Wheat ta ppk13 mutant and application

Abstract

The present application relates to the technical field of plant genetic engineering, and particularly to a wheat TaPPKL3 mutant and application. The wheat TaPPKL3 mutant includes TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D; the amino acid sequence of the TaPPKL3-5A is shown as SEQ ID NO:1, the amino acid sequence of the TaPPKL3-5B is shown as SEQ ID NO:2, and the amino acid sequence of the TaPPKL3-5D is shown as SEQ ID NO:3. The wheat TaPPKL3 mutant obtained by the present application can be used for breeding of a new wheat variety with dwarf, short spike and increased grain width, and has an important role in improving and modifying wheat crop germplasm resources.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and particularly relates to a wheat TaPPKL3 mutant and application thereof. BACKGROUND

[0002] Wheat is one of the three major crops in the world, and is the main source of food for human beings. The yield and quality of wheat are directly related to food security and agricultural economic development. The factors affecting the yield of wheat mainly include effective tiller number per plant, grain number per spike and grain weight. However, in the actual breeding process, there is a complex mutual restraint relationship among the three yield factors. The improvement of a single yield factor is often accompanied by the decrease of other factors, which limits the overall improvement of wheat yield and leads to the difficulty in simultaneous improvement of high-yield traits. Traditional breeding is difficult to break through the trade-off relationship among these traits, and it is urgent to analyze the synergistic regulation mechanism from the molecular level.

[0003] Plant growth and development are regulated by a complex signal network, in which protein phosphatases precisely control the signal transduction process through reversible phosphorylation modification. PPKL (Phosphatase Pseudokinase and Leucine-rich repeat) is a special phosphatase, and its N-terminal contains several Kelch-like repeat sequences, which have evolved unique regulatory functions in plants. In wheat, the research on PPKL protein is still shallow, and its function in regulating important agronomic traits such as plant height, spike length and grain width has not been reported. Therefore, it is of great significance to study the mechanism of TaPPKL gene for wheat molecular breeding. SUMMARY

[0004] The present application aims to provide a wheat TaPPKL3 mutant and application thereof.

[0005] To achieve the above-mentioned purpose, the present application provides the following technical scheme:

[0006] In a first aspect of the present application, a wheat TaPPKL3 mutant is provided, wherein the wheat TaPPKL3 mutant includes TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D.

[0007] The amino acid sequence of the TaPPKL3-5A is shown as SEQ ID NO: 1, the amino acid sequence of the TaPPKL3-5B is shown as SEQ ID NO: 2, and the amino acid sequence of the TaPPKL3-5D is shown as SEQ ID NO: 3.

[0008] In some embodiments, the wheat TaPPKL3 mutant of the present application is caused by the deletion, addition, truncation, substitution, etc. of the gene sequence of the three homologous copies of the TaPPKL3 gene (TaPPKL3-5A, TaPPKL3-5B, TaPPKL3-5D) of wheat through the operation of the three homologous copies of the TaPPKL3 gene.

[0009] In some embodiments, the wheat TaPPKL3 mutant of the present application can be obtained by gene editing of the wheat TaPPKL3 gene.

[0010] In some embodiments, the wheat TaPPKL3 mutant of the present application can be obtained by CRISPR-based gene editing technology. The site-specific nuclease can induce a double-strand break (DSB) at the target site of the genomic sequence, which is then repaired by the natural process of homologous recombination (HR) or non-homologous end joining (NHEJ), thereby causing the deletion, addition, truncation, substitution, etc. of the TaPPKL3 gene sequence; or by adding an exogenous donor template, thereby causing the mutation of the wheat TaPPKL3 protein.

[0011] In a second aspect of the present application, a nucleic acid molecule encoding the wheat TaPPKL3 mutant of the present application is provided.

[0012] The nucleic acid molecule is selected from the group consisting of a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

[0013] The nucleic acid molecule can be single-stranded or double-stranded.

[0014] The nucleic acid molecule can further comprise an additional helper element selected from the group consisting of a signal peptide, a secretion peptide, a tag sequence (such as 6His), a nuclear localization signal, or a combination thereof.

[0015] The nucleic acid molecule further comprises a promoter operably linked to the ORF sequence encoding the mutant polypeptide.

[0016] The promoter is selected from the group consisting of a constitutive promoter, a tissue-specific promoter, an inducible promoter, or a strong promoter.

[0017] In some embodiments, the nucleic acid molecule comprises a gene as shown in (a1) or (a2) or (a3) below:

[0018] (a1) a cDNA molecule encoding an amino acid sequence as shown in SEQ ID NO: 1, or, a deletion of the base corresponding to position 329 of the wheat TaPPKL3-5A gene sequence as shown in SEQ ID NO: 4;

[0019] (a2) a cDNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 2, or, in which the bases from 325 to 326 corresponding to the sequence of the wheat TaPPKL3-5B gene as set forth in SEQ ID NO: 5 are deleted;

[0020] (a3) a cDNA molecule encoding an amino acid sequence as set forth in SEQ ID NO: 3, or, in which the bases from 323 to 327 corresponding to the sequence of the wheat TaPPKL3-5D gene as set forth in SEQ ID NO: 6 are deleted.

[0021] In a third aspect of the present application, there is provided an expression cassette or a vector comprising the nucleic acid molecule of the present application.

[0022] In some embodiments, the expression cassette comprises the nucleic acid molecule of the present application and a regulatory element operably linked thereto.

[0023] The regulatory element is selected from one or more of the group consisting of enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0024] In some embodiments, the vector comprises a nucleic acid molecule encoding the wheat TaPPKL3 mutant of the present application. Preferably, the vector further comprises an expression regulatory element operably linked to the nucleic acid molecule.

[0025] In some embodiments, the vector comprises a cloning vector, an expression vector, a shuttle vector or an integration vector.

[0026] In some embodiments, the vector can be a vector for gene editing of the endogenous TaPPKL3 gene in the host cell.

[0027] In some embodiments, the expression vector further comprises at least one replication origin to enable self-replication.

[0028] In some embodiments, the vector can be a vector that is integrated into the genome and replicated together with the chromosome into which it is integrated when introduced into a host cell.

[0029] The vector can be of the type of plasmid, virus, cosmid, bacteriophage, etc., which are well known to those skilled in the art. Preferably, the vector in the present application is a plasmid.

[0030] In some embodiments, the present application provides an editing vector system comprising one or more vectors, which comprises at least a guide sequence targeting a parent TaPPKL3 protein-coding gene. The guide sequence comprises a partial nucleotide sequence of the parent TaPPKL3 protein-coding gene, preferably at least 15 bp of the nucleotide sequence of the TaPPKL3 protein-coding gene, more preferably at least 20 bp of the nucleotide sequence of the TaPPKL3 protein-coding gene.

[0031] In some embodiments, the editing vector system further comprises a gene editing enzyme, which comprises a nuclease of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats), TALEN (Tanscription Activator-like (TAL) effector nucleases), ZFN (Zinc finger nucleases) editing tools.

[0032] In some embodiments, the gene editing enzyme is a Cas protein, also known as CRISPR enzyme or Cas effector protein, which includes but is not limited to: Cas9 protein, Cas12 protein, Cas13 protein, Cas14 protein, Csm1 protein, FDK1 protein. Preferably, the Cas protein is operably linked to a first regulatory element.

[0033] In some embodiments, the gene editing enzyme is a Cas9 protein, and the vector further comprises a Scaffold sequence that can specifically bind to the Cas9 protein. After the Scaffold sequence is operably linked to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

[0034] In other embodiments, the gene editing enzyme is a Cas12 protein, such as Cas12a, Cas12b, Cas12i, and the vector further comprises a Direct Repeat sequence that can specifically bind to the Cas12 protein. After the Direct Repeat sequence is operably linked to the guide sequence, a guide guide sequence (gRNA) is formed. Preferably, the gRNA is operably linked to a second regulatory element.

[0035] The above-mentioned regulatory elements include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).

[0036] In some embodiments, a resistance gene is further comprised in the editing vector to facilitate screening, which includes hyg, bar, kana, rif, spec, amp, which are well known to those skilled in the art.

[0037] In some embodiments, the Cas protein is selected from nCas9 or other nick- active Cas9 proteins. Wherein "n" represents nick, i.e., Cas protein only has single strand cleavage activity.

[0038] In a fourth aspect of the present application, a host cell is provided, which comprises the nucleic acid molecule or the expression cassette or the vector of the present application, or the nucleic acid molecule is integrated into the genome of the host cell.

[0039] In some embodiments, the host cell is a eukaryotic cell, such as a yeast cell or an animal cell or a plant cell.

[0040] In some embodiments, the host cell is a prokaryotic cell, such as E. coli.

[0041] In some embodiments, the plant includes angiosperms and gymnosperms.

[0042] In some embodiments, the plant includes monocotyledons and dicotyledons.

[0043] In some embodiments, the plant includes herbaceous plants and woody plants.

[0044] In some embodiments, the plant includes wheat, maize, Arabidopsis, tobacco, rice, sorghum, barley, millet, soybean, tomato, potato, quinoa, lettuce, rape, Chinese cabbage, strawberry, etc.

[0045] In a fifth aspect of the present application, the wheat TaPPKL3 mutant, the nucleic acid molecule, the expression cassette or the vector, and the host cell of the present application are used in any one of the following aspects:

[0046] (b1) regulating the plant height of wheat;

[0047] (b2) regulating the ear length of wheat;

[0048] (b3) regulating the grain width or yield of wheat;

[0049] (b4) regulating the tiller number of wheat;

[0050] (b5) breeding a dwarf wheat variety;

[0051] (b6) wheat breeding.

[0052] In some embodiments, the modulating the plant height of wheat is negatively modulating the plant height of wheat, or, decreasing the plant height of wheat.

[0053] In some embodiments, the decreasing the plant height of wheat refers to the plant height of a wheat plant comprising the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application is lower than that of a wheat plant comprising wild type parent TaPPKL3 protein.

[0054] The plant height refers to the height from the ground to the highest point of the wheat.

[0055] In some embodiments, the plant height of a wheat plant comprising the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application is decreased by about 10%-90%, e.g., 15%, 20%, 25%, 30%, 35%, 40%, 45%, 55%, 60%, 65%, 70%, 75%, 80%, 85% compared to that of a wild type parent.

[0056] In some embodiments, the modulating the ear length of wheat is negatively modulating the ear length of wheat, or, decreasing the ear length of wheat.

[0057] In some embodiments, the decreasing the ear length of wheat refers to the ear length of a wheat plant comprising the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application is lower than that of a wheat plant comprising wild type parent TaPPKL3 protein.

[0058] In some embodiments, the modulating the grain width or yield of wheat is positively modulating the grain width or yield of wheat, or, increasing the grain width.

[0059] In some embodiments, the increasing the grain width refers to the grain width of a wheat plant comprising the wheat TaPPKL3 mutant, nucleic acid molecule, expression cassette or vector, host cell of the present application is increased by about 5%-30%, e.g., 5%, 8%, 10%, 15%, 20%, 25%, 30% compared to that of a wild type parent.

[0060] In some embodiments, the modulating the tiller number of wheat refers to negatively modulating the tiller number of wheat, or, decreasing the tiller number of wheat.

[0061] In a sixth aspect, the present application provides a method for reducing the plant height of wheat, comprising the step of introducing the wheat TaPPKL3 mutant of the present application into a plant cell, a plant seed, a plant tissue, a plant part or a plant.

[0062] In a seventh aspect, the present application provides a method for breeding a dwarf wheat variety, comprising the step of introducing the wheat TaPPKL3 mutant of the present application into a plant cell, a plant seed, a plant tissue, a plant part or a plant.

[0063] In an eighth aspect, the present application provides a method for increasing the length and width of wheat grains, comprising the step of introducing the wheat TaPPKL3 mutant of the present application into a plant cell, a plant seed, a plant tissue, a plant part or a plant.

[0064] In the above-mentioned methods, introducing the wheat TaPPKL3 mutant of the present application comprises the step of expressing the TaPPKL3 mutant protein in a plant cell, a plant tissue, a plant part or a plant, for example, the step of expressing the mutant protein by means of an expression vector, or the step of integrating the nucleic acid molecule encoding the mutant protein into the plant genome for expression.

[0065] In some embodiments, introducing the wheat TaPPKL3 mutant of the present application comprises the step of mutating and expressing the endogenous TaPPKL3 protein-encoding gene of a plant.

[0066] In some embodiments, the TaPPKL3 mutant comprises deletion, addition, truncation, substitution, etc. of TaPPKL3.

[0067] In the above-mentioned methods, the method for introducing the mutation comprises natural variation, physical mutagenesis (such as UV mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (such as nitrous acid, hydroxylamine, EMS, nitroso guanidine, etc.), biological mutagenesis (such as virus or bacteria-mediated mutagenesis), gene editing.

[0068] It should be further noted that, since wheat is an allohexaploid, the TaPPKL3 gene comprises three copies of TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D, and thus, the above-mentioned three homologous copies of the gene need to be edited simultaneously.

[0069] Those skilled in the art can easily mutate the nucleotide sequence of the TaPPKL3 gene of the present application by means of known methods, such as site-directed mutagenesis (including oligonucleotide primer-mediated site-directed mutagenesis, PCR-mediated site-directed mutagenesis and cassette mutagenesis, etc.) or directed evolution (including error-prone PCR, DNA shuffling and in vitro random priming recombination, etc.).

[0070] Based on the above technical scheme, the application has the following technical effects:

[0071] 1. The application screens a group of mutant wheat TaPPKL3 gene sequences.

[0072] 2. The application designs a guide single-stranded RNA (sgRNA) targeting the TaPPKL3 gene, constructs an expression vector that can knock out the TaPPKL3 gene in wheat in vivo, and obtains offspring with a knocked-out TaPPKL3 gene by genetic transformation of wheat. ko- tapppkl3-15#, Compared with the wild type, the plant height, ear length and tiller number are reduced, the grain width is increased, and the thousand-grain weight has no significant difference.

[0073] 3. The application provides a feasible method for realizing rapid breeding and cultivating lodging-resistant wheat by using genetic engineering technology, and has important breeding application value. BRIEF DESCRIPTION OF DRAWINGS

[0074] Figure 1 For the three homologous copies in the embodiment of the application that all undergo gene editing ko-tappkl3-15# Sequencing results

[0075] Figure 2 For the wild type protein encoded by the homologous copy gene TaPPKL3-5A in the embodiment of the application and the strain that undergoes gene editing ko-tappkl3-15# Comparison of protein encoded by the homologous copy gene TaPPKL3-5A in the embodiment of the application and the strain that undergoes gene editing

[0076] Figure 3 For the wild type protein encoded by the homologous copy gene TaPPKL3-5B in the embodiment of the application and the strain that undergoes gene editing ko-tappkl3-15# Comparison of protein encoded by the homologous copy gene TaPPKL3-5B in the embodiment of the application and the strain that undergoes gene editing

[0077] Figure 4 For the wild type protein encoded by the homologous copy gene TaPPKL3-5D in the embodiment of the application and the strain that undergoes gene editing ko-tappkl3-15# Comparison of protein encoded by the homologous copy gene TaPPKL3-5D in the embodiment of the application and the strain that undergoes gene editing

[0078] Figure 5 For the three homologous copies in the embodiment of the application that all undergo gene editing ko-tappkl3-15# Amplification fragment of the editing site of the strain, wherein: 1 is Transgen 2K plus marker, 2-12 is ko-tappkl3-15# Results of PCR amplification fragments of offspring, 13 is the result of PCR amplification fragments in JW1, and 14 is the result of negative control amplification with water as a template

[0079] Figure 6JW1 and homozygous gene knockout strains in the embodiments of the present application ko-tappkl3-15# Comparison of agronomic traits such as plant height, ear length and grain width; wherein: A is a picture of a wheat plant taken at the same time, B is a comparison of plant height, C is a comparison of tiller number, D is a comparison of effective tiller number, E is a picture of a wheat ear type taken at the same time, F is a comparison of ear length, G is a comparison of spikelet number, H is a comparison of thousand-grain weight, I is a schematic diagram of grain length, J is a comparison of grain length, K is a schematic diagram of grain width, and L is a comparison of grain width; in the figure, different letters above the column chart indicate that there is a significant difference between different samples in statistics, and the same letter indicates that there is no significant difference. DETAILED DESCRIPTION

[0080] The present application will be further described in detail below in conjunction with specific embodiments, and the embodiments given are only for the purpose of illustrating the present application, but not for limiting the scope of the present application. The embodiments provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not in any way constitute a limitation on the present application.

[0081] The experimental methods in the following examples are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.

[0082] As described previously, mining the key genes controlling grain size and plant height has important application value for wheat strain improvement and high-yield variety breeding.

[0083] Therefore, the present application has conducted in-depth research on the genes regulating wheat grain size and plant height. The present application uses wild-type wheat variety JW1 as experimental material, and uses CRISPR / Cas9 gene editing technology to mutate the wheat TaPPKL3-5A gene, TaPPKL3-5B gene and TaPPKL3-5D gene as follows:

[0084] (1) The 329th base corresponding to the sequence of the wheat TaPPKL3-5A gene shown in SEQ ID NO: 4 is deleted, causing a frameshift mutation, and the reading frame changes, and the mutant protein TaPPKL3-5A starts to have a frameshift from the 109th amino acid, and the corresponding function of the gene is lost.

[0085] (2) The 325th to 326th bases corresponding to the sequence of the wheat TaPPKL3-5B gene shown in SEQ ID NO: 5 are deleted, causing a frameshift mutation, and the reading frame changes, and the mutant protein TaPPKL3-5B starts to have a frameshift from the 109th amino acid, and the corresponding function of the gene is lost.

[0086] (3) deletion of the bases corresponding to positions 323-327 of the sequence of the wheat TaPPKL3-5D gene shown in SEQ ID NO: 6, resulting in a frame shift mutation, the reading frame changes, and the mutant protein TaPPKL3-5D has a frame shift starting from the 108th amino acid, and the corresponding function of the gene is lost.

[0087] The wheat TaPPKL3 mutant obtained by the above mutation treatment has an amino acid sequence of TaPPKL3-5A shown in SEQ ID NO: 1, an amino acid sequence of TaPPKL3-5B shown in SEQ ID NO: 2, and an amino acid sequence of TaPPKL3-5D shown in SEQ ID NO: 3.

[0088] By comparing the wheat TaPPKL3 mutant and the wild type wheat variety JW1, it is found that the plant height and ear length of the wheat TaPPKL3 mutant are significantly reduced, the grain width is significantly increased, the tiller number is reduced, and the thousand-grain weight yield has no obvious difference from the wild type. Therefore, by means of existing genetic engineering, site-directed mutation treatment can be performed on the wheat TaPPKL3-5A gene, TaPPKL3-5B gene and TaPPKL3-5D gene to obtain a wheat mutant with reduced plant height and increased grain length and width, thereby laying a foundation for the cultivation of dwarf and lodging-resistant wheat.

[0089] The high-fidelity enzyme required for PCR amplification is KOD-FX NEO (Toyobo); the restriction endonuclease BsaI required for Gibson assembly and the T4 ligase are both purchased from the NEB company; the gel recovery kit and the plasmid extraction kit required for enzyme digestion fragment recovery are both purchased from Thermo Fisher Scientific. The inorganic salts required for medium preparation are purchased from the National Pharmaceutical Group, and the vitamins and antibiotics are purchased from the Sigma company. The E. coli strain used in the present application is E. coli Transgen 5α, purchased from Beijing Quanshi Gold Company.

[0090] The wheat variety JW1 used in the present application is a new germplasm with good tissue culture ability selected by the Crop Institute of Shandong Agricultural Academy, and the public can obtain it from the Crop Institute of Shandong Agricultural Academy. This biological material is only used for repeating the related experiments of the present application and cannot be used for other purposes.

[0091] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0092] Example 1 Design and expression vector of sgRNA

[0093] 1. Design of sgRNA targeting TaPPKL3

[0094] The TaPPKL3 gene exists one copy on chromosome 5A, 5B and 5D of wheat (TaPPKL3-5A, TaPPKL3-5B, TaPPKL3-5D), respectively. The nucleotide sequence of TaPPKL3 gene in A genome has 100% sequence similarity with the sequence of gene TraesCS5A02G030300 (Chromosome 5A: 26,440,090-26,449,927 forward strand.) in Ensembl Plants database (http: / / plants.ensembl.org / index.html), and the nucleotide sequence of coding region (CDS) of TaPPKL3-5A is shown in SEQ ID NO: 4; the nucleotide sequence of TaPPKL3 gene in B genome has 100% sequence similarity with the sequence of gene TraesCS5B02G029100 (Chromosome 5B: 27,830,119-27,840,027 reverse strand.) in Ensembl Plants database, and the nucleotide sequence of coding region (CDS) of TaPPKL3-5B is shown in SEQ ID NO: 5; the nucleotide sequence of TaPPKL3 gene in D genome has 100% sequence similarity with the sequence of gene TraesCS5D02G038500 (Chromosome 5D: 37,321,983-37,331,860 forward strand.) in Ensembl Plants database, and the nucleotide sequence of coding region (CDS) of TaPPKL3-5D is shown in SEQ ID NO: 6.

[0095] To design sgRNA capable of editing in the coding region of TaPPKL3 gene, suitable targeting sites were searched in the coding region of TaPPKL3 gene through website CRISPRdirect (http: / / crispr.dbcls.jp / ), and 20 bp sequence fragments before or after PAM structure were set as target sequences. One of the sgRNAs was taken as an example for knockout experiment, and its nucleotide sequence was CAGCGGCTGATCCTCTTCGG (SEQ ID NO: 7).

[0096] 2. pBUE411-TaPPKL3 binary expression vector

[0097] The embodiment adopts a plant CRISPR / Cas9 gene editing vector pBUE411 containing a wheat U3 promoter TaU3 to start sgRNA, and Cas9 simulates the characteristics of a higher GC content at the 5' end of a grass gene, which is a plant codon-optimized gene designed and synthesized. The plasmid pBUE411 is publicly available from China Agricultural University, and its sequence is known, with a length of 17430 bp.

[0098] The plant binary expression vector pBUE411-TaPPKL3 is composed of expression cassette E1 and expression cassette E2; wherein expression cassette E1 is, from upstream to downstream, TaU3 promoter from wheat, sgRNA targeting TaPPKL3 gene, and terminator T1; expression cassette E2 is, from upstream to downstream, ubiquitin promoter Ubi from corn, corn Cas9 coding sequence, and terminator T2. The nucleotide sequences of the wheat TaU3 promoter TaU3, the terminator T1, the corn ubiquitin promoter Ubi, the corn Cas9 coding sequence, and the terminator T2 have been disclosed in the patent “202411320638.3”. The nucleotide sequence information of pBUE411-TaPPKL3 is: the 802th to 821th bases in the nucleotide sequence of the plant binary expression vector pBUE411-TaPND in the patent “202411320638.3” are replaced by cagcggctgatcctcttcgg (SEQ ID NO: 7), which is the nucleotide sequence of the plant binary expression vector pBUE411-TaPPKL3 of the present application.

[0099] Example 2: Obtaining and identifying of transgenic offspring

[0100] 1. Obtaining of TaPPKL3 transgenic offspring

[0101] The plant binary expression vector pBUE411-TaPPKL3 in Example 1 is transformed into Agrobacterium EHA105 competent cells, specifically: the plant binary expression vector pBUE411-TaPPKL3 is added to Agrobacterium EHA105 competent cells for ice bath for 5 min, quick freezing in liquid nitrogen for 5 min, 37°C heat shock reaction for 5 min, then ice bath for 5 min, adding LB without antibiotics, and placing in a 28°C shaker for recovery for 2 h, then coating on LB (containing rifampicin, streptomycin and kanamycin) plates with a coater, and 28°C inverted culture until the clones grow out. Single clones are picked and inoculated in LB culture solution containing corresponding antibiotics, and cultured at 28°C with shaking at 160 rpm for 24 hours.

[0102] Take the JW1 wheat seeds about 15 days after pollination, and peel the young embryos. Take 1 mL of bacterial solution in a 1.5 mL centrifuge tube, add 1.4 μL of acetyl-piperitone (0.1M) and mix well. After 5 minutes of infection with the prepared bacterial solution, place it on the co-culture medium and incubate it in the dark at 23°C for 3 days. After co-culture, place it on the rest medium and incubate it in the dark at 25°C for 5 days. Transfer the callus to the screening medium 1, seal the petri dish with sealing film, and incubate it in the dark at 25.5°C for 2 weeks. After cutting the callus, transfer it to the screening medium 2, seal the petri dish again with sealing film, and continue to incubate it in the dark at 25.5°C for 2 weeks. After 2 weeks of callus cutting and screening, transfer the resistant callus showing green bud spots to the regeneration medium. Seal the petri dish, place it in the 25°C incubator with light / dark (16 h / 8 h) for 2 weeks. After 2 weeks of regeneration, transfer the healthy growing seedlings to a new resistant regeneration box. When the seedlings grow to a certain size, they can be sampled for detection.

[0103] The various media involved in the above wheat genetic transformation and their preparation are described in the following document: Kan Wang (ed.), Agrobacterium Protocals: Volume 1, Methods in Molecular Biology, vol. 1223 DOI 10.007 / 978-1-4939-1695-5_15, Spring Science+Businedd Media New York 2015. The formulations of co-culture medium, rest medium, screening medium 1, screening medium 2 and regeneration medium are shown in Table 1.

[0104] Table 1 Medium formulation

[0105]

[0106] The young leaves of regenerated wheat were taken, and the genomic DNA was extracted by CTAB method, and PCR identification was performed by using primers on two vectors BUE-DF1 (TCATTGAGCAGATTTCCGAGT, SEQ ID NO: 8) and BUE-DR1 (ATTTGCAGCTTTTCTAGGTCT, SEQ ID NO: 9). The PCR reaction system was as follows: 2x PCR master mix: 10 μL, BUE-DF1 (10 μM): 0.5 μL, BUE-DR1 (10 μM): 0.5 μL, gDNA (50 ng / μL): 1 μL, ddH2O: 8 μL. The PCR reaction program was as follows: 95 ℃ pre-denaturation for 5 min, 95 ℃ denaturation for 30 s; 58 ℃ annealing for 30 s, 72 ℃ extension for 30 s, 32 cycles of reaction; 72 ℃ recombination for 5 min.

[0107] 2. Identification of TaPPKL3 transgenic knockout offspring

[0108] Wheat is an allohexaploid, TaPPKL3 gene is a copy on chromosome 5A, and the homologous copies on chromosomes 5B and 5D are TaPPKL3-5B and TaPPKL3-5D. The DNA sequences of the three copies are highly homologous, and the gene editing of the three homologous copies needs to be detected simultaneously. In this experiment, the Hi-TOM gene editing site detection kit purchased from Xi'an Qingxue Biotechnology Co., Ltd. was used. The kit completes the high-throughput library construction process by PCR, and the variation information of multiple samples and multiple sites is directly analyzed by Hi-TOM online software. The specific primers Seq-F (ggagtgagtacggtgtgcCCGTGACCGCGCGGGGGATCTCGAGCT, SEQ ID NO: 10) and Seq-R (gagttggatgctggatggGCCGTACGGATCCCGGCGCTCCCAGCC, SEQ ID NO: 11) containing the target sequence on both sides were used to amplify TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D at the same time. The first round of PCR reaction system: wheat plant leaf DNA transformed with pBUE411-TaPPKL3 gene as template 1 μL, 2× Taq Master Mix in the kit 10 μL, Seq-F and Seq-R (10 μM) each 0.5 μL, Nuclease-free Water to make up the volume to 20 μL. The PCR reaction conditions are as follows: 94 ℃ pre-denaturation for 2 min; 94 ℃ denaturation for 30 s, 64 ℃ annealing for 30 s, 72 ℃ extension for 20 s, a total of 32 cycles; finally 72 ℃ extension for 5 min. After PCR, 5 μL of the PCR product was detected by agarose gel electrophoresis to ensure the presence of the target product and good specificity. Then the second round of PCR reaction was carried out, Hi-TOM Mix in the kit 12 μL, 1 μL of the first round of PCR product as template, Nuclease-free Water to make up the volume to 20 μL. PCR reaction program: 94 ℃ denaturation for 2 min; 94 ℃ denaturation for 30 s, 58 ℃ annealing for 30 s, 72 ℃ extension for 25 s, a total of 33 cycles; finally 72 ℃ extension for 5 min. The amplified products were mixed and gel recovered, and the gel recovery products were used as library sequencing samples, which were then sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing.

[0109] The gene editing results of the target genes TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D are shown in Figure 1 , in which the yellow CGG is the PAM structure. The wild-type protein encoded by the homologous gene TaPPKL3-5A is compared with the protein encoded by the edited strain ko-tappkl3-15# . Figure 2As shown, the wild-type protein encoded by the homologous copy gene TaPPKL3-5B is different from the strain with gene editing ko-tappkl3-15# The comparison of the encoded proteins is shown in Table 3. Figure 3 As shown, the wild-type protein encoded by the homologous copy gene TaPPKL3-5D is different from the strain with gene editing ko- tappkl3-15# The comparison of the encoded proteins is shown in Table 3. Figure 4 As shown, after alignment, the mutant protein tappkl3-5a has a frame shift starting from the 109th amino acid; the protein tappkl3-5b has a frame shift starting from the 109th amino acid; and the protein tappkl3-5d has a frame shift starting from the 108th amino acid. The results show that the sgRNA and Cas9 elements are successfully transformed and function, and the TaPPKL3 gene is edited, resulting in the premature termination of translation of the TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D three proteins, and the loss of the corresponding function of the gene.

[0110] Example 3: Phenotype identification of wheat after knocking out TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D genes

[0111] To obtain a homozygous knockout strain of the three homologous copies of TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D, a cleavage amplification polymorphism sequence (Caps) marker is developed for the editing site, and the offspring of the gene editing mutant is identified until a homozygous mutant with simultaneous knockout of TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D is obtained.

[0112] The TaPPKL3-5A, TaPPKL3-5B and TaPPKL3-5D genes of the gene editing offspring are amplified by PCR using Seq-F (SEQ ID NO: 10) and Seq-R (SEQ ID NO: 11). The PCR reaction system is as follows: KOD-FX NEO buffer: 10 μL, dNTP (2 mM): 4 μL, Seq-F (10 μM): 0.6 μL, Seq-R (10 μM): 0.6 μL, gene knockout strain gDNA (about 20 ng / μL): 1 μL, KOD-FX NEO: 0.4 μL, ddH2O to 20 μL. The PCR reaction program is as follows: 98 ℃ pre-denaturation for 2 min, 98 ℃ denaturation for 12 s; 58 ℃ annealing for 20 s, 68 ℃ extension for 45 s, 35 cycles; 68 ℃ reannealing for 5 min.

[0113] The amplification products are detected by electrophoresis, and the results are shown in Table 4. Figure 5The amplification product was sent to Xi'an Qingxue Biotechnology Co., Ltd. for sequencing, and the gene editing results are shown in Figure 1 The transgenic homozygous three-copy gene knockout lines were screened out ko- tappkl3-15# .

[0114] The wild type receptor variety JW1 and the homozygous knockout lines screened out ko-tappkl3-15# were respectively planted in the greenhouse of Qingdao campus of Shandong University (120.41 °E, 36.07 °N), and the culture conditions were as follows: light / dark = 16 / 8 h; daytime temperature 22 °C, nighttime temperature 16 °C; humidity between 40% ~ 50%; CO2 concentration 500 ppm ~ 700 ppm. During the filling period, the plant height, tiller number and main ear length of wheat were counted, and the plant morphology of the wild type and knockout mutants was photographed using a high-performance single reflex camera. At the middle-late stage of the ripening period, the wheat was harvested per plant, and the morphology of the ear and spikelet was photographed, and the grain width was counted. The thousand-grain weight of wheat was counted. The harvested wheat seeds were placed in a constant temperature incubator at 37 °C for continuous drying for 14 d, and the length and width of the wheat grains of JW1 and ko-tappkl3-15# were photographed and counted. As shown in A, B, C and D in Figure 6 , the plant height, tiller number and effective tiller number of the homozygous knockout mutants were significantly decreased compared with the wild type, Figure 6 E in Figure 6 , the ear type of the homozygous knockout mutants compared with the wild type JW1, as shown in F and G in Figure 6 , the ear length and spikelet number of the homozygous knockout mutants compared with the wild type JW1 were significantly decreased, as shown in H in Figure 6 , the thousand-grain weight of the homozygous knockout mutants compared with the wild type JW1 had no significant difference; as shown in I and J in Figure 6 , the grain length of the homozygous knockout mutants compared with the wild type JW1 had no significant difference; as shown in K and L in , the grain width of the homozygous knockout mutants compared with the wild type JW1 was significantly increased. The above results show that TaPPKL3 has a regulatory effect on the plant height, tiller number, ear grain number and wheat grain development of wheat.

[0115] Finally, it should be noted that the above only describes the preferred embodiments of the present application and is not intended to limit the present application. Although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent replacements of some parts. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. The application of knocking out the wheat TaPPKL3 gene in reducing wheat plant height, characterized by: The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

2. The application of knocking out the wheat TaPPKL3 gene in reducing wheat spike length, characterized by, The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

3. The application of knocking out the wheat TaPPKL3 gene in increasing wheat grain width, characterized by: The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

4. The application of knocking out the wheat TaPPKL3 gene in reducing wheat tiller number, characterized in that, The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

5. The application of knocking out the wheat TaPPKL3 gene in the breeding of dwarf wheat varieties, characterized in that, The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

6. The application of knocking out the wheat TaPPKL3 gene in wheat breeding, characterized by: The wheat TaPPKL3 gene has three copies, A, B and D, in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6; the application is achieved by simultaneously knocking out the three copies A, B and D of the TaPPKL3 gene in wheat.

7. A method for reducing wheat plant height, characterized in that, This includes using gene editing technology to knock out the gene encoding the endogenous TapPKL3 protein in a plant, wherein the plant is wheat; The wheat TapPKL3 protein encoding gene has three copies (A, B, and D) in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO:

6.

8. A method for breeding dwarf wheat varieties, characterized in that, This includes using gene editing technology to knock out the gene encoding the endogenous TapPKL3 protein in a plant, wherein the plant is wheat; The wheat TapPKL3 protein encoding gene has three copies (A, B, and D) in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO:

6.

9. A method for increasing the width of wheat grains, characterized in that, This includes using gene editing technology to knock out the gene encoding the endogenous TapPKL3 protein in a plant, wherein the plant is wheat; The wheat TapPKL3 protein encoding gene has three copies (A, B, and D) in wheat, and its coding sequence is shown in SEQ ID NO: 4~SEQ ID NO: 6.

Images