: Construction, expression, and screening of UCK single-point mutations:

[0056] Step 1: Construct a single-point mutation:

[0057] Based on the above principles, the following five single-point mutants were constructed: R30D, Q35E, H55D, R86E, and K104D. Using the pET28a-UCK plasmid from Case 1 as a template, and employing the principle of Quick-change site-directed mutagenesis, single-point mutagenesis was first performed using the primers listed in Table 1, mutating the amino acids at each site.

[0058]

[0059] PCR amplification was performed using Takara's KOD high-fidelity polymerase under the following conditions: 95°C. o C 2min, then 55 o C20sec, 72 o C 100sec, 30 loops in total, last 72 seconds o C 10 min. PCR products were recovered from the gel and incubated at 37°C using DpnI enzyme (Fermentas). o Digestion of the gel product under C conditions for 2 hours degraded the initial template. The digestion product was converted to BL21(DE3) and plated onto LB agar plates containing 50 μg / mL kanamycin, incubated at 37°C. o The bacteria were cultured overnight at C10, positive clones were screened, and sequenced for verification. Recombinant bacteria with the UCK mutant were obtained.

[0060] Step 2: Expression and screening of mutant engineered bacteria:

[0061] The mutated plasmid from step 1 was transformed into the host bacterium *E. coli* BL21(DE3). A crude enzyme solution was prepared using the method described in Example 1, and its related enzyme activity and salt tolerance under 2000 mM NaAc conditions were determined according to the method described in Example 3. The results are shown in Table 2. The activities of the five single-point mutations (R30D, Q35E, H55D, R86E, and K104D) did not decrease significantly, but their tolerance to high-concentration salt environments (acetate) was improved to some extent. Therefore, these five single-point mutations were simultaneously introduced into the engineered enzyme, and other acidic amino acid mutations were further introduced to improve the salt tolerance of the engineered enzyme.

[0062]

[0063] Example 6: Construction, expression, and screening of UCK engineered enzymes:

[0064] Step 1: Further construct the UCK engineered enzyme:

[0065] In Case Study 5, five single-point mutations were constructed. Compared to wild-type UCK, these mutations maintained a certain level of activity under high-salt conditions. Therefore, these five single-point mutations were simultaneously introduced into UCK to construct engineered enzyme M1. Based on this, and according to the principles of rational design, other nonpolar and polar amino acids located on the protein surface were mutated into acidic amino acids to further construct engineered enzymes M2, M3, and M4, significantly improving the salt tolerance of UK. The UCK engineered enzymes and related mutation sites are shown in Table 3.

[0066]

[0067] Step 2: Expression and screening of UCK engineered enzymes:

[0068] The engineered enzymes M1, M2, M3, and M4 constructed in step 1 were expressed in the host bacterium E. coli BL21(DE3). Crude enzyme solutions were prepared using the method described in Example 1, and their related enzyme activities and salt tolerance were determined according to the method described in Example 3. The results are as follows: Figure 2 , Figure 3 and Figure 4 As shown, mutants M1, M2, M3, and M4 all exhibited increased tolerance to high concentrations of NaAc, KAc, and NH4Ac, with M4 showing the greatest increase. The mutants were purified according to the method described in Example 2 to obtain pure UCK[M4] enzyme solution.

[0069] Example 7: Application of UCK mutants, Example 1:

[0070] The salt-tolerant UCK mutant was used to prepare cytidine monophosphate (CMP). Cytidine, adenosine triphosphate (ATP), and acetyl phosphate were used as raw materials in a 300 mL reaction system. The dosage of cytidine was 36.48 g (500 mM), ATP was 0.91 g (5 mM), magnesium chloride hexahydrate was 4.27 g (70 mM), and the initial acetyl phosphate was 20 g / L (143 mM). The pH was adjusted to 7.5 with NaOH. 12,000 U of pure UCK[M4] enzyme solution and 24,000 U of acetate kinase were added. The reaction was allowed to proceed at 35°C, with the pH adjusted back to 7.5 with NaOH solution every half hour. Acetyl phosphate was added at 1 h, 3.5 h, and 8 h of reaction. After 16 h of reaction, the conversion rate of CMP was 91.245%.

[0071] Example 8: Application of UCK mutant, Example 2:

[0072] The salt-tolerant UCK mutant was used to prepare uridine monophosphate. Uridine, adenosine triphosphate (ATP), and acetyl phosphate were used as raw materials in a 300 mL reaction system. The amount of uridine added was 36.63 g (500 mM), ATP was 0.91 g (5 mM), magnesium chloride hexahydrate was 4.27 g (70 mM), and the initial acetyl phosphate was 20 g / L (143 mM). The pH was adjusted to 7.5 with KOH. 15,000 U of pure UCK[M4] enzyme solution and 24,000 U of acetate kinase were added. The reaction was allowed to proceed at 35°C, and the pH was adjusted back to 7.5 with NaOH solution every half hour. Acetyl phosphate was added at 1 h, 3.5 h, and 8 h of reaction. After 16 h of reaction, the conversion rate of CMP was 92.536%.

[0073] Example 9: Application of UCK mutants, Example 3:

[0074] The salt-tolerant UCK mutant was used in the preparation of cytidine triphosphate (CTP). Cytidine, adenosine triphosphate (ATP), and acetyl phosphate were used as raw materials in a 300 mL reaction system. The addition amounts of cytidine were 36.48 g (500 mM), ATP 0.91 g (5 mM), magnesium chloride hexahydrate 4.27 g (70 mM), and initial acetyl phosphate 40 g / L (283 mM). The pH was adjusted to 7.5 with NaOH. The addition amounts of pure UCK[M4] enzyme solution were 48,000 U, uridine / cytidine kinase 24,000 U, and acetate kinase 48,000 U. The reaction was allowed to proceed at 35°C, with the pH adjusted to 7.5 with NaOH solution every half hour. Acetyl phosphate was added at 40 g / L at 1 h, 3 h, 6 h, and 10 h of reaction. After 22 h of reaction, the CTP conversion rate was 85.669%.

[0075] Example 10: Application of UCK mutants, Example 4:

[0076] The salt-tolerant UCK mutant was used to prepare uridine triphosphate (UTP). Cytidine, adenosine triphosphate (ATP), and acetyl phosphate were used as raw materials in a 300 mL reaction system. The addition amounts of uridine were 36.63 g (500 mM), ATP 0.91 g (5 mM), magnesium chloride hexahydrate 4.27 g (70 mM), and initial acetyl phosphate 40 g / L (283 mM). The pH was adjusted to 7.5 with NaOH. The addition amounts of pure UCK[M4] enzyme solution were 48,000 U, uridine / cytidine kinase 24,000 U, and acetate kinase 48,000 U. The reaction was allowed to proceed at 35°C, with the pH adjusted to 7.5 with NaOH solution every half hour. Acetyl phosphate was added at 40 g / L at 1 h, 3 h, 6 h, and 10 h of reaction. After 22 h of reaction, the UTP conversion rate was 88.432%.

[0077] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or essential characteristics. Therefore, the embodiments should be considered in all respects as exemplary and non-limiting, and the scope of the invention is defined by the appended claims rather than the foregoing description. Thus, all variations falling within the meaning and scope of equivalents of the claims are intended to be included within the present invention, and no reference numerals in the claims should be construed as limiting the rights involved.

Claims

1. A highly salt-tolerant uridine cytidine kinase mutant, characterized in that: The highly salt-tolerant uridine cytidine kinase mutant was obtained by mutating the R30D, Q35E, H55D, R86E, and K104D sites of uridine cytidine kinase.

2. The salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The forward primer sequence for R30D is ACCTTATACGACGAGCTCCGTGAGCAGGTTGG, and the reverse primer sequence is CCAACCTGCTCACGGAGCTCGTCGTATAAGGT.

3. The salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The forward primer sequence for Q35E is CTCCGTGAGGAAGTTGGCGATGAACATATTGG, and the reverse primer sequence is CCAATATGTTCATCGCCAACTTCCTCACGGAG.

4. The salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The forward primer sequence for H55D is AGATCAGTCAGATCTGAGCATGGAAGAGCGT, and the reverse primer sequence is ACGCTCTTCCATGCTCAGATCTGACTGATCT.

5. A highly salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The forward primer sequence for R86E is GCGCTGAAAGAGGGTTCAGCGATCGACCTCC, and the reverse primer sequence is GGAGGTCGATCGCTGAACCCTCTTTCAGCGC.

6. The salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The forward primer sequence for K104D is ACCCGTATGGACGAAACCGTCACGGTCGAA, and the reverse primer sequence is TTCGACCGTGACGGTTTCGTCCATACGGGT.

7. The salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The mutation sites of the uridine cytidine kinase also include V98D, P141E and N155D.

8. A highly salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The mutation sites of the uridine cytidine kinase also include K63E, V98D, T108D, P141E, N155D, P192D, R193E and I199D.

9. A highly salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The mutation sites of the uridine cytidine kinase also include K63E, A89E, V98D, T108D, P141E, N155D, G158D, K170D, Q178E, Q185E, P192D, R193E, K196D, and I199D.

10. The application of the salt-tolerant uridine cytidine kinase mutant according to claim 1, characterized in that: The highly salt-tolerant uridine cytidine kinase mutant is used in the preparation of cytidine acid, uridine acid, cytidine triphosphate, and uridine triphosphate.

Images